Application of ZmSAMT gene in improvement of corn methyl salicylate release amount and aphid control
By overexpressing the ZmSAMT gene in corn and increasing the release of methyl salicylate, the problems of pesticide resistance and environmental pollution in traditional control methods were solved, and the effect of biological control of aphids was achieved.
Patent Information
- Application Number
- CN202511292173.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-11
- Publication Date
- 2025-10-10
- Estimated Expiration
- 2045-09-11
AI Technical Summary
Traditional chemical pesticides for controlling corn aphids have problems of aphid resistance and environmental pollution. In addition, it is difficult to apply pesticides when corn plants are tall, making it difficult to effectively control aphids.
By constructing a recombinant overexpression vector of the ZmSAMT gene, the release of methyl salicylate in corn is increased, and biological control is achieved by utilizing the properties of methyl salicylate in repelling aphids and attracting aphids' natural enemies.
It significantly improves the control effect of corn on aphids, reduces the use of chemical pesticides, protects the environment, and increases the number of natural enemies of aphids.
Smart Images

Figure CN120758559A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of genetic engineering technology and specifically relates to a ZmSAMT Application of genes in increasing methyl salicylate release from corn and controlling aphids. Background Art
[0002] Corn aphids are a significant pest that harms corn crops. Traditionally, chemical pesticides have been used to control them. However, aphids infest the mid- to late-stage of corn growth, when corn plants are tall and small, and often cluster near the corn core, making pesticide application difficult. Furthermore, traditional chemical pesticide control not only easily leads to aphid resistance but also pollutes the environment. Therefore, new methods for controlling corn aphids are urgently needed. Summary of the Invention
[0003] The purpose of the present invention is to provide a ZmSAMT The application of the gene in increasing the release of methyl salicylate from corn and controlling aphids solves the problems existing in the prior art.
[0004] The technical solution adopted in the present invention is: The present invention provides a ZmSAMT Application of gene in increasing the release of methyl salicylate from corn and controlling aphids, the ZmSAMT The base sequence of the gene is shown in SEQ ID NO.1.
[0005] Preferably, by constructing the ZmSAMT The recombinant overexpression vector of the gene is used to prepare overexpression corn to increase the release of methyl salicylate from the corn, thereby further achieving the purpose of preventing and controlling aphids.
[0006] Preferably, the aphid control refers to repelling aphids and / or attracting natural enemies of aphids.
[0007] Preferably, the aphid is a cereal aphid; The natural enemy of the aphid is Harmonia axyridis.
[0008] Preferably, the method for preparing the recombinant overexpression vector comprises the following steps: Extract corn RNA and reverse transcribe it into cDNA; Using cDNA as template, the primers shown in SEQ ID NO.8 and SEQ ID NO.9 were used to amplify ZmSAMT Gene; The overexpression vector is digested with enzymes to obtain a linearized overexpression vector; Will ZmSAMT The gene is connected to the linearized overexpression vector to obtain a recombinant overexpression vector.
[0009] Preferably, the overexpression vector is pET-30a(+).
[0010] Preferably, when the overexpression vector is digested, the restriction endonucleases used are BamHI and HindIII.
[0011] Preferably, the corn RNA is derived from corn leaves.
[0012] Preferably, for connection ZmSAMT The enzyme used to ligate the gene and the linearized overexpression vector is T4 DNA ligase.
[0013] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides a ZmSAMT Application of gene in increasing the release of methyl salicylate from corn and controlling aphids, the ZmSAMT The base sequence of the gene is shown in SEQ ID NO.1. Methyl salicylate is a common plant volatile that has a significant repellent effect on a variety of aphids and a significant attraction to aphids' natural enemies. Salicylic acid carboxyl methyltransferase is a key synthase of methyl salicylate in plants. The present invention studies corn ZmSAMT The function of the gene and its mechanism of resistance to aphids, ZmSAMT Gene overexpression increases the release of methyl salicylate in crops, which not only repels corn aphids but also attracts aphids' natural enemies, thereby utilizing the corn-aphid-natural enemy interaction to control aphids. The research results of the present invention have good application prospects for the development of new aphid-resistant corn varieties. BRIEF DESCRIPTION OF THE DRAWINGS
[0014] 图1 Figure 2 shows the normal corn and corn after aphid infestation at different time points. ZmSAMT Relative gene expression analysis.
