Specific methylation marker for auxiliary diagnosis of renal papillary cell carcinoma

Abstract

The invention relates to the technical field of molecular auxiliary diagnosis, and discloses a specific methylation marker for auxiliary diagnosis of renal papillary cell carcinoma, the marker is cytosine which takes a human genome GRCh38.p14 Primary Assessment as a reference genome and is located in at least one CpG site in a Chr7: 99392794-99392876 region, and the marker is one or more of cytosine at the positions of Chr7: 99392813, Chr7: 99392820, Chr7: 99392831, Chr7: 99392855 and chr7: 99392871. According to the invention, CpG site cytosine in the Chr7: 99392794-99392876 region is limited as a methylation marker, so that the problems of difficult cancer species identification and high missed diagnosis rate caused by the situation that traditional renal cell carcinoma diagnosis mostly depends on imaging subjective interpretation or generalization of tumor markers are improved.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular auxiliary diagnosis, in particular to a specific methylation marker for auxiliary diagnosis of renal papillary cell carcinoma. BACKGROUND

[0002] Renal cell carcinoma is a malignant tumor originating from renal tubular epithelium. According to the GLOBOCAN 2020 global cancer statistics, in 2020, the global incidence of renal cell carcinoma ranked 14th among malignant tumors, and the mortality rate ranked 15th. The histopathological types of renal cell carcinoma mainly include clear cell carcinoma, papillary cell carcinoma and chromophobe carcinoma. In clinical practice, early renal cell carcinoma usually lacks clinical manifestations. When symptoms such as hematuria, flank pain and abdominal mass appear, most patients are in the middle and advanced stages. Therefore, early diagnosis of renal cell carcinoma is of great significance.

[0003] Traditional diagnosis of renal cell carcinoma mostly relies on subjective interpretation of imaging or general tumor markers. Since ultrasonic imaging is easily affected by the experience of operators and the condition of patients, CT has radiation hazards, and lacks specific molecular targets for renal papillary cell carcinoma, thereby causing difficulties in cancer identification and high rate of missed diagnosis. SUMMARY

[0004] In view of the deficiencies of the prior art, the present application provides a specific methylation marker for auxiliary diagnosis of renal papillary cell carcinoma, which solves the problem that traditional diagnosis of renal cell carcinoma mostly relies on subjective interpretation of imaging or general tumor markers. Since ultrasonic imaging is easily affected by the experience of operators and the condition of patients, CT has radiation hazards, and lacks specific molecular targets for renal papillary cell carcinoma, thereby causing difficulties in cancer identification and high rate of missed diagnosis.

[0005] To achieve the above purpose, the present application realizes the following technical scheme: a specific methylation marker for auxiliary diagnosis of renal papillary cell carcinoma, the marker being cytosine in at least one CpG site in the region of Chr7:99392794-99392876, with human genome GRCh38.p14 Primary Assembly as the reference genome.

[0006] By using the above technical scheme, cytosine in the CpG site in the region of Chr7:99392794-99392876 is used as a methylation marker, and then the characteristic that the methylation level of this region is significantly higher than that of other urinary system diseases in renal papillary cell carcinoma is utilized, thereby improving the problem that traditional diagnosis of renal cell carcinoma mostly relies on subjective interpretation of imaging or general tumor markers. Since ultrasonic imaging is easily affected by the experience of operators and the condition of patients, CT has radiation hazards, and lacks specific molecular targets for renal papillary cell carcinoma, thereby causing difficulties in cancer identification and high rate of missed diagnosis.

[0007] Preferably, the marker is one or more cytosines at positions Chr7:99392813, Chr7:99392820, Chr7:99392831, Chr7:99392855, chr7:99392871.

[0008] The application of the specific methylation marker for auxiliary diagnosis of renal papillary cell carcinoma in the preparation of a product for auxiliary diagnosis or screening of renal papillary cell carcinoma, and the auxiliary diagnosis or screening is achieved by detecting the methylation level of the marker.

[0009] Preferably, the reagent for detecting the methylation level of the marker comprises a primer pair, one primer sequence of which is 5'TAGAATTTGGATAAGAAGGC 3', and the other primer sequence of which is 5'CTAACGCTATTCTTATACAACG 3'.

[0010] Preferably, the reagent for detecting the methylation level of the marker further comprises a Taqman probe, and the sequence of the probe is 5'GAGTTTCGAGGGTGGTAC 3'.

[0011] Preferably, the product comprises one or more of a kit, a chip, a computer system and a sequencing library.

[0012] Preferably, the methylation level is detected by at least one of a methylation-specific PCR method, a sequencing method, a methylation-specific high-performance liquid chromatography method, a digital PCR method, a methylation-specific high-resolution melting curve method, a methylation-specific microarray method and a methylation-sensitive restriction enzyme method.

