A recombinant plasmid, a construction method and application thereof in improving the synthesis ability of aphanizomenoidin

By constructing recombinant plasmids in Nostoc commune and overexpressing the ScyR regulator gene, the stability and efficiency issues of pseudocranophane biosynthesis were resolved, resulting in a significant increase in the pseudocranophane content in Nostoc commune.

CN120758539BActive Publication Date: 2026-03-27SICHUAN UNIVERSITY OF SCIENCE AND ENGINEERING
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511075495.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-01
Publication Date
2026-03-27
Estimated Expiration
2045-08-01

AI Technical Summary

Technical Problem

Existing technologies struggle to achieve stable and efficient biosynthesis of pseudocranophane in non-model algal strains, especially in Escherichia coli where pseudocranophane dimers cannot be generated.

Method used

A recombinant plasmid was constructed, containing a vector plasmid, an sgRNA target sequence, an HR homologous sequence, a psbA promoter sequence, and a ScyR regulator gene. The ScyR regulator gene was overexpressed in Nostoc commune using CRISPR/Cpf1 gene editing technology to enhance the synthesis of pseudocladophytin.

Benefits of technology

It significantly increased the biosynthesis of pseudocranophane in Nostoc commune, resulting in an increase in pseudocranophane content under suitable conditions, reaching 2.4 times that of the wild type.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120758539B_ABST
    Figure CN120758539B_ABST
Patent Text Reader

Abstract

This invention relates to the field of genetic engineering technology, specifically to a recombinant plasmid, its construction method, and its application in enhancing the synthesis of pseudocladocerin from Nostoc flagelliforme. The recombinant plasmid includes a vector plasmid, and sgRNA target sequences, HR homologous sequences, psbA promoter sequences, and other components linked to the vector plasmid. ScyR Regulatory genes. This recombinant plasmid can be used in black moss. MAAs Overexpression of key regulatory genes at gene cluster sites significantly enhanced the pseudocranophane synthesis capacity of Nostoc commune. The Nostoc mutant obtained by transforming this recombinant plasmid into Nostoc commune exhibited a pseudocranophane content 2.4 times higher than that of wild-type Nostoc commune after 15 days of culture.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a recombinant plasmid, its construction method, and its application in improving the synthesis ability of pseudocladophyte in Nostoc commune. Background Technology

[0002] Scytonemin is a fat-soluble aromatic alkaloid pigment that exhibits significant application potential in the daily chemical and pharmaceutical industries due to its excellent ultraviolet absorption and antioxidant properties. In the daily chemical field, as a natural sunscreen active ingredient, its highly effective photoprotective efficacy has attracted considerable attention from the dermatology and cosmetics industries. In the medical field, its significant anti-inflammatory and anti-proliferative properties further highlight its potential as a novel small-molecule drug. Furthermore, scytonemin also has important ecological significance for cyanobacteria; the complex it forms with iron can promote the survival of cyanobacterial communities in sandstone environments, making it one of the key factors for cyanobacteria's adaptation to their natural environment.

[0003] Currently, the synthesis methods for pseudocranophanes are mainly divided into two categories: chemical synthesis and biosynthesis. In chemical synthesis, based on the chemical structure and properties of pseudocranophanes, previous studies have used 3-indoleacetic acid as a starting material, employing a total of nine chemical reactions including Heck carbocyclization and Suzuki-Miyaura cross-coupling to synthesize pseudocranophanes. While this synthetic route offers high flexibility and is applicable to the preparation of various pseudocranophane derivatives, it also suffers from significant drawbacks such as numerous reaction steps, low conversion rate (only 4%), and high cost. In contrast, biosynthesis demonstrates more prominent advantages and enormous potential.

[0004] biosynthetic gene cluster of pseudocladocanine ( Npun_R1276 - R1259 For the first time in its natural host, cyanobacteria... Nostoc punctiforme The complete solution was obtained in PCC 73102 (Soule et al., J Bacteriol, 2007). Recently, cyanobacteria inhabiting the soil surface in arid regions... Nostoc flagelliforme The biosynthesis of pseudocladocanine was also identified in the study. Scy Gene clusters ( COO91_00773 - 00791 ) and its two regulatory genes ( COO91_00772 - 00771 (Gao et al., MarDrugs, 2021). Currently, Nostoc flagelliforme Cell suspension culture technology has been successfully developed and can be used for large-scale cultivation under laboratory or industrial conditions. It has been reported that UV-B treatment can effectively induce the synthesis of pseudocladocerin in this cell suspension culture.