[0015] 图2 PCR validation ZmSAMT The results of gene cloning.
[0016] 图3 The results of enzyme digestion verification were shown.
[0017] 图4 The expression of ZmSAMT protein was analyzed by SDS-PAGE.
[0018] 图5 For qRT-PCR analysis of different maize lines ZmSAMT Gene expression level.
[0019] 图6 Figure 3. Effects of overexpressing maize on aphid populations and natural enemies. A: Effects of overexpressing maize on the olfactory behavior of Aphis graminis; B: Effects of overexpressing maize on the olfactory behavior of Harmonia axyridis; C: Effects of overexpressing maize on the population of Aphis graminis; D: Results of the defensive responses of neighboring plants. DETAILED DESCRIPTION
[0020] The present invention will be further described below by way of specific examples, but the scope of the present invention is not limited thereto. The details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but such modifications or replacements fall within the scope of protection of the present invention.
[0021] The inventive concept of the present invention is as follows: Methyl salicylate, or MeSA, is a common pest-inducing volatile. It is highly volatile and has a significant repellent effect on various aphid species, while also attracting their natural enemies. MeSA formulated into slow-release pellets and released into corn fields can effectively suppress aphid populations while simultaneously increasing the populations of their natural enemies. However, releasing MeSA pellets into the field is time-consuming and labor-intensive, necessitating a key challenge to increase MeSA release from corn plants under natural conditions.
[0022] Salicylate carboxyl methyltransferase, or SAMT, is a methyltransferase that uses S-adenosylmethionine as a methyl donor and salicylic acid as an acceptor. It can catalyze the conversion of SA to MeSA and use plant genetic modification technology to induce the release of odor compounds, regulate pest behavior, and thus achieve the purpose of pest control.
[0023] MeSA is one of the few plant-derived repellents that can be used in the field to control aphids. However, since MeSA is easily volatile and degraded in the natural environment, how to prepare an efficient and inexpensive MeSA slow-release agent has always been an important factor restricting its large-scale field application. The unique feature and innovation of this invention is to explore the key MeSA synthase gene in corn plants. ZmSAMT function, by improving ZmSAMT The expression level of the gene is increased, the release of MeSA in transgenic corn is increased, and its aphid resistance is improved. The release of MeSA by the crop itself provides a new solution to the problem of how to efficiently release MeSA in field applications, and also provides a theoretical basis for the development of aphid-resistant corn varieties.
[0024] In order to make those skilled in the art better understand the technical solution of the present invention and be able to implement it, the present invention is further described below in conjunction with specific examples. In the description of the present invention, if not otherwise specified, the reagents used are all commercially available and the methods used are all conventional techniques in the art.
[0025] The abbreviations of the present invention are shown in Table 1.
[0026] Table 1 Abbreviations of the present invention
[0027] Example 1 ZmSAMT The application of genes in increasing the release of methyl salicylate from corn and controlling aphids is as follows: 1. Experimental method.
[0028] 1.1. Materials.
[0029] Xianyu 335: used for ZmSAMT Gene expression pattern analysis KN5585: used for preparation of overexpression ZmSAMT Genetic plants.
[0030] 1.2、 ZmSAMT Sequence prediction analysis of genes.
[0031] ZmSAMT The complete CDS sequence of the gene is from the NCBI database. ZmSAMT The base sequence of the gene is shown in SEQ ID NO.1.
[0032] SEQ ID NO.1:
[0033] 1.3、 ZmSAMT Gene expression patterns: RNA extraction and qRTPCR analysis.
[0034] Primers ZmSAMT- F and ZmSAMT-R Used for ZmSAMT qRTPCR of genes, using Actin The genes were used as internal reference values. The primer sequences are shown in Table 2.
[0035] Eight hundred aphids were inoculated onto six-leaf-stage Xianyu 335 maize plants. At 24, 48, 72, and 96 hours post-inoculation, leaves from maize plants not affected by the aphids and leaves from maize plants affected by the aphids were collected. Normal plants served as the control group. Leaves were collected, RNA was extracted, and reverse-transcribed into cDNA. qRT-PCR was performed using the cDNA as a template. The qRT-PCR reaction system is shown in Table 3; the procedure is shown in Table 4. Three biological replicates and three parallel samples were set up for each group. Two -ΔΔCt Methods qRT-PCR analysis was performed.