[0013] Preferably, the reagent comprises the primer pair and the Taqman probe, and the product is a kit comprising the reagent.

[0014] The application provides a specific methylation marker for auxiliary diagnosis of renal papillary cell carcinoma.

[0015] 1、In the application, the cytosine of the CpG site in the Chr7:99392794-99392876 region is defined as a methylation marker, and then the methylation level of the region in renal papillary cell carcinoma is significantly higher than that in other urinary system diseases, thereby improving the condition that traditional renal cell carcinoma diagnosis mostly relies on subjective interpretation of imaging or general tumor markers, and the problems of difficult cancer identification, high misdiagnosis rate caused by the fact that ultrasonic imaging is easily affected by the experience of operators and the condition of patients, CT has radiation hazards, and lacks specific molecular targets for renal papillary cell carcinoma.

[0016] 2、In the present application, by including urine samples (including urinary sediment, supernatant and mixture) into the detection range, and combining bisulfite conversion and methylation-specific PCR and other technologies, non-invasive or minimally invasive diagnosis without surgical biopsy is realized, thereby improving the condition that traditional diagnosis mostly relies on invasive acquisition of tissue samples (such as nephrectomy, radical surgery), which may cause patient pain, infection risk and postoperative recovery burden, and early patients are difficult to accept invasive examination, thereby causing the problems of difficult sample acquisition, low early diagnosis popularization rate.

[0017] 3、In the present application, by designing specific primer pair (5'TAGAATTTGGATAAGAAGGC3' / 5'CTAACGCTATTCTTATACAA CG3') and Taqman probe (5'GAGTTTCGAGGGTGGTAC3'), and integrating them into kit, chip and other product forms, and providing various detection methods such as methylation-specific PCR, sequencing, a whole-process standardization system from sample extraction to result analysis is constructed, thereby improving the condition that traditional detection mostly relies on dispersed reagent configuration or single detection method, since the traditional operation steps are tedious and prone to error, and the single method is difficult to balance cost and precision (such as high sequencing cost, insufficient sensitivity of ordinary PCR), thereby causing the problems of low detection efficiency and poor result repeatability. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 It is a schematic diagram of methylation levels of target regions and three comparison regions in different samples of the present application;

[0019] Figure 2 It is a schematic diagram of ROC curves of renal papillary cell carcinoma and interference samples in urine of the present application. DETAILED DESCRIPTION

[0020] The technical solutions of the present application will be described clearly and completely below in combination with the drawings of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0021] The embodiments of the present application provide a specific methylation marker for auxiliary diagnosis of renal papillary cell carcinoma, and the marker is cytosine in at least one CpG site in the region of Chr7:99392794-99392876 in the reference genome of human genome GRCh38.p14 Primary Assembly.

[0022] Specifically, the cytosine methylation level of the CpG site in the region is significantly higher in renal papillary cell carcinoma than in benign diseases of the urinary system and other urinary system cancers (such as bladder urothelial carcinoma, prostate cancer, and renal clear cell carcinoma), and can be used as a specific molecular marker for differential diagnosis; by detecting the methylation level of the marker in tissue or urine samples, non-invasive or minimally invasive diagnosis can be achieved, avoiding the trauma of traditional invasive biopsy and the limitations of imaging examination; the marker site is specific (such as Chr7: 99392813 and other specific positions), which can be detected by primer pairs, probes and other reagents, and combined with methylation-specific PCR and other methods to improve the accuracy and repeatability of diagnosis.

[0023] The marker is one or more cytosines at positions Chr7: 99392813, Chr7: 99392820, Chr7: 99392831, Chr7: 99392855, and chr7: 99392871.

[0024] Specifically, the methylation level is significantly higher in renal papillary cell carcinoma than in bladder urothelial carcinoma, prostate cancer, and other urinary system diseases such as renal clear cell carcinoma, which can specifically distinguish the target cancer from other diseases; the specific site is clearly defined, which facilitates the design of specific primers and probes, precise capture of the methylation state of the target region, and avoids non-specific amplification; by detecting the methylation frequency / proportion of a single or multiple sites and combining with ΔΔCt values and other quantitative indicators, a quantifiable scientific basis is provided for auxiliary diagnosis, and the diagnostic accuracy is improved.

[0025] The application of the specific methylation marker for auxiliary diagnosis of renal papillary cell carcinoma in the preparation of products for auxiliary diagnosis or screening of renal papillary cell carcinoma, realizes auxiliary diagnosis or screening by detecting the methylation level of the marker.

