Application of PtWOX11 in regulation and control of leaf stalk and / or branching characters of poplar

Abstract

The invention provides application of PtWOX11 in regulating and controlling leaf stalk characters and / or branching characters of poplar, and belongs to the technical field of genetic engineering breeding. The invention provides application of PtWOX11 in regulation and control of leaf stalk characters and / or branching characters of poplar trees. The overexpression of PtWOX11 can shorten the petiole of the poplar, reduce the angle between the petiole and the stem, reduce the angle between the lateral branch and the main stem, and integrally form a compact tree (narrow crown). The shrunk tree type can increase the number of trees planted in the forest land in unit area, and the wood yield in unit area is directly increased. On the other hand, the function inhibition type PtWOX11 SRDX for knocking out or knocking down the PtWOX11 or overexpressing the PtWOX11 can prolong the petiole of the poplar, increase the angle between the petiole and the stem and increase the angles of the lateral branches and the main stem, and a divergent tree type (wide crown) is integrally formed. The divergent tree has scattered branches and leaves, is suitable for serving as a street tree and is used for shading and shielding rain.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering breeding, and particularly relates to application of PtWOX11 in regulating petiole traits and / or branch traits of poplar. BACKGROUND

[0002] The WOX (WUSCHEL-related homeobox) family is a plant-specific transcription factor family, which contains a homeodomain (HD) composed of 65-66 amino acid residues. The plant WOX family members regulate target gene expression at the transcriptional level, thereby participating in important biological processes such as plant growth and development and response to abiotic stress.

[0003] At present, there is no report about PtWOX11 in the WOX family regulating petiole and / or branch traits of poplar. SUMMARY

[0004] The application aims to provide application of PtWOX11 in regulating petiole traits and / or branch traits of poplar.

[0005] The application provides application of PtWOX11 in regulating petiole traits and / or branch traits of poplar.

[0006] Preferably, the petiole traits include petiole length and / or angle between petiole and stem; and the branch traits include lateral branch number, lateral branch length, axillary bud germination, axillary bud number, axillary bud size and / or angle between lateral branch and main stem.

[0007] The application further provides application of overexpressing PtWOX11 in cultivating a tight-type tree type of poplar variety.

[0008] The application further provides application of overexpressing PtWOX11 in close planting of poplar and / or increasing wood yield of poplar plantation.

[0009] Preferably, the application is achieved by at least one of the following: 1) shortening the petiole of poplar; 2) reducing the angle between the petiole and the stem of poplar; 3) inhibiting axillary bud dormancy of poplar to form lateral branches, inhibiting axillary bud germination of poplar and / or reducing the number of axillary buds of poplar; 4) inhibiting the size of axillary buds of poplar; 5) reducing the number of lateral branches of poplar; 6) increasing the length of lateral branches of poplar; and 7) reducing the angle between lateral branches and the main stem.

[0010] The application further provides application of knock-out or knock-down PtWOX11 or functional inhibition type PtWOX11SRDX of overexpressing PtWOX11 in cultivating a divergent-type tree type of poplar variety.

[0011] The application also provides a function-inhibited PtWOX11SRDX of knocking out or knocking down PtWOX11 or overexpressing PtWOX11 in cultivating and / or planting row trees.

[0012] Preferably, the application is achieved by at least one of the following: (1) increasing the petiole of poplar; (2) increasing the angle between the petiole and the stem of poplar; (3) promoting the axillary bud of poplar to break dormancy to form lateral branches, promoting the germination of the axillary bud of poplar and / or increasing the number of the axillary bud of poplar; (4) inhibiting the size of the axillary bud of poplar; (5) increasing the number of lateral branches of poplar; (6) shortening the length of lateral branches of poplar; (7) increasing the angle between the lateral branches and the main stem.

[0013] The application also provides a method for cultivating a poplar variety of a compact tree type, comprising the following step: overexpressing PtWOX11 in poplar.

[0014] The application also provides a method for cultivating a poplar variety of a divergent tree type, comprising the following step: knocking out or knocking down PtWOX11 or overexpressing a function-inhibited PtWOX11SRDX of PtWOX11 in poplar.

[0015] The application provides the application of PtWOX11 in regulating the petiole and / or branch traits of poplar. Increasing the planting density and improving the space utilization of forest trees are important strategies for further increasing the yield of wood of artificial forest. High-density planting has higher requirements for the crown type of forest trees, and cultivating a new variety of forest trees with a small angle between the lateral branches and the main stem to form a long and narrow "narrow crown" is an important way to realize dense planting. Overexpression of PtWOX11 can shorten the petiole of poplar, reduce the angle between the petiole and the stem, and reduce the angle between the lateral branches and the main stem, and the whole forms a compact tree type (narrow crown). The compact tree type can increase the number of trees per unit area of forest land and directly increase the yield of wood per unit area. On the other hand, row trees require a wide crown type of forest trees, which are used for shading, rain protection and beautifying the city. Knocking out or knocking down PtWOX11 or overexpressing a function-inhibited PtWOX11SRDX of PtWOX11 can lengthen the petiole of poplar, increase the angle between the petiole and the stem, and increase the angle between the lateral branches and the main stem, and the whole forms a divergent tree type (wide crown). The divergent tree type has scattered branches and leaves, which is suitable for row trees and is used for shading and rain protection. BRIEF DESCRIPTION OF DRAWINGS

[0016] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed in the embodiments. Obviously, the drawings described below only show some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative labor.