[0036] Table 2 Primer sequences used for qRTPCR
[0037] Table 3 qRT-PCR reaction system
[0038] Table 4 qRT-PCR reaction procedure
[0039] 1.4、 ZmSAMT Gene cloning.
[0040] RNA was extracted from leaves of Xianyu 335 plants and reverse transcribed to obtain cDNA. Primer 5.0 software was used to design amplification primers. The primer sequences are shown in SEQ ID NO.6 and SEQ ID NO.7. ZmSAMT PCR amplification was performed. The amplification system is shown in Table 5, and the amplification program is shown in Table 6. After the PCR amplification was completed, the product was detected by agarose gel electrophoresis. If a band consistent with the predicted size was obtained, the PCR product was excised and recovered. The gel recovery method was referred to the instructions of the Kangwei Century Gel Kit.
[0041] F primer, SEQ ID NO.6: ATGGATATAAGACGTGATTTCCATATGGC.
[0042] R primer, SEQ ID NO. 7: TCACTCTTTCTTCAAGCACATGGCG.
[0043] The PCR product after glue recovery was ligated to the Blunt vector, incubated at 16°C for 30 min. The ligation product was transformed into DH5a E. coli competent cells, plated on LB solid medium containing Amp resistance for screening, incubated at 37°C overnight, and single colonies were picked for expansion to obtain bacterial liquid and plasmid extraction. PCR verification was performed using the bacterial liquid and plasmid as templates. If the PCR band size is consistent with the gene size, the bacterial liquid and plasmid are sent to Changchun Shengong Biotechnology Co., Ltd. for sequencing. ZmSAMT
[0044] Table 5 ZmSAMT PCR amplification system of the gene
[0045] Table 6 ZmSAMT PCR amplification procedure of the gene
[0046] 1.5, Construction of recombinant overexpression vector.
[0047] The CDS region of the gene was amplified from corn using the primer shown in SEQ ID NO. 8 and SEQ ID NO. 9 with cDNA as the template. ZmSAMT The overexpression vector pET-30a(+) was double-digested with BamHI and HindIII to obtain a linearized overexpression vector; the gene and the linearized overexpression vector were connected using T4 DNA ligase, so that the gene was inserted into the multiple cloning site region of the pET-30a(+) vector. ZmSAMT ZmSAMT The recombinant plasmid was obtained.
[0048] SEQ ID NO. 8: CCATGGCTGATATCGGATCCATGGATATAAGACGTGATTTCCATATGGC.
[0049] SEQ ID NO. 9: TCGAGTGCGGCCGCAAGCTTTCACTCTTTCTTCAAGCACATGGCG.
[0050] The recombinant plasmid was transformed into competent E. coli and plated on LB solid medium containing Kan resistance. Single colonies were picked and screened for overnight culture in LB liquid medium. PCR detection was performed on the bacterial solution. PCR products were detected by agarose gel electrophoresis. Bacterial solutions with expected band sizes were sent to Jilin Shenggong Biological Company for sequencing. Plasmids were extracted from strains with correct sequencing to obtain recombinant overexpression vectors. Part of the recombinant overexpression vector was sent to the synthetic overexpression ZmSAMT The transgenic overexpression of the gene in corn was completed by Boyuan Biotechnology Co., Ltd.; the other part was protein induced expression.
[0051] 1.6. Induction and expression of ZmSAMT protein.
[0052] (1) The strain containing the recombinant overexpression vector and the strain containing the empty vector were inoculated into LB liquid medium containing kanamycin, and placed in a constant temperature shaker at 37°C for 12 hours. The next day, the inoculation volume was transferred to fresh LB medium at a v / v 1% inoculum, and the bacterial concentration was continuously monitored until the OD 600 When the expression level reached 0.5±0.1, IPTG was added to a final concentration of 0.5 mM to induce expression.
[0053] (2) After induction at 16°C, the cells were collected by centrifugation at 5000g for 10 min at 4°C and resuspended in phosphate buffer. 200 μL of the suspension was labeled as the post-induction bacterial suspension. The remaining cells were ultrasonically disrupted in an ice bath to achieve cell lysis. The lysate was centrifuged at 12000g for 30 min to separate the supernatant and precipitate. The precipitate was resuspended in PBS and labeled as the inclusion body fraction.