[0005] However, although important progress has been made in the study of the biosynthetic pathway and regulatory mechanism of scytonemin, the natural host cyanobacterium Nostoc punctiforme PCC 73102 and cyanobacterium Nostoc flagelliforme As a non-model strain, there are great technical difficulties in genetic modification and engineering application, and at present, stable, efficient and green production of scytonemin cannot be realized. Researchers have chosen the most widely used E. coli for industrial fermentation as the chassis cell for scytonemin biosynthesis. However, the E. coli engineering strain carrying the scytonemin biosynthetic gene can only successfully synthesize scytonemin monomer, but cannot generate the final scytonemin dimer.

[0006] In view of this, the present application is proposed. SUMMARY

[0007] Based on the above problems, the purpose of the present application is to provide a recombinant plasmid, a construction method and the application thereof in providing the scytonemin synthesis ability of the hair-like algae. The recombinant plasmid is transformed into the hair-like algae, which can significantly improve the scytonemin biosynthesis ability of the hair-like algae.

[0008] To achieve the above purpose, the first technical solution adopted by the present application is:

[0009] A recombinant plasmid, characterized in that it comprises a vector plasmid, and an sgRNA target sequence, an HR homologous sequence, a psbA promoter sequence and a regulator gene connected to the vector plasmid. ScyR

[0010] Further, the sgRNA target sequence is a hair-like algae MAAs (Clavine amino acid) gene cluster recognition sequence, which is composed of a sequence (20-24 bp) behind the PAM (short structured sequence located at the end of the target DNA in the CRISPR-Cas system) site, and usually 22 bp is selected. The nucleotide sequence of the sgRNA target sequence is shown in SEQ ID NO. 1.

[0011] Further, the HR homologous sequence is a hair-like algae MAAs Gene cluster homologous sequence at both ends, including an upstream homologous arm and a downstream homologous arm, the nucleotide sequence is shown in SEQ ID NO. 2 and SEQ ID NO. 3.

[0012] Further, the psbA promoter sequence is an endogenous promoter sequence from the hair-like algae, and the nucleotide sequence is shown in SEQ ID NO. 4.

[0013] Further, the ScyR Regulator gene is COO91_00771 Gene, the nucleotide sequence is shown in SEQ ID NO. 5, and the amino acid sequence is shown in SEQ ID NO. 6.​

[0014] Further, the vector plasmid is pCpf1b-sp.

[0015] The second technical solution adopted by the application is:

[0016] A construction method of a recombinant plasmid comprises the following steps:

[0017] The sgRNA target sequence and the HR homologous sequence are sequentially connected to the vector plasmid to obtain an intermediate vector;

[0018] The psbA promoter sequence and ScyR The regulator gene is fused and then connected to the intermediate vector.

[0019] In the specific construction process, the HR homologous sequence is amplified by taking the Zostera marina genome DNA as a template, the sgRNA target sequence and the amplified HR homologous sequence are connected to the vector plasmid by using a ready-to-use seamless cloning technology, the psbA promoter sequence and ScyR The regulator gene is respectively amplified by taking the Zostera marina genome DNA as a template and then fused, and then connected to the intermediate vector by using a ready-to-use seamless cloning technology.

[0020] The third technical solution adopted by the application is:

[0021] The above-mentioned recombinant plasmid or the recombinant plasmid constructed according to the construction method of the above-mentioned recombinant plasmid is applied to improving the Zostericolide synthesis capacity.

[0022] Further, the recombinant plasmid is transformed into wild-type Zostera marina, and the Zostericolide synthesis capacity of the Zostera marina is improved by overexpressing MAAs the gene cluster site ScyR The regulator gene.

[0023] The method for transforming the recombinant plasmid into the Zostera marina comprises:

[0024] The recombinant plasmid is transformed into HB101 competent cells by using a heat shock method to obtain a recombinant strain;

[0025] The recombinant strain is mixed with Zostera marina cells and then cultured to obtain transformants;

[0026] The transformants are selected and continuously streaked and cultured, and the Zostera marina mutants are obtained through multiple rounds of resistance screening.

[0027] The fourth technical solution adopted by the application is:

[0028] A Zostera marina mutant, the above-mentioned recombinant plasmid or the recombinant plasmid constructed according to the construction method of the above-mentioned recombinant plasmid is transformed into the Zostera marina to obtain.