[0017] Figure 1Schematic diagram of 84K poplar with narrow crown formed by overexpression of PtWOX11;

[0018] Figure 2 Schematic diagram of 84K poplar with wide crown formed by functional inhibition type PtWOX11SRDX overexpression of PtWOX11;

[0019] Figure 3 Comparison diagram of plant type structure;

[0020] Figure 4 Comparison diagram of the angle between petiole and stem; wherein, A: petiole angle of wild type 84K, overexpression of PtWOX11 and functional inhibition type PtWOX11SRDX cultured for 70 days in greenhouse; B: statistical diagram of petiole angle of the 3rd to 5th leaf of plant material in figure A;

[0021] Figure 5 Schematic diagram of petiole length change; wherein, A: petiole length change trend of wild type 84K, overexpression of PtWOX11 and functional inhibition type PtWOX11SRDX cultured for 70 days in greenhouse; B: petiole length diagram of the 10th leaf of plant material in figure A;

[0022] Figure 6 Comparison diagram of opposite branch angle; wherein, A: 84K branch angle diagram after topping; B: PtWOX11 overexpression branch angle diagram after topping; C: PtWOX11SRDX functional inhibition type branch angle diagram after topping; D: statistical results of the first to third branch angle of corresponding A, B and C plant materials;

[0023] Figure 7 Comparison diagram of 84K wild type poplar, PtWOX11 and PtWOX11SRDX axillary bud number; wherein, A: 84K, PtWOX11 and PtWOX11SRDX plants after soil culture in constant temperature climate incubator for 50 days; B: data of axillary bud number between leaves of 84K wild type poplar, PtWOX11 and PtWOX11SRDX transgenic lines; **, P<0.01; ***, P<0.001;

[0024] Figure 8 Comparison diagram of 84K wild type poplar, PtWOX11 and PtWOX11SRDX axillary bud size; wherein, A~C: 4th, 7th and 10th axillary bud diagrams from top to bottom of 84K poplar plant; D~F: 4th, 7th and 10th axillary bud diagrams from top to bottom of PtWOX11 plant; G~I: 4th, 7th and 10th axillary bud diagrams from top to bottom of PtWOX11SRDX plant; scale bar 1mm;

[0025] Figure 9Figure 8 is a comparison chart of axillary bud germination rate and lateral branch length of 84K wild type, PtWOX11 and PtWOX11SRDX after topping; wherein, A: 84K, PtWOX11 and PtWOX11SRDX (from left to right) after 11 days of culture in a constant temperature incubator after topping; B: the first lateral branch on the top of 84K; C: the first lateral branch on the top of PtWOX11; D: the first lateral branch on the top of PtWOX11SRDX; the scale is 1 cm;

[0026] Figure 10 Figure 9 is the axillary bud germination data of 84K, PtWOX11 and PtWOX11SRDX after topping; *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001; ns, no significant difference;

[0027] Figure 11 Figure 10 is the lateral branch length data of 84K, PtWOX11 and PtWOX11SRDX from top to bottom; *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001; ns, no significant difference;

[0028] Figure 12 Figure 11 is a comparison chart of 84K wild type, PtWOX11 and PtWOX11SRDX axillary bud cell length; wherein, A-C: paraffin section charts of the first axillary bud on the top of 84K after 24h, 48h and 72h of topping; D-F: paraffin section charts of the first axillary bud on the top of PtWOX11 plant after 24h, 48h and 72h of topping; G-I: paraffin section charts of the first axillary bud on the top of PtWOX11SRDX plant after 24h, 48h and 72h of topping; the scale is 100 μm; J: cell length data of the first axillary bud on the top of 84K, PtWOX11 and PtWOX11SRDX plant after 24h, 48h and 72h of topping; *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001;

[0029] Figure 13 Figure 12 is a schematic diagram of the first bud position and the second bud position of 84K wild type and PtWOX11 overexpression plant; wherein, the upper chart is the first bud position and the second bud position of 84K wild type after 24h of topping; the lower chart is the first bud position and the second bud position of PtWOX11ox after 24h of topping;