[0054] (3) All samples were mixed with 5-fold concentrated buffer at a volume ratio of 4:1, and denatured by heating in boiling water for 8 min to prepare test samples suitable for SDS-PAGE gel electrophoresis analysis.
[0055] 1.7 Overexpression ZmSAMT Genetic corn ZmSAMT Detection of gene expression.
[0056] Seven overexpressing corn plants were obtained, designated OE1 to OE7. RNA was extracted from the corn leaves and reverse transcribed into cDNA. The quality of the cDNA was tested by gel electrophoresis, and the qualified cDNA was used as a template for qRT-PCR and stored at -80°C.
[0057] according to ZmSAMT The primers designed for the gene sequence were configured according to the instructions of the qRT-PCR kit. After mixing evenly and centrifuging, qRT-PCR detection was performed.
[0058] qRT-PCR reaction procedure: pre-denaturation at 95°C for 3 min; 30 cycles of 95°C for 5 s, 60°C for 30 s; and 95°C for 5 s. Melting curve was recorded from 65°C to 95°C at 0.5°C intervals for 5 s. Three replicates were set up for each sample. The relative expression of genes was calculated using 2 -△△CT Methods for calculation and analysis.
[0059] 1.8 Overexpression ZmSAMT Evaluation of genetically modified corn.
[0060] 1.8.1. Behavioral response.
[0061] The present invention utilizes corn aphids, Aphis graminearum ( Rhopalosiphum padi ) and the natural enemy of the cereal aphid, Harmonia axyridis ( Harmonia axyridis ) to evaluate overexpression ZmSAMT The behavioral responses of the cereal aphid (Aphididae) and the multicolored ladybird (Hymenoptera: Harmonia axyridis) to corn plants were measured using a Y-shaped olfactometer. The Y-shaped olfactometer consists of a 14-cm-long base tube and two 12-cm-long arms, each with a 75-degree angle between them. The tubes have a uniform inner diameter of 2 cm.
[0062] 1.8.2. Envelopment test.
[0063] The cage test was performed according to the method in the following references.
[0064] References: Jiang Shanshan, Deng Qing, Fan Jia, Sun Jingrui, Chen Julian. Olfactory behavioral responses of Macrosiphum avenae to E-β-farnesene[J]. Acta Entomologica Sinica, 2015, 58(7): 776-782.
[0065] (1) Select wild-type KN5585 and OE3 plants at the 5-leaf stage and place them together in an insect cage. Fifteen aphids of the cereal aphids were inoculated on each plant. The total number of aphids was observed after two weeks. Each experiment was repeated three times.
[0066] (2) Detection of overexpression ZmSAMT Can genetically modified corn plants induce defense responses in neighboring plants?
[0067] The experimental design is as follows: Five-leaf maize plants, CK and OE3, were selected for the experiment. Two CK plants were placed together in insect cage 1, designated CK1 and CK2. One CK plant and one OE3 plant were then placed in insect cage 2, designated CK3. Fifteen aphids were inoculated on CK1 and OE3, respectively. After two weeks, the number of aphids on CK2 and CK3 was observed. Each experiment was replicated three times in a light incubator at 25°C, 60% relative humidity, a 16 L:8 D photoperiod, and 20,000 lux.
[0068] 2. Experimental results.
[0069] 2.1、 ZmSAMT Gene expression analysis.
[0070] The present invention was obtained through the NCBI database ZmSAMT The gene consists of 1158 nucleotides and encodes 384 amino acids. Primary structure prediction indicates that the ZmSAMT protein has a molecular weight of 43.73 kDa and an isoelectric point of 5.56. L-leucine is the primary amino acid in the ZmSAMT protein, while tryptophan is the least abundant amino acid in the protein. The average hydrophilicity of ZmSAMT is -0.332, making it a hydrophilic protein. Its instability coefficient is 38.73, and its lipid coefficient is 81.79, making it a stable protein.