[0029] When this *Nostoc* mutant was cultured under suitable conditions, the biosynthetic yield of pseudocladin was significantly increased compared to the wild-type *Nostoc*. The suitable culture environment was: a culture temperature of 24-26 ℃ and a light intensity of 30-50 µmol photonsm. -2 s -1 The shaking speed is 100-150 rpm, and low-intensity UV irradiation is applied for 1-3 hours per day during the cultivation period.

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] This invention is the first to clone black moss. MAAs The gene cluster recognition sequence and its homologous sequences at both ends were recombine into the pCpf1b vector to obtain an intermediate vector, and the psbA promoter sequence was cloned for the first time. ScyR The regulatory gene sequence was extracted and recombined into the intermediate vector to obtain a recombinant plasmid, which can be used in *Nostoc commune*. MAAs Overexpression of key regulatory genes at gene cluster sites can significantly enhance the pseudo-branching phycocyanin synthesis capacity of Nostoc commune.

[0032] This invention successfully cloned a recombinant plasmid and constructed a *Nostoc commune* mutant using CRISPR / Cpf1 gene editing technology. Compared to wild-type *Nostoc commune*, this mutant showed a significant increase in pseudocladin content after cultivation. Attached Figure Description

[0033] Figure 1 This is a schematic diagram of the structure of the recombinant vector in Example 1;

[0034] Figure 2 This is a diagram showing the PCR identification results during the construction of the recombinant vector in Example 1;

[0035] Figure 3 Image of the activated transformant from Example 3;

[0036] Figure 4 This is a graph showing the PCR identification results of the Nostoc mutabilis mutant in Example 3;

[0037] Figures 5-9 The biological content, relative activity, pseudocladophyte content, and chlorophyll content of the mutant and wild-type Nostoc in Example 3 were measured during cultivation. a Results of content and carotenoid content determination. Detailed Implementation

[0038] To make the objectives, technical solutions, and advantages of this invention clearer, the following detailed description of the invention is provided in conjunction with embodiments. Those skilled in the art will understand that the following embodiments are merely exemplary and not intended to limit the scope of the invention. Furthermore, in the following description, unless specific conditions are specified in the embodiments, conventional conditions or conditions recommended by the manufacturer are followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0039] The preparation method of the culture medium used in the embodiments of the present invention is as follows:

[0040] LB liquid medium: Take 16 g LB powder, add deionized water to make up to 800 mL, stir or shake thoroughly until the powder is completely dissolved, sterilize at 121 ℃ for 20 min, cool to room temperature and store at 4 ℃ for later use.

[0041] LB solid medium: Take 16 g LB powder and 14.4 g agar powder, add deionized water to make up to 800 mL, stir or shake thoroughly until the powder is completely dissolved, sterilize at 121 ℃ for 20 min, cool to room temperature and store at 4 ℃ for later use.

[0042] BG11 liquid culture medium: Prepare stock solutions 1-6 according to the components and dosages described in Table 1. Add 800 μL of stock solution 1, stock solution 2, stock solution 3, stock solution 4, stock solution 5, and stock solution 6 sequentially to 700 mL of deionized water. Then add 8 mL of a 154 g L / L solution. -1 Sodium nitrate solution, then add water to make up to 800 mL, at 121 o Sterilize at ℃ for 20 min, and after cooling, store at 4 ℃ for later use.

[0043] BG11 solid culture medium: Prepare stock solutions 1-6 according to the components and dosages described in Table 1. Add 800 μL of stock solution 1, stock solution 2, stock solution 3, stock solution 4, stock solution 5, and stock solution 6 sequentially to 700 mL of deionized water. Then add 8 mL of a 154 g L / L solution. -1 Sodium nitrate solution and 8 g agar powder, then add water to make up to 800 mL, at 121 o Sterilize at ℃ for 20 min, and after cooling, store at 4 ℃ for later use.

[0044] Table 1. Composition and dosage of mother liquors 1-6

[0045] .

[0046] Example 1: Construction of recombinant plasmid pCpf1b-PAM-HR-psbA- ScyR

[0047] (1) Cloning the target sequence into the vector plasmid

[0048] The sequence following the PAM site (22 bp) was selected to form the gene-editing sgRNA target sequence, as shown in SEQ ID NO.1. Primers for the sgRNA target sequence were then used. MAAs -sgRNA-F, MAAs Fusion with sgRNA-R yielded the target sequence fusion fragment. Primer information is as follows:

[0049] MAAs -sgRNA-F: AGATGGCACTCTTGTATTACTAGCGA;

[0050] MAAs -sgRNA-R:AGACTCGCTAGTAATACAAGAGTGCC.