[0030] Figure 14Figure 8 is a volcano plot and a clustering plot of differentially expressed genes of the first bud position and the second bud position of 84K wild type and PtWOX11 overexpression type plants, wherein the blue dots represent down-regulated genes, the red dots represent up-regulated genes, and the gray dots represent non-differentially expressed genes; wherein A: the upper graph is a volcano plot of up-regulated genes and down-regulated genes of the first bud position of the PtWOX11 overexpression type plants after decapitation for 24 hours compared with the 84K wild type, and the lower graph is a heat map of the corresponding gene expression amount; B: the upper graph is a volcano plot of up-regulated genes and down-regulated genes of the second bud position of the PtWOX11 overexpression type plants after decapitation for 24 hours compared with the 84K wild type, and the lower graph is a heat map of the corresponding gene expression amount;

[0031] Figure 15 Figure 9 is a GO enrichment column chart of differentially up-regulated expression genes of WT-1 vs WOX11-1;

[0032] Figure 16 Figure 10 is a GO enrichment column chart of differentially down-regulated expression genes of WT-1 vs WOX11-1;

[0033] Figure 17 Figure 11 is a GO enrichment column chart of differentially up-regulated expression genes of WT-2 vs WOX11-2;

[0034] Figure 18 Figure 12 is a GO enrichment column chart of differentially down-regulated expression genes of WT-2 vs WOX11-2;

[0035] Figure 19 Figure 13 is a gene enrichment comparison analysis result chart of differentially expressed genes of the PtWOX11 overexpression type plants and the 84K plants; wherein A: the Wayne analysis of the differentially expressed genes caused by the comparison between the first bud position of the PtWXO11 ox overexpression and the 84K wild type, and the lower part shows the functional categories of the GO enrichment analysis between different sets; B: the Wayne analysis of the differentially expressed genes caused by the comparison between the second bud position of the PtWXO11 ox overexpression and the 84K wild type, and the lower part shows the functional categories of the GO enrichment analysis between different sets. DETAILED DESCRIPTION

[0036] The application provides application of PtWOX11 in regulating leaf petiole traits and / or branch traits of poplar.

[0037] As an embodiment, the leaf petiole traits include the length of the leaf petiole and / or the angle between the leaf petiole and the stem; and the branch traits include the number of lateral branches, the length of lateral branches, axillary bud germination, the number of axillary buds, the size of axillary buds, and / or the angle between the lateral branches and the main stem.

[0038] In the present application, the nucleotide sequence of the PtWOX11 is shown as SEQ ID NO. 1, specifically: atggaagataatcaaggccaagaccctaacagtccaagcaaccatgccactgaaagaagcgaaccggtgaggtcacggtggactccaaagccagagcaaatattgatacttgagtccatctttaacagtggaatggtaaacccaccaaaggatgaaactgtgagaataaggaaacttctagaaaaatttggttctgttggtgatgcaaatgtcttctactggtttcaaaaccgacgatcaagatctcgccgccggcaacgccagatgcaggctagtctggttgcaggagagcaaacaaataatcaacaggcacaagctagtggtggtgcaattcaatataaaggctgtaacacttctattgggtttgcaaattctccttcttttgttcaatccccgtcttcttatcttggtggttcctcttcttcttatggagttgttgatgaagatcatggtggagagagtctgtattctttctctaatcaaatggccttccaagaagtggatcaaacctctggtgtaacttcaattttatacccatcggagacttctaatttgcattaccaaactgctggattcatcacagttttcatcaacgggcttcccacagaagttccaaggggggcacttgacatgaatgcaatgtttggtcaagatgtagtgttggtccattcttctggagtgcccgtacccactaatgaatttgggtttctaatgcagagcttgcatcatggtgaaagctatttcctggtaatcatctctggagcataa.

[0039] The present application also provides an application of overexpressing PtWOX11 in cultivating a poplar variety of tight-shrink type.

[0040] The present application also provides an application of overexpressing PtWOX11 in close planting of poplar and / or improving wood yield of poplar plantation.

[0041] As an embodiment, the cultivation of the compact tree type poplar variety or the high-density planting of poplar and / or the increase of the wood yield of poplar plantation is achieved by at least one of the following: 1) shortening the petiole of poplar; 2) reducing the angle between the petiole and the stem of poplar; 3) inhibiting the de-dormancy of the axillary bud of poplar to form lateral branches, inhibiting the germination of the axillary bud of poplar and / or reducing the number of the axillary bud of poplar; 4) inhibiting the size of the axillary bud of poplar; 5) reducing the number of lateral branches of poplar; 6) increasing the length of lateral branches of poplar; and 7) reducing the angle between the lateral branches and the main stem.

[0042] In the present application, the angle between the petiole and the stem of poplar is the gravity orientation angle, the direction of gravity is 0 degree, and the angle of the stem is 180 degrees.