[0026] Specifically, the methylation level can be detected in non-invasive samples such as urine to identify renal papillary cell carcinoma before symptoms appear, solving the problem of insufficient early diagnosis by traditional imaging; by the difference in methylation level, renal papillary cell carcinoma can be accurately distinguished from bladder urothelial carcinoma, prostate cancer, renal clear cell carcinoma and other urinary system diseases, making up for the lack of specificity of traditional methods; quantifiable detection indicators (such as ΔΔCt values) and standardized processes (such as methylation-specific PCR) are provided to reduce human error and improve the repeatability and reliability of the diagnosis results; the product form (kit, chip, etc.) is suitable for clinical detection and large-scale screening, reducing the dependence on invasive surgery and high-end imaging equipment, and improving the accessibility of diagnosis.

[0027] The reagent for detecting the methylation level of the marker comprises a primer pair, one primer sequence of which is 5'TAGAATTTGGATAAGAAGGC 3', and the other primer sequence is 5'CTAACGCTATTCTTATACAACG 3'.

[0028] Specifically, the primer sequence is designed for the Chr7:99392794-99392876 region, and is specifically combined only with the methylation DNA template, avoiding the amplification of non-methylation sequences or other region DNAs, improving the detection accuracy; the primer sequence is optimized to recognize the unmethylated cytosine (C) sequence converted from unmethylated cytosine (U) after bisulfite conversion, ensuring that only the methylation preserved cytosine (C) sequence is amplified, and realizing the effective differentiation between the methylation and non-methylation states.

[0029] The reagent for detecting the methylation level of the marker also comprises a Taqman probe, and the probe sequence is 5'GAGTTTCGAGGGTGGTAC 3'.

[0030] Specifically, the probe sequence is complementary to the target region methylation DNA, and the amplification process is monitored in real time through a fluorescent signal (5' end FAM reporter group, 3' end MGB quencher group), and the fluorescent signal is released only when specific binding occurs, avoiding non-specific hybridization interference and improving the detection sensitivity.

[0031] The product comprises one or more of a kit, a chip, a computer system and a sequencing library.

[0032] Specifically, the kit provides standardized detection components (such as primers, probes, buffers), which are suitable for laboratory routine detection; the chip supports high-throughput sample parallel analysis, improving large-scale screening efficiency; the computer system can integrate multi-dimensional data through algorithms to assist automated result interpretation.

[0033] The methylation level is detected by at least one of a methylation-specific PCR method, a sequencing method, a methylation-specific high-performance liquid chromatography method, a digital PCR method, a methylation-specific high-resolution melting curve method, a methylation-specific microarray method, and a methylation-sensitive restriction enzyme method.

[0034] Specifically, for the differences in DNA content and methylation distribution of different sample types such as tissues and urine (such as urinary sediment and supernatant), appropriate methods (such as digital PCR for urine samples to improve sensitivity) are selected to ensure the effectiveness of detection; methylation-specific PCR, high-resolution melting curve method, etc. are suitable for routine screening, low cost and fast; sequencing method, high performance liquid chromatography, etc. are used for accurate verification to meet the clinical diagnosis or scientific research needs, forming a layered detection system; multiple methods are verified with each other (such as PCR screening combined with sequencing re-verification), reducing the limitations of a single method (such as PCR false positives and low sequencing throughput), and improving the accuracy and repeatability of methylation level detection.

[0035] The reagent comprises a primer pair and a Taqman probe, and the product is a kit comprising the reagent.

[0036] Specifically, the core reagent (primer, probe, buffer, etc.) is pre-configured, without the need to prepare components separately, reducing operation errors, and adapting to the routine detection process of the laboratory; the primer pair specifically amplifies the target methylation DNA, and the Taqman probe monitors the fluorescence signal in real time, and the combination of the two realizes the synchronization of "amplification-detection", improving the detection sensitivity and specificity.

[0037] The term "methylation level" has the same general understanding, which refers to whether there is methylation on the 5' carbon atom of cytosine in one or more CpG dinucleotides in a DNA sequence, or the frequency / proportion / percentage of methylation, representing both a qualitative concept and a quantitative concept.

[0038] The term "auxiliary diagnosis" refers to providing a reference basis for distinguishing patients and people who are suspected to be ill but actually healthy through some tests, examinations or other means.

[0039] The term "screening" refers to distinguishing people who may be ill but appear healthy from people who may be healthy through rapid tests, examinations or other means. Screening is different from diagnosis, and it is only a preliminary examination. Further diagnosis tests need to be performed on the screening positive or suspicious positive.

[0040] The present application accidentally found that the methylation level of cytosine residues in the CpG dinucleotide site in the Chr7:99392794-99392876 region is significantly higher than that in samples of benign diseases of the urinary system and other urinary system cancers, including bladder urothelial carcinoma, prostate cancer and renal clear cell carcinoma, and can be used as a specific diagnostic marker for renal papillary cell carcinoma.