[0051] Take 5 μL respectively MAAs -sgRNA-F and MAAs Fusion was performed using sgRNA-R primers, and the fusion procedure is shown in Table 2.

[0052] Table 2 sgRNA target sequence primer fusion procedure

[0053] .

[0054] use Aar The pCpf1b-sp vector plasmid was digested with restriction endonucleases, as shown in Table 3. The digestion conditions were: 37 °C for 10 h followed by 65 °C for 20 min. Gel electrophoresis was used to check for proper digestion. The digested vector was then purified using a gel extraction kit (Qingke Biotechnology).

[0055] Table 3. Enzyme digestion system of pCpf1-sp vector plasmid

[0056] .

[0057] The target sequence fusion fragment was ligated with T4 DNA ligase to obtain a vector containing the target sequence. The ligation system is shown in Table 4. The ligation conditions were: ligation at 25 °C for 1.5 h.

[0058] Table 4. T4 DNA ligase ligation system

[0059] .

[0060] The ligation product is transformed into DH5a competent cells by heat shock transformation. Specifically, 10 μL of the ligation product is added to 80 μL of DH5a competent cells, which are then placed on ice for 10 min, followed by water bath at 42 °C for 60 s, then ice bath for 2 min, and then 800 μL of LB liquid medium is added, which is then incubated at 37 °C and 120 rpm for 1 h, and then spread on LB solid medium containing 175 μg / mL of ampicillin, 20 μg / mL of tetracycline, 50 μg / mL of kanamycin, and 20 μg / mL of spectinomycin, and then incubated at 37 °C overnight. -1 Spectinomycin (Spe), 50 mg / mL -1 Isopropyl-β-D-thiogalactopyranoside (IPTG), 20 mg / mL -1 The colonies are then picked (white spots) for colony PCR identification after overnight incubation at 37 °C, and the positive strains are then cultured, and the plasmid is extracted using a plasmid extraction kit (Tiangen Biochemical) and then sent to a company for sequencing. The plasmid with correct sequencing is the target sequence-containing vector. The colony PCR system is shown in Table 5, and the reaction program is shown in Table 6.

[0061] Table 5 Colony PCR system

[0062] .

[0063] Table 6 Colony PCR reaction program

[0064] .

[0065] (2) Cloning of HR homologous sequences to the target sequence-containing vector

[0066] The HR homologous sequence is the Gracilaria dura gene cluster MAAs The homologous sequences at both ends of the gene cluster include the upstream homologous arm and the downstream homologous arm, and the sequence information is shown in SEQ ID NO. 2 and SEQ ID NO. 3. The Gracilaria dura genomic DNA is extracted using a plant genomic extraction reagent, and then the upstream and downstream homologous arms are amplified by PCR using the Gracilaria dura genome as a template. The size of the PCR product band is detected by gel electrophoresis, and the amplified fragments are purified and recovered using a gel recovery kit (Qingke Biological). The PCR reaction system of the upstream and downstream homologous arms is shown in Table 7, and the PCR reaction program is shown in Table 6. The primer information in the reaction system is as follows:

[0067] The upstream homologous arm amplification primer is:

[0068] MAAs -UP-F: CGATATCTAGATCTCATGGAGTTACCGAGGTAGGTATG;

[0069] MAAs -UP-R: GTGAGATTTCGGTAATAATTCC;

[0070] The downstream homologous arm amplification primers are:

[0071] MAAs -DW-F:ATTACCGAAATCTCACCCCGGGTACCAATCCACATTCTA

[0072] AAGCC;

[0073] MAAs -DW-R:AACGTTGTTGCCATTGCGGAAGTGGTGAGTATGCTCAA

[0074] TG.

[0075] Table 7 PCR reaction system of upstream and downstream homologous arms

[0076] .

[0077] use BamH The vector containing the target sequence was digested with restriction endonucleases, as shown in Table 8. The digestion temperature was 30 °C, and the digestion time was 2 h. The digestion efficiency was detected by gel electrophoresis, and the vector was purified using a gel extraction kit.

[0078] Table 8 BamH I restriction endonuclease digestion system

[0079] .

[0080] The target sequence-containing vector, digested by enzymes, and the amplified upstream and downstream homologous arms were ligated using in-fusion ligase. The ligation system is shown in Table 9. The ligation temperature was 50 °C and the ligation time was 50 min.

[0081] Table 9 In-fusion ligase ligation system

[0082] .