[0043] As an embodiment, the poplar includes 84K poplar. In an embodiment of the present application, compared with the wild type of 84K poplar, the petiole of 84K poplar over-expressing PtWOX11 is shortened by 2 / 3, the angle between the petiole and the stem is reduced by 10°, the angle between the lateral branches and the main stem is reduced by 15°, and a compact tree type (narrow crown) is formed as a whole. The compact tree type can increase the number of trees planted per unit area of forest land, and directly increase the wood yield per unit area. See the schematic diagram Figure 1 .

[0044] The present application also provides the use of the PtWOX11 knock-out or knock-down or the functional inhibitory PtWOX11 SRDX over-expressing in the cultivation of the divergent tree type poplar variety.

[0045] In the present application, the nucleotide sequence of the PtWOX11 SRDX is shown in SEQ ID NO. 2, specifically as follows:

[0046] atggaagataatcaaggccaagaccctaacagtccaagcaaccatgccactgaaagaagcgaaccggtgaggtcacggtggactccaaagccagagcaaatattgatacttgagtccatctttaacagtggaatggtaaacccaccaaaggatgaaactgtgagaataaggaaacttctagaaaaatttggttctgttggtgatgcaaatgtcttctactggtttcaaaaccgacgatcaagatctcgccgccggcaacgccagatgcaggctagtctggttgcaggagagcaaacaaataatcaacaggcacaagctagtggtggtgcaattcaatataaaggctgtaacacttctattgggtttgcaaattctccttcttttgttcaatccccgtcttcttatcttggtggttcctcttcttcttatggagttgttgatgaagatcatggtggagagagtctgtattctttctctaatcaaatggccttccaagaagtggatcaaacctctggtgtaacttcaattttatacccatcggagacttctaatttgcattaccaaactgctggattcatcacagttttcatcaacgggcttcccacagaagttccaaggggggcacttgacatgaatgcaatgtttggtcaagatgtagtgttggtccattcttctggagtgcccgtacccactaatgaatttgggtttctaatgcagagcttgcatcatggtgaaagctatttcctggtaatcatctctggagcagggctcgatctggatctagaactccgtttgggtttcgcttaa.

[0047] The present application also provides a functional inhibitory PtWOX11 SRDX of knocking out or knocking down PtWOX11 or overexpressing PtWOX11 for cultivating and / or planting row trees.

[0048] As an embodiment, the cultivating poplar varieties of the divergent tree type or cultivating and / or planting street trees is achieved by at least one of the following: (1) increasing the petiole of the poplar; (2) increasing the angle between the petiole and the stem of the poplar; (3) promoting the de-dormancy of the axillary buds of the poplar to form lateral branches, promoting the germination of the axillary buds of the poplar and / or increasing the number of the axillary buds of the poplar; (4) inhibiting the size of the axillary buds of the poplar; (5) increasing the number of lateral branches of the poplar; (6) shortening the length of the lateral branches of the poplar; and (7) increasing the angle between the lateral branches and the main stem.

[0049] In an embodiment of the present application, compared with the wild type of 84K poplar, the petiole of the 84K poplar overexpressing the functional inhibitory PtWOX11SRDX of PtWOX11 is extended by 2 times, the angle between the petiole and the stem is increased by 10°, the angle between the lateral branches and the main stem is increased by 15°, and a divergent tree type (wide crown) is formed as a whole. The divergent tree type has branches and leaves scattered, which is suitable for street trees and is used for shading and rain protection. See the schematic diagram Figure 2 .

[0050] The present application also provides a method for cultivating poplar varieties of the compact tree type, comprising the following steps: overexpressing PtWOX11 in the poplar.

[0051] As an embodiment, the overexpression of PtWOX11 in the poplar comprises the following steps:

[0052] The CDS sequence of PtWOX11 is cloned into the intermediate vector pDNOR222.1, and after sequencing, it is subcloned into the binary vector pMDC32 for plant expression to construct the expression vector 35S::PtWOX11. The expression vector is transformed into Agrobacterium tumefaciens to obtain a recombinant bacterium, and the recombinant bacterium is used to infect poplar leaf discs.

[0053] The present application also provides a method for cultivating poplar varieties of the divergent tree type, comprising the following steps: knocking out or knocking down PtWOX11 or overexpressing the functional inhibitory PtWOX11SRDX of PtWOX11 in the poplar.

[0054] As an embodiment, the overexpression of the functional inhibitory PtWOX11SRDX of PtWOX11 comprises the following steps: the CDS sequence of PtWOX11SRDX is cloned into the intermediate vector pDNOR222.1, and after sequencing, it is subcloned into the binary vector pMDC32 for plant expression to construct the expression vector 35S::PtWOX11SRDX. The expression vector is transformed into Agrobacterium tumefaciens to obtain a recombinant bacterium, and the recombinant bacterium is used to infect poplar leaf discs.

[0055] In one embodiment, the expression vector is constructed using the gateway cloning system (Life Technologies, Carlsbad, CA, USA); the expression vector is transformed into Agrobacterium tumefaciens by electroporation; the Agrobacterium tumefaciens includes the Agrobacterium tumefaciens strain GV3101.