[0071] The present invention is effective for corn leaves not damaged by cereal aphids and corn leaves damaged by cereal aphids. ZmSAMT Tissue-specific expression analysis of genes was performed. 图1 , found that after corn plants were fed by the cereal aphid, ZmSAMT The gene expression level increased significantly. ZmSAMT The expression levels of the gene at 24h, 48h, 72h, and 96h were 27.87, 27.69, 27.30, and 25.16, respectively; ZmSAMT The expression levels of the gene at 24h, 48h, 72h, and 96h were 54.86, 70.88, 54.13, and 46.53, respectively. Further analysis found that at 48h, the expression levels of the gene in the corn leaves damaged by the aphid were 54.86, 70.88, 54.13, and 46.53, respectively. ZmSAMT The expression level of the gene was 2.56 times that of corn leaves not damaged by P. graminearum.
[0072] 2.2、 ZmSAMT Gene cloning.
[0073] The present invention extracts total RNA from the leaves of Xianyu 335, performs reverse transcription to generate cDNA, and then performs PCR amplification and gel excision recovery. ZmSAMT The gene was connected to the Blunt vector, transformed, and a single colony was picked for propagation and detection. The sequencing results were compared using DNAMAN. 图2 As shown, the size of the fragment amplified by PCR is 1158 bp, which proves ZmSAMT The gene was successfully cloned. 图2 In the figure, M is a marker. Lane 1 and Lane 2 are two maize plants that were not damaged by the aphid; Lane 3 and Lane 4 are two maize plants that were damaged by the aphid.
[0074] 2.3. Construction of recombinant overexpression vector.
[0075] A gene fragment of approximately 1158 bp was obtained by PCR amplification, which was directionally connected to the pET-30a(+) vector and introduced into the competent E. coli DH5a cells by heat shock transformation. After initial screening of positive clones by colony PCR, a typical single colony was selected for Sanger bidirectional sequencing to verify the integrity of the inserted sequence and obtain the recombinant overexpression vector. The verified recombinant overexpression vector was subjected to BamHI / HindIII restriction enzyme double digestion, and the results of agarose gel electrophoresis were consistent with expectations, confirming the validity of the enzyme cutting site. 图3 The enzyme-cut band was consistent with the gene size. The sequencing results were analyzed and compared using DNAMAN software. The results were consistent, proving that the recombinant overexpression vector was successfully constructed. 图3 Lanes 1 to 3 in the figure represent three biological replicates.
[0076] 2.4. Induced expression of ZmSAMT protein.
[0077] After IPTG induction, SDS-PAGE analysis showed that the molecular weight of ZmSAMT protein was about 50 kDa, which was consistent with the predicted value. 图4 .
[0078] 图4 In the figure, M: protein marker; lane 1: total protein before empty vector induction; lane 2: total protein after empty vector induction; lane 3: total protein before recombinant overexpression vector induction; lane 4: total protein after recombinant overexpression vector induction; lane 5: supernatant after ultrasonic disruption of recombinant overexpression vector; lane 6: inclusion body fraction after ultrasonic disruption of recombinant overexpression vector; the arrows indicate the target protein.
[0079] 2.5 Overexpression in Maize ZmSAMT Gene expression level.
[0080] The present invention obtained a total of 7 overexpression corn strains, namely OE1~OE7, through a biological company, and detected the expression of 57 genes in the 7 overexpression corn strains by qRT-PCR. ZmSAMT The present invention found that in 7 overexpression corn lines ZmSAMT The expression levels of genes were significantly increased. p <0.05, e.g. 图5 As shown. Among them, OE3 has the highest expression level, followed by OE5; OE2 has the lowest expression level. The above results are all based on the wild type WT as the control. ZmSAMT The gene had the highest expression level, so subsequent experiments were performed based on OE3.
[0081] 2.6 Overexpression ZmSAMT Evaluation of genetically modified corn.
[0082] 2.6.1. Behavioral response test results.
[0083] In order to further verify whether OE3 has an effect on the aphid population and the aphid's natural enemies, the present invention used a "Y" type olfactometer to conduct behavioral responses. 图6 .