[0083] The above-mentioned ligation product was transformed into DH5α competent cells using a heat shock transformation method. Specifically, 10 μL of the above ligation product was added to 80 μL of DH5α competent cells, and the cells were placed on ice for 30 min, then incubated in a water bath at 42 ℃ for 60 s, followed by an ice bath for 2 min. 800 μL of LB liquid medium was added, and the cells were cultured on a shaker at 37 ℃ and 120 rpm for 1 h. The cells were then plated onto LB solid medium (containing 175 μg mL of LB liquid medium). -1After incubating the bacteria overnight at 37 °C, single colonies were picked for colony PCR identification. Positive strains were then expanded, and plasmids were extracted using a plasmid extraction kit (Tiangen Biotech) and sent to the company for sequencing. The correctly sequenced plasmid was identified as the intermediate vector pCpf1b-sgRNA-HR. The colony PCR system is shown in Table 5, and the reaction procedure is shown in Table 6.

[0084] (3) Combine the psbA starter sequence and ScyR cloning regulator genes into intermediate vectors

[0085] The psbA promoter sequence is an endogenous promoter sequence derived from *Nostoc commune*, and its sequence information is shown in SEQ ID NO.4. The psbA promoter sequence was amplified using *Nostoc commune* genomic DNA as a template. The amplification system is shown in Table 10, and the reaction procedure is shown in Table 6. The sequence information of the primers Nf-psbA-F and Nf-psbA-R in the amplification system is as follows:

[0086] Nf-psbA-F:GATCCCCACGGATCCGGGTTGTCATGTCACACATCCCC;

[0087] Nf-psbA-R: GGTTTTATAAGTGCGGTTAG.

[0088] Table 10 psbA promoter sequence amplification system

[0089] .

[0090] ScyR regulator genes are COO91_00771 The gene, nucleotide sequence is shown in SEQ ID NO.5, and amino acid sequence is shown in SEQ ID NO.6. Using the genomic DNA of *Nostoc commune* as a template, [the following was performed / conducted / etc.]. ScyR The regulator gene was amplified, and the amplification system is shown in Table 11, while the reaction procedure is shown in Table 12. The sequence information of primers 00771-F and 00771-R in the amplification system is as follows:

[0091] 00771-F: CGCACTTATAAAACCATGCATGAATCACCAAAGAAAT;

[0092] 00771-R: AAAAAAAGGATCTCAAGAAGATCCTTTGATTTTTCAGCAAT

[0093] TTTGCCAAAGTTTTAC.

[0094] Table 11 ScyR regulator gene amplification system

[0095] .

[0096] Table 12 ScyR PCR reaction procedure for regulator genes

[0097] .

[0098] The amplified psbA promoter sequence and... ScyR The regulator gene fragments were ligated to obtain the fusion product. The fusion system is shown in Table 13, and the fusion procedure is shown in Table 14. Nf-psbA-F and 00771-R primers were added to the fusion product for PCR amplification. The PCR reaction system is shown in Table 15, and the reaction procedure is shown in Table 6. The size of the PCR product bands was detected by gel electrophoresis, and the amplified fragments were recovered using a DNA fragment gel recovery kit.

[0099] Table 13 Integration System

[0100] .

[0101] Table 14 Fusion Procedure

[0102] .

[0103] Table 15 PCR Identification Reaction System for Fusion Products

[0104] .

[0105] use Sma The intermediate vector was digested with restriction endonucleases as shown in Table 16. The digestion temperature was 30℃, and the digestion time was 2 h. The digestion efficiency was detected by gel electrophoresis, and the vector was purified using a gel extraction kit.

[0106] Table 16 Intermediate Carriers Sma I enzyme digestion system

[0107] .

[0108] The intermediate vector digested by enzyme ligase and the amplified fusion product were ligated using in-fusion ligase. The ligation system is shown in Table 17. The ligation temperature was 50 °C and the ligation time was 50 min.

[0109] Table 17 Ligation system of intermediate vector after enzyme digestion and fusion product after amplification

[0110] .