[0056] To further illustrate the present invention, the application of PtWOX11 provided by the present invention in regulating petiole traits and / or branching traits of poplar leaves is described in detail below with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0057] Example 1

[0058] The CDS sequence of PtWOX11 (PtWOX11ox, SEQ ID NO. 1) was cloned from Populus tomentosa cDNA into the intermediate vector pDNOR222.1. After correct sequencing, the sequence was subcloned into the target plant expression binary vector pMDC32 to construct 35S::PtWOX11. The expression vector was constructed using the Gateway cloning system (Life Technologies, Carlsbad, CA, USA). The expression vector was transformed into Agrobacterium tumefaciens strain GV3101 by electroporation.

[0059] 2. Hybrid poplar clone 84K (P. alba XP. glandulosa) tissue culture seedlings used for genetic transformation were cultured at a temperature of 23-25°C, a light intensity of 16 / 8 h (day / night), and a light intensity of 50 μM m -2 s -1 Agrobacterium containing 35S::PtWOX11 was cultured at OD 600 =0.3-0.8 when infecting 84K leaf discs. The infected leaf discs were co-cultured on adventitious shoot induction medium (SIM, Murashige-Skoog (MS) minimal medium supplemented with 0.5 mg / l 6-benzyl aminopurine (6-BA) and 0.05 mg / l naphthaleneacetic acid (NAA)) at 22±2°C in the dark for 3 days. The co-cultured leaf discs were transferred to SIM containing 3 mg / l hygromycin B and 200 mg / l Timentin and cultured at 23-25°C under a 16 / 8 h (day / night) light intensity of 50 μM m -2 s -1Resistant shoots were induced and selected under the conditions described above. After about 30 days of induction, resistant shoots were transferred to rooting medium (RIM, ½ MS basal medium supplemented with 0.05 mg / L IBA and 0.02 mg / L NAA) containing 3 mg / L hygromycin B and 200 mg / L Timentin until induction of adventitious roots, i.e. resistant plants.

[0060] Total RNA was extracted from leaves of resistant plants using the RNeasy Plant Mini Kit and RNase-free DNase I Kit (Qiagen, Hilden, Germany). About 1.5 μg of RNA per sample was used to synthesize the first strand of cDNA by using the Superscript III first-strand synthesis system (Life Technologies, Carlsbad, CA, USA). Semi-quantitative amplification was performed using primers 5'-CTGGTTTCAAAACCGACGAT-3' (SEQ ID NO. 5) and 5'-CGGGGATTGAACAAAAGAAG-3' (SEQ ID NO. 6) in a reaction mixture of 2X SYBR Green qPCR Master Mix 10 μL, SEQ ID NO. 5 0.5 μl, SEQ ID NO. 6 0.5 μl, cDNA 11 μl, Nuclease-Free Water up to 20 μL. The amplification program was 95 °C, 3 min; 95 °C, 15 sec, 60 °C, 15 sec, 72 °C, 15 sec, 35 cycles; 72 °C, 5 min. Amplification products were separated by agarose gel electrophoresis to identify transgenic positive plants. Phenotype analysis was performed using at least 3 transgenic lines, with at least 20 clones per line. All experiments were repeated at least three times with similar results.

[0061] Example 2

[0062] 1. CDS of PtWOX11 with the coding sequence of SRDX inserted before the stop codon (SEQ ID NO. 3) GGGCTCGATCTGGATCTAGAACTCCGTTTGGGTTTCGCT (translated as GLDLDLELRLGFA, SEQ ID NO. 4) Construct PtWOX11SRDX (PtWOX11srdx), cloned into intermediate vector pDNOR222.1. After sequencing correctly, subclone into binary vector pMDC32 for the purpose plant, construct 35S::PtWOX11SRDX. The vector construction uses gateway cloning system (Life Technologies, Carlsbad, CA, USA). The expression vector is transformed into Agrobacterium tumefaciens strain GV3101 by electroporation.

[0063] 2. The same as step 2 in example 1 except that 35S::PtWOX11 is replaced by 35S::PtWOX11SRDX.

[0064] Test Example 1

[0065] The overexpression PtWOX11ox strain obtained in example 1 and the PtWOX11SRDX strain obtained in example 2 are respectively cultured for 40 days after culture. The post-culture conditions are: 24-25℃, 16h light and 8h dark, humidity of 70%, and culture in nutrient soil. 84K wild type is used as a control to observe the plant structure, the angle between petiole and stem, petiole length, and opposite branch angle. The results are shown in Figures 3 to 6 . Among them Figure 3 is a comparison of plant structure, Figure 4 is a comparison of the angle between petiole and stem, Figure 5 is a schematic diagram of petiole length change, Figure 6 is a comparison of opposite branch angle. As can be seen from the figure, the angle between petiole and stem and between lateral branch and stem of the overexpression PtWOX11ox strain is small, and the overall shape is tight and narrow crown. On the contrary, the angle between petiole and stem and between lateral branch and stem of the overexpression PtWOX11SRDX strain is large, and the overall shape is relaxed and wide crown.