[0041] Example 1

[0042] This embodiment provides a method for determining the methylation level of the Chr12:99392794-99392876 region on the DNA sequence of a human tissue sample.

[0043] 1. Sample collection and processing

[0044] Twenty pairs of matched renal papillary cell carcinoma tissues and paracancerous tissues were collected, which were derived from patients who underwent nephron-sparing surgery or radical nephrectomy. In addition, 20 cases of bladder cancer tissues, 20 cases of renal clear cell carcinoma tissues and 20 cases of prostate cancer tissues were collected, which were derived from patients who underwent corresponding radical surgery. All tissue samples were paraffin-embedded sections. The collection process of all samples was approved by the ethics committee, all volunteers signed the informed consent, and all samples were anonymized. The staging of each type of cancer tissue was based on the AJCC 8th edition TNM staging system in 2018. The pathological staging information of each type of cancer tissue is shown in Table 1 as follows:

[0045] Table 1. Pathological grading and clinical staging of 10 prostate cancer samples

[0046]

[0047]

[0048] 2. DNA extraction

[0049] The DNA in the cancer tissue was extracted using the paraffin-embedded tissue DNA extraction kit (DP331) of Tiangeng Biochemical Technology (Beijing) Co., Ltd. The specific operation is described in the kit instructions. The concentration of the extracted DNA was determined using the NanoDrop One spectrophotometer.

[0050] 3. Bisulfite conversion

[0051] The previously extracted tissue DNA was subjected to bisulfite conversion to distinguish between methylated and non-methylated sequences. Specifically, 1 microgram of tissue DNA was treated using the nucleic acid purification reagent (Ehuanye Preparation 20200843) of Wuhan Amison Life Science Co., Ltd. The detailed operation is described in the kit instructions. In the final elution step, 25 μL of eluent was used for DNA elution. After bisulfite treatment, non-methylated cytosine was first sulfonated to sulfonated cytosine, then deaminated to sulfonated uracil, and finally converted to uracil by desulfurization step, while the methylated cytosine remained unchanged.

[0052] 4. PCR reaction

[0053] The methylation level of the sample Chr7:99392794-99392876 region (target region) was detected by using methylation-specific PCR, and for comparison and verification, the methylation levels of three regions (comparison regions) upstream and downstream of the target region were also detected, the positions of the three regions on the human genome are Chr7:99392688-99392768, Chr7:99393012-99393123 and Chr7:99393331-99393486, respectively, the internal reference gene for detecting the target region and the comparison region is ACTB, and the primers and probes for PCR amplification of the target region and the internal reference gene are shown in Table 2.

[0054] Table 2

[0055]

[0056] The primers and probes in Table 2 can specifically amplify the methylation DNA template of the positive strand of the corresponding region. The detection probes of the target region, the comparison region and the internal reference gene are Taqman probes, the reporter group at the 5' end of the target region and the comparison region probe is FAM, and the quenching group at the 3' end is MGB, the reporter group at the 5' end of the ACTB probe is VIC, and the quenching group at the 3' end is BHQ1.

[0057] In Table 2, TAGAATTTGGATAAGAAGGC is SEQ ID NO: 1, CTAACGCTATTCTTATACAACG is SEQ ID NO: 2, GAGTTTCGAGGGTGGTAC is SEQ ID NO: 3, GGTGTTGTTTATTTATGACGTC is SEQ ID NO: 4, CGCTACGAACTCTACTTAAAAAC is SEQ ID NO: 5, TCCAACCGCCCGCCGAAA is SEQ ID NO: 6, GGTAGGCGTGTTTTTAATTC is SEQ ID NO: 7, GATTTTAATACGACGCCAA is SEQ ID NO: 8, ACCCCGCCCACAAATCG is SEQ ID NO: 9, ATGGGGTTGAGTAGTTAGTTTC is SEQ ID NO: 10, GCTAAATACTAACAATAAACCCG is SEQ ID NO: 11, TGTATTTTCGGGATTTAGGTG is SEQ ID NO: 12, AAGTGTAAAGAATATGGT is SEQ ID NO: 13, ACACAATAAATCTAAACA is SEQ ID NO: 14, AGTGTGTTGGGGTTTTGGGAT is SEQ ID NO: 15.

[0058] The DNA of the tissue sample is extracted and after bisulfite conversion, methylation-specific PCR is performed on the converted DNA. The PCR components, specifications, and volumes of each component are shown in Table 3 below. Note that the target region and the control region should be detected separately, i.e., one PCR well detects only one target region / control region at a time. Each time the sample is detected, the target region / control region and the internal reference gene positive control and negative control PCR wells should be set up at the same time. The positive control and the negative control are both plasmids, wherein the positive control contains a completely methylated gene corresponding to the artificial synthetic sequence after bisulfite conversion, and