[0111] The ligation product is transformed into DH5a competent cells by heat shock transformation. Specifically, 10 μL of the ligation product is added to 80 μL of DH5a competent cells, which are placed on ice for 30 min, then placed in a 42 °C water bath for 60 s, followed by ice bath for 2 min, 800 μL of LB liquid medium is added, and the mixture is incubated at 37 °C and 120 rpm for 1 h, then spread on LB solid medium (containing 175 μg / mL ampicillin (Amp), 25 μg / mL kanamycin (Kan)), and incubated at 37 °C overnight. Single colonies are picked for colony PCR identification, and the PCR reaction system and reaction program are shown in Table 5 and Table 6. The successfully identified strains are cultured, and the plasmid is extracted using a plasmid extraction kit (Tiangen Biochemical) and sent to the company for sequencing. The plasmid with correct sequencing is the recombinant plasmid pCpf1b-sgRNA-HR-psbA- -1 Spe and 25 μg / mL kanamycin (Kan)), and incubated at 37 °C overnight. Single colonies are picked for colony PCR identification, and the PCR reaction system and reaction program are shown in Table 5 and Table 6. The successfully identified strains are cultured, and the plasmid is extracted using a plasmid extraction kit (Tiangen Biochemical) and sent to the company for sequencing. The plasmid with correct sequencing is the recombinant plasmid pCpf1b-sgRNA-HR-psbA- -1 Spe and 25 μg / mL kanamycin (Kan)), and incubated at 37 °C overnight. Single colonies are picked for colony PCR identification, and the PCR reaction system and reaction program are shown in Table 5 and Table 6. The successfully identified strains are cultured, and the plasmid is extracted using a plasmid extraction kit (Tiangen Biochemical) and sent to the company for sequencing. The plasmid with correct sequencing is the recombinant plasmid pCpf1b-sgRNA-HR-psbA- ScyR The structure of the recombinant plasmid is shown in Figure 1 .

[0112] The PCR identification results in the construction process of the above recombinant plasmid are shown in Figure 2 , where A, B, and C represent the PCR identification results of the vector containing the target sequence, the intermediate vector, and the recombinant plasmid, respectively.

[0113] Example 2: Transformation of recombinant plasmid in hair fungus

[0114] The recombinant plasmid pCpf1b-sgRNA-HR-psbA- ScyR is transformed into hair fungus to obtain transformants. The specific transformation steps are as follows:

[0115] (1) The recombinant plasmid with correct sequencing is transformed into HB101 competent cells by heat shock method. After colony PCR identification of positive clones, a positive single colony is inoculated in LB liquid medium (containing 175 μg / mL ampicillin (Amp), 25 μg / mL kanamycin (Kan)), and incubated at 37 °C. Then, 1 mL of the cultured bacterial solution is transferred to 100 mL of LB liquid medium (containing 175 μg / mL ampicillin (Amp), 25 μg / mL kanamycin (Kan)), and incubated at 37 °C and 200 rpm until the logarithmic growth phase (OD -1 Spe and 25 μg / mL kanamycin (Kan)), and incubated at 37 °C overnight. Single colonies are picked for colony PCR identification, and the PCR reaction system and reaction program are shown in Table 5 and Table 6. The successfully identified strains are cultured, and the plasmid is extracted using a plasmid extraction kit (Tiangen Biochemical) and sent to the company for sequencing. The plasmid with correct sequencing is the recombinant plasmid pCpf1b-sgRNA-HR-psbA- -1 Spe and 25 μg / mL kanamycin (Kan)), and incubated at 37 °C overnight. Single colonies are picked for colony PCR identification, and the PCR reaction system and reaction program are shown in Table 5 and Table 6. The successfully identified strains are cultured, and the plasmid is extracted using a plasmid extraction kit (Tiangen Biochemical) and sent to the company for sequencing. The plasmid with correct sequencing is the recombinant plasmid pCpf1b-sgRNA-HR-psbA- 600 for 0.6-0.8), then centrifuged at 4000 rpm for 5 min, the supernatant was removed, and the cells were rinsed twice with LB liquid medium without antibiotics, then resuspended in 1.5 mL of LB liquid medium.

[0116] (2) Take 100 mL of wild-type Nostoc cells in the logarithmic growth phase, centrifuge at 7500 rpm for 10 min, remove the supernatant, rinse twice with BG11 liquid medium, and resuspend in 1.5 mL of BG11 liquid medium.

[0117] (3) The above-mentioned resuspended bacterial and algal solutions were placed at 25 °C under weak light (5-10 μmol photons m -2 s -1 After culturing for 1 h under the specified conditions, the sample was spread onto BG11 solid medium (covered with a sterilized nitrocellulose film) and incubated at 25 °C and 40 µmol photons per minute light intensity. -2 s -1 After being cultured for 24 h under the specified conditions, the nitrocellulose membrane containing the nori extract was transferred to a membrane containing 30 μg mL of [unspecified substance]. -1 Spe and 20 μg mL -1 On Kan's BG11 solid medium, at a temperature of 25 °C and a light intensity of 40 µmol photons m -2 s -1 Under suitable conditions, transformants will appear after approximately 3-4 weeks of cultivation.