[0066] Test Example 2

[0067] Regulation of PtWOX11 expression affects poplar lateral branch formation

[0068] 1. PtWOX11 is involved in regulating the number of axillary buds

[0069] Cis-acting element analysis showed that WUS domain binding sites are widely present in the upstream promoter region of regulatory genes, but the expression of WOX family transcription factors was not significantly enriched in axillary bud formation. This suggests that there is a potential to regulate axillary bud formation by regulating the expression of WOX genes in poplar. In this experiment, the 84K wild type, PtWOX11 of Example 1, and PtWOX11SRDX transgenic lines of Example 2, which were cultured in a constant temperature climate incubator for 50 days, were used as materials to measure the number of axillary buds in the leaf axils ( Figure 7 A in the figure). It can be observed that compared with the wild type 84K, the number of axillary buds of PtWOX11 is significantly lower than that of 84K, with axillary buds of about 11, while the number of axillary buds of PtWO11SRDX is significantly higher than that of 84K, with axillary buds of about 17 ( Figure 7 (B) This indicates that overexpression of PtWOX11 inhibits the number of axillary buds, but restricting PtWOX11 function further increases the number of axillary buds, thereby affecting the number of lateral branches in poplar trees.

[0070] 2. PtWOX11 is involved in regulating axillary bud size

[0071] To better understand the mechanism of PtWOX11 overexpression on lateral branch formation in poplars, the number of axillary buds of 84K wild-type poplar, PtWOX11 and PtWOX11SRDX transgenic lines was measured, and their axillary bud sizes were further measured. The 4th, 7th and 10th axillary buds from top to bottom of 84K wild-type, PtWOX11 and PtWOX11SRDX transgenic lines were photographed and recorded. From a longitudinal perspective, the size of the 4th axillary bud from top to bottom was the largest for PtWOX11SRDX ( Figure 8 A, D, G in Figure 3), but at the 7th axillary bud, the 84K axillary bud was significantly larger than that of the other two transgenic lines, with p-values ​​of 0.01211 and 0.00259 ( Figure 8 By the 10th axillary bud, the axillary buds of the PtWOX11 transgenic line were found to be larger than those of the PtWOX11SRDX line ( Figure 8 (C, F, and I). After the seventh axillary bud, the axillary bud size of the 84K wild-type was significantly larger than that of the PtWOX11 and PtWOX11SRDX transgenic lines, with p-values ​​of 0.00397 and 0.00629, respectively. This indicates that overexpression or inhibition of PtWOX11 inhibits the size of subsequent axillary buds.

[0072] 3. PtWOX11 is involved in regulating the process of axillary buds emerging from dormancy and forming lateral branches

[0073] To further explore the effect of the PtWOX11 gene on axillary bud dormancy, we selected 84K wild-type poplar, PtWOX11, and PtWOX11SRDX lines that had been cultured in a constant temperature climate incubator for 50 days and uniformly topped them. We then continued to culture them for 11 days to observe their lateral branch growth and axillary bud germination. Figure 9 A in the figure). The length of all the side branches that grew after pruning was measured from the top to the bottom. The measurement results showed that the side branches of the 84K wild type showed a trend of gradually shortening from top to bottom, ranging from 0.55 to 9.03 cm in length. The length of the first side branch at the top reached about 9.03 cm ( Figure 9 B in the figure). The length of the lateral branches of PtWOX11 gradually shortens from top to bottom, ranging from 3.23 to 10.10 cm, and the length of the first lateral branch at the top reaches a maximum of about 10.1 cm ( Figure 9 The length of the lateral branches of the PtWOX11SRDX strain was different from that of the 84K and PtWXO11ox strains. The length of the lateral branches ranged from 0.1 to 3.62 cm, and showed a steady downward trend from the top to the bottom. The length of the first lateral branch at the top reached about 3.65 cm ( Figure 9 In terms of axillary bud germination rate, compared with the wild type 84K axillary bud germination rate of 46.88%, the axillary bud germination rate of the PtWOX11 transgenic line was only 24.44%, while the corresponding axillary bud germination rate of the PtWOX11SRDX transgenic line was as high as 58.54% ( Figure 10 ). At the same time, it can be seen that the average lateral branch length of the PtWOX11 strain is significantly higher than that of the 84K wild-type poplar and the PtWOX11SRDX strain, while the lateral branch length of the PtWOX11SRDX strain is significantly lower than that of the 84K wild-type poplar ( Figure 11 ).

[0074] The above results show that overexpression of the PtWOX11 gene can effectively inhibit the process of axillary buds breaking dormancy and forming lateral branches. At the same time, after the PtWOX11 gene is inhibited, it can promote more axillary buds of poplar to break dormancy and germinate into lateral branches, but the elongation of the lateral branches is far less than that of the wild-type 84K.