[0084] 90 wingless and winged aphids of Cereals were used for behavioral response, of which 13 wingless aphids did not make a choice, accounting for 14.4% of the total; and 10 winged aphids did not make a choice, accounting for 11.1% of the total. ZmSAMT The genetically modified corn caused behavioral responses in both wingless and winged aphids of the cereal aphid family. The selection rate of wingless aphids for CK was 55.5%, while the selection rate for OE3 was 30%. The selection rate of winged aphids for CK was 55.5%, while the selection rate for OE3 was 33.33%. The number of wingless aphids that selected OE3 was significantly lower than that of CK. P <0.001; the number of winged aphids in OE3 was also significantly lower than that in CK, P <0.01.
[0085] 90 adult and 90 larvae of Harmonia axyridis were used for behavioral responses. Of these, 5 adults (5.56%) did not make a choice; 8 larvae (8.89%) did not make a choice. The selection rate of Harmonia axyridis adults for CK was 30%, and the selection rate for OE3 was 64.4%. The selection rate of Harmonia axyridis larvae for CK was 36.67%, and the selection rate for OE3 was 54.44%. The number of Harmonia axyridis adults who chose OE3 was significantly higher than that of CK. P <0.001; the number of Harmonia axyridis larvae in OE3 was significantly higher than that in CK. P <0.05.
[0086] The present invention verifies that overexpression ZmSAMT Genetically modified corn has a repellent effect on aphids and an attractive effect on aphids' natural enemies.
[0087] 2.6.2. Overexpression experiment ZmSAMT Effects of genetically modified corn on aphid populations.
[0088] (1) The experiments were conducted under indoor culture conditions. The number of aphids feeding on OE3 and CK was counted. This experiment was repeated three times, and the values were expressed as the average of the three biological replicates. The number of aphids feeding on CK was 451.33, while the number of aphids feeding on OE3 was 267. This shows that compared with the CK group, the number of aphids in the OE3 group was significantly reduced. P <0.001. 图6 C.
[0089] (2) In detecting overexpression ZmSAMT In the experiment to determine whether the genetically modified corn plants could induce a defense response in neighboring plants, three biological replicates were performed, and the values were expressed as the average of the three biological replicates. The population of the aphid on the CK2 corn plants was 473.33; the population of the aphid on the CK3 corn plants was 431.67, which was significantly lower than that of the CK2. P <0.05, this result proves overexpression ZmSAMT Genetically modified corn plants can induce a defense response in neighboring plants.
[0090] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0091] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.
Claims
1. ZmSAMT The application of the gene in increasing the release of methyl salicylate from corn and controlling aphids is characterized in that: described ZmSAMT The base sequence of the gene is shown in SEQ ID NO.
1.
2. The use according to claim 1, characterized in that By constructing the ZmSAMT The recombinant overexpression vector of the gene is used to prepare overexpression corn to increase the release of methyl salicylate in corn, thereby further achieving the purpose of preventing and controlling aphids.
3. The use according to claim 2, characterized in that The aphid prevention and control refers to repelling aphids and / or attracting the natural enemies of aphids.
4. The use according to claim 3, characterized in that The aphid is a cereal aphid; The natural enemy of the aphid is Harmonia axyridis.
5. The use according to claim 2, characterized in that The preparation method of the recombinant overexpression vector comprises the following steps: Extract corn RNA and reverse transcribe it into cDNA; Using cDNA as template, the primers shown in SEQ ID NO.8 and SEQ ID NO.9 were used to amplify ZmSAMT Gene; The overexpression vector is digested with enzymes to obtain a linearized overexpression vector; Will ZmSAMT The gene is connected to the linearized overexpression vector to obtain a recombinant overexpression vector.
6. The use according to claim 5, characterized in that The overexpression vector is pET-30a(+).
7. The use according to claim 5, characterized in that When the overexpression vector is digested, the restriction endonucleases used are BamHI and HindIII.
8. The use according to claim 5, characterized in that The corn RNA is derived from corn leaves.
9. The use according to claim 5, characterized in that For connection ZmSAMT The enzyme used to ligate the gene and the linearized overexpression vector is T4 DNA ligase.
Citation Information
Patent Citations
DsRNA as insect control agent
CN101370940A
DsRNA as insect control agent
CN104087577A
Plant expression vector of gene CmMYB15-like for improving aphid resistance of chrysanthemum and application of plant expression vector
CN114875041A
Gene CsWIN1 for regulating and controlling resistance of cucumber aphids as well as encoding protein and application of gene CsWIN1
CN118652902A