[0118] Example 3: Construction of Nostoc mustachys mutant

[0119] (1) Select the transformants obtained in Example 2 and place them in a solution containing 30 μg mL -1 Spe and 20 μg mL -1 Stranded on Kan's BG11 solid medium (continuous light cultivation at 25 ℃), after 2-3 generations of subculturing, the transformed individuals were picked and transferred to a medium containing 20 μg mL of [unclear text - likely a specific culture medium or culture medium]. -1 Streaking was performed on Kan's BG11 solid medium (continuous light incubation at 25 ℃) to obtain activated transformants, such as... Figure 3 As shown;

[0120] (2) The activated transformants were transferred to BG11 liquid medium for culture at a temperature of 24-26 ℃ and a light intensity of 30-50 µmol photons m -2 s -1 The culture was performed at a shaker speed of 100-150 rpm, with 2-3 transfers. The culture liquid was collected, and the genome was extracted and identified by PCR using three sets of primers. The three sets of primers were: ① 00771-F and 00771-R, ② Nf-psbA-F and 00771-R. MAAs -sgRNA-F and MAAs-DW-R. The identification reaction system is shown in Table 18, the identification procedure is shown in Table 19, and the correct identification result is the mutant of bryopsis. Figure 4 PCR identification result of the mutant of bryopsis.

[0121] Table 18 PCR identification reaction system of the mutant of bryopsis

[0122] .

[0123] Table 19 PCR identification procedure of the mutant of bryopsis

[0124] .

[0125] Example 4 Analysis of growth phenotype and scytonemin synthesis ability of the mutant of bryopsis

[0126] The cell suspension culture liquid of the mutant of bryopsis and the cell suspension culture liquid of wild type bryopsis in the logarithmic growth phase were respectively continuously irradiated under the ultraviolet condition of UV-B 0.528 W m -2 , PAR 20 µmol photons m -2 s -1 for 15 days, 1 hour per day, while adding the substrate tryptophan (0.5 mM) in the culture medium, and sampling every 5 days to determine the biomass, relative activity, scytonemin content, chlorophyll a (Chl a ) content and carotenoid (Car) content.

[0127] The determination methods of the above indexes are as follows:

[0128] (1) Biomass

[0129] Weigh 10 mL centrifuge tubes, collect 20 mL cell suspension culture liquid, centrifuge at 7500 rpm for 10 min, discard the supernatant, and freeze dry in a freeze dryer until a constant weight is reached. Weigh the centrifuge tube containing dried cells, and calculate the biomass according to the following formula:

[0130] Biomass (mg mL -1 ) = (weight of centrifuge tube containing dried cells - weight of centrifuge tube before drying) / 20.

[0131] (2) Relative activity of cells

[0132] Take 2 mL cell suspension culture, after 20 min treatment in dark state, use chlorophyll fluorescence instrument to determine cell relative activity value, set parameter Measure color = 630 nm, Flash pulse = 60%, Super pulse = 40%.

[0133] (3) Chlorophyll a , Carotenoid, Scytonemin content

[0134] Take 20 mL cell suspension culture, after 5 min centrifugation at 7500 rpm, discard supernatant, dry in freeze dryer, then wet dry cell, add 3 ml 100% acetone, extract at 4 ℃ under dark overnight, rinse once with 1 ml 100% acetone, collect all acetone solution (total 4 mL), filter with 0.22 μm organic filter membrane, determine absorbance of filtrate at 384 nm, 490 nm and 663 nm wavelength, and calculate chlorophyll a , Carotenoid and Scytonemin concentration according to following formula:

[0135] C (mg mL -1 ) = A / Kb

[0136] In the formula, C is substance concentration (mg mL -1 ), A is corrected absorbance, K is molar absorption coefficient, and b is cell thickness (cm). Among them, K (Chl a ) = 92.6 mL mg -1 cm -1 ; K (Car) = 250 mL mg -1 cm -1 ; K (Scytonemin) = 112.6 mL mg -1 cm -1 .

[0137] The method for calculating corrected absorbance is:

[0138] A* 663 (Chl a ) = 1.02A 663 - 0.027A 384 + 0.01A 490 ;

[0139] A* 490 (Car) = 1.02A 490 - 0.08A 384 - 0.026A 663 ;

[0140] A* 384(Scytonemin) = 1.04A 384 -0.79A 663 -0.27A 490 ;

[0141] Then calculate chlorophyll using the following formula. a Carotenoid and pseudocladin content:

[0142] M=C / DW

[0143] In the formula, M is the substance content (mg g) -1 DW), C is the concentration of the substance (mg / mL) -1 ), DW represents biomass.