[0075] 4. Anatomical Analysis of the Effects of Regulating PtWOX11 Expression on Lateral Branch Formation in Poplars

[0076] To investigate the underlying mechanisms of the PtWOX11 gene's involvement in lateral branch formation in poplars, paraffin sections were taken from the first axillary buds at the top of 84K wild-type poplars, PtWOX11, and PtWOX11SRDX transgenic lines 24, 48, and 72 hours after topping. The results showed that the internal structure and cell length of the axillary buds in 84K wild-type poplars, PtWOX11, and PtWOX11SRDX transgenic lines, which emerged from dormancy after topping, showed significant changes.

[0077] Observation of paraffin sections, for example, 84K, showed that 24 hours after truncation, two young scale leaves were visible inside the axillary bud, surrounding the middle meristem, with the cells at the top of the meristem larger ( Figure 12 At 48 hours, the second and even third layers of scale leaves have been formed. To support more scale leaves, axillary buds begin to develop radially ( Figure 12 B), at 72h, the pith of the axillary bud is more obvious, and the radial growth is more obvious ( Figure 12 C in the figure). By comparative observation, we found that the scale leaves wrapped with meristem tissue could not be seen until 48 hours after truncation of the PtWOX11 transgenic line ( Figure 12 D and E in the figure), and the developmental stage at this time is similar to the paraffin section of 84K poplar 24 hours after top cutting, and this state is maintained until 72 hours ( Figure 12 In contrast, the axillary bud sections of PtWOX11SRDX 24 hours after truncation showed that the second and even third layers of scale leaves next to the meristem had already formed, which is equivalent to the 48-hour paraffin section period of the axillary bud of 84K poplar ( Figure 12 G in the figure), and the development process is faster than that of the wild type. For example, after 48 hours, the meristem is arched ( Figure 12 H), leaves developed after 72 hours ( Figure 12 This indicates that the inhibition of the PtWOX11 gene will accelerate the process of axillary buds emerging from dormancy, thereby affecting the number of lateral branches. We measured the cell lengths of 84K wild-type poplar, PtWOX11, and PtWOX11SRDX transgenic lines at different stages, and found that over time, the cells inside the axillary buds of the three lines all grew longitudinally and axially. The overall length of the axillary bud cells of PtWOX11 was shorter than that of 84K, while the overall length of the axillary buds of PtWOX11SRDX was longer than that of 84K. The restriction of PtWOX11 function will promote the growth and development of axillary buds, thereby affecting the number of lateral branches ( Figure 12 The above data and the results of paraffin sections indicate that overexpression of PtWOX11 inhibits the growth and development of axillary buds, thereby preventing them from escaping dormancy and forming fewer lateral branches.

[0078] Test Example 3

[0079] Study on the transcriptional regulation of PtWOX11

[0080] 1. PtWOX11 overexpression differential gene map

[0081] Separate analysis of the axillary buds at the first and second bud positions of PtWOX11 overexpressing plants revealed that, compared with 84K wild-type plants, PtWOX11 overexpressing plants upregulated 2,094 genes and downregulated 2,450 genes at the first bud position, upregulated 841 genes and downregulated 748 genes at the second bud position, and that there was less gene expression difference at the second bud position than at the first bud position ( Figure 13 and Figure 14 ). Next, GO enrichment analysis was performed on the differentially expressed genes in the first and second buds caused by PtWOX11 overexpression, and the top 20 enriched GO terms were selected to draw a bar graph. The results showed that the functions of the differentially expressed genes in the first bud after PtWOX11 overexpression were concentrated in related functions such as "nuclear activity" and "cytokinin metabolism" ( Figure 15 The functions of the differentially expressed genes that were downregulated after PtWOX11 overexpression were concentrated in the related functions of "photosynthesis", "cellulose formation" and "cell wall formation" ( Figure 16 The functions of the differentially expressed genes upregulated in the second bud were concentrated in the "chitin decomposition process", "cell wall synthesis process" and "secondary metabolite biosynthesis process" and other related functions ( Figure 17 ), while the functions of down-regulated differentially expressed genes were concentrated in "defense response", "response to external stimuli" and "jasmonic acid-mediated signaling pathway" ( Figure 18 Taken together, these results suggest that PtWOX11 plays an important role in plant differentiation and nuclear activity, and may be involved in the regulation of photosynthesis and cell wall synthesis.

[0082] 2. PtWOX11 regulates the formation of lateral branches in poplar trees

[0083] The results of the GO enrichment analysis of the number of differentially expressed genes in the first and second buds of PtWOX11 overexpressing plants show that there are significant differences in the number and function of differentially expressed genes in the first and second buds of PtWOX11 overexpressing plants, which leads to significant differences in the lateral branch phenotypes after axillary bud germination ( Figure 6 D) in.