[0144] Biomass, relative cell activity, pseudocladin content, and chlorophyll content of Nostoc mukorossi mutant and wild-type Nostoc mukorossi a The results of the content and carotenoid content determination are as follows: Figures 5-9 As shown in the figure, Nf-psbA-ScyR The text indicates that the mutant form of *Nostoc commune* is represented by 'WT', while the wild-type form is represented by 'Wild Nostoc commune'. The results in the figure show that, within a 15-day culture period, the biomass of both wild-type and mutant *Nostoc commune* exhibited a continuous upward trend, while their relative activity initially decreased and then increased. Chlorophyll content... a The contents of all substances gradually decreased, and the content of carotenoids also showed a decreasing trend. By the fifth day of cultivation, the wild-type *Nostoc commune* did not produce pseudocranophane, while the *Nostoc commune* mutant produced 2.3 mg / g of pseudocranophane. -1 After 15 days of cultivation, both wild-type Nostoc and its mutant strain synthesized pseudocladophytin, with the mutant strain reaching a content of 4.6 mg / g. -1 It is 2.4 times that of wild-type black moss. This shows that in black moss... MAAs Gene cluster site overexpression ScyR The regulator gene can significantly enhance the pseudobryophyte synthesis capacity of Nostoc cells.

[0145] Those skilled in the art can make various changes, modifications, substitutions and alterations to these embodiments without departing from the spirit and principles of the invention, the scope of which is defined by the claims and their equivalents.

Claims

1. A recombinant plasmid, characterized in that, It includes a vector plasmid, and sgRNA target sequence, HR homology sequence, psbA promoter sequence and ScyR regulator gene linked to the vector plasmid; The sgRNA target sequence is the MAAs gene cluster recognition sequence of Nostoc commune, and its nucleotide sequence is shown in SEQ ID NO.1; The HR homologous sequence is the homologous sequence at both ends of the Nostoc maculata MAAs gene cluster, including the upstream homologous arm and the downstream homologous arm, and the nucleotide sequence is shown in SEQ ID NO.2 and SEQ ID NO.3; The psbA promoter sequence is an endogenous promoter sequence derived from Nostoc commune, and its nucleotide sequence is shown in SEQ ID NO.4; The ScyR regulator gene is the COO91_00771 gene, with the nucleotide sequence shown in SEQ ID NO.5 and the amino acid sequence shown in SEQ ID NO.

6.

2. The recombinant plasmid as described in claim 1, characterized in that, The vector plasmid is pCpf1b-sp.

3. A method for constructing a recombinant plasmid, characterized in that, Includes the following steps: The sgRNA target sequence and the HR homologous sequence were sequentially ligated into the vector plasmid to obtain the intermediate vector. The PSBA boot sequence and ScyR The regulator gene was fused and then ligated into an intermediate vector; The sgRNA target sequence is the MAAs gene cluster recognition sequence of Nostoc commune, and its nucleotide sequence is shown in SEQ ID NO.1; The HR homologous sequence is the homologous sequence at both ends of the Nostoc maculata MAAs gene cluster, including the upstream homologous arm and the downstream homologous arm, and the nucleotide sequence is shown in SEQ ID NO.2 and SEQ ID NO.3; The psbA promoter sequence is an endogenous promoter sequence derived from Nostoc commune, and its nucleotide sequence is shown in SEQ ID NO.4; The ScyR regulator gene is the COO91_00771 gene, with the nucleotide sequence shown in SEQ ID NO.5 and the amino acid sequence shown in SEQ ID NO.

6.

4. The application of the recombinant plasmid as described in any one of claims 1-2, or the recombinant plasmid constructed by the method of constructing the recombinant plasmid as described in claim 3, in improving the ability of Nostoc pseudocladophyta to synthesize phycocyanin.

5. The application as described in claim 4, characterized in that, The recombinant plasmid was transformed into Nostoc commune, and the process was carried out in Nostoc commune. MAAs Gene cluster site overexpression ScyR Regulatory genes are used to enhance the pseudo-branching phycocyanin synthesis capacity of Nostoc commune.

Citation Information

Patent Citations

  • Method for producing scytonemin by inducing nostoc flagelliforme suspension culture cells by using solar radiation

    CN113817649A

  • Synthesis method of cladosporin

    CN117945982A