[0084] Furthermore, the differentially expressed genes (DEGs) between the first and second bud positions of PtWOX11 and the important DEGs in lateral branch formation of 84K wild-type poplar were combined to explore the same DEGs in the regulatory process. Many identical DEGs were found, and GO enrichment analysis was performed on them. The results showed that among the up-regulated DEGs in the first bud position of PtWOX11 overexpressing plants, a total of 1032 up-regulated DEGs overlapped with the important DEGs in lateral branch formation of 84K wild-type poplar, of which 184 up-regulated DEGs overlapped with C7 and 194 up-regulated DEGs overlapped with C9, accounting for 27.64% of the original C9 ( Figure 19 In the second bud position, we found that a total of 561 up-regulated DEGs overlapped with the important DEGs in lateral branch formation of 84K wild-type poplar, of which 196 up-regulated DEGs overlapped with C7 and 38 up-regulated DEGs overlapped with C9 ( Figure 19 We further performed GO enrichment analysis on these overlapping DEGs and found that among the 184 DEGs upregulated in the first bud of PtWOX11 overexpressing plants that overlapped with C7, they were mainly concentrated in processes such as "response to stimulus", "phosphorylation", and "protein phosphorylation", while the 194 upregulated DEGs that overlapped with C9 were mainly concentrated in processes such as "cell division", "cell differentiation", and "nuclear division" ( Figure 19 Among the 196 DEGs that overlapped with C7 in the second bud, they were mainly concentrated in processes such as "protein phosphorylation" and "protein modification", while the 38 DEGs that overlapped with C9 were concentrated in processes such as "multicellular organism development" and "response to jasmonic acid" ( Figure 19 In the 84K wild-type poplar, the C7 and C9 genes were down-regulated during lateral branch formation. Therefore, it can be inferred that the overexpression of PtWOX11 caused the reverse regulation of these genes that should have been down-regulated.

[0085] Transcriptome-wide analysis revealed that overexpression of PtWOX11 and the functionally inhibited form, PtWOX11SRDX, differentially regulate lateral branch development and morphology in poplar trees. Specifically, PtWOX11 overexpression resulted in significant differences in the number and function of differentially expressed genes between the first and second buds. Further analysis revealed that the regulatory changes induced by PtWOX11 overexpression primarily involved biological processes such as responses to external stimuli, biosynthesis of organic compounds, protein phosphorylation, and cell cycle progression.

[0086] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. Application of PtWOX11 in regulating petiole traits and / or branching traits of poplar leaves.

2. The use according to claim 1, characterized in that The petiole traits include petiole length and / or the angle between the petiole and the stem; the branching traits include the number of side branches, the length of side branches, axillary bud initiation, the number of axillary buds, the size of axillary buds and / or the angle between the side branches and the main stem.

3. Application of overexpression of PtWOX11 in breeding poplar varieties with compact tree shapes.

4. Application of overexpression of PtWOX11 in dense poplar planting and / or increasing wood yield of poplar plantations.

5. The use according to claim 3 or 4, characterized in that The application is implemented by at least one of the following: 1) Shorten the petiole of poplar leaves; 2) Reduce the angle between the petiole and stem of the poplar leaf; 3) inhibiting the poplar axillary buds from escaping dormancy and forming lateral branches, inhibiting the germination of poplar axillary buds and / or reducing the number of poplar axillary buds; 4) Inhibit the size of axillary buds of poplars; 5) Reduce the number of side branches of poplar trees; 6) Increase the length of poplar side branches; 7) Reduce the angle between side branches and main stem.

6. Application of knockout or knockdown of PtWOX11 or overexpression of the functional inhibitory type PtWOX11SRDX in the cultivation of poplar varieties with divergent tree types.

7. Knockout or knockdown of PtWOX11 or overexpression of the functional inhibitory type PtWOX11SRDX in the cultivation and / or planting of street trees.

8. The use according to claim 6 or 7, characterized in that The application is implemented by at least one of the following: (1) Increase the petiole of poplar leaves; (2) Increase the angle between the petiole and stem of the poplar leaf; (3) promoting the emergence of poplar axillary buds from dormancy to form side branches, promoting the germination of poplar axillary buds, and / or increasing the number of poplar axillary buds; (4) inhibiting the size of poplar axillary buds; (5) Increase the number of poplar lateral branches; (6) Shorten the length of poplar side branches; (7) Increase the angle between side branches and main stem.

9. A method for cultivating a poplar variety with a compact tree shape, characterized in that: The following steps are involved: Overexpression of PtWOX11 in poplar.

10. A method for cultivating a poplar variety with a divergent tree shape, characterized in that: The method comprises the following steps: knocking out or knocking down PtWOX11 in poplar or overexpressing the functional inhibitory type PtWOX11SRDX of PtWOX11.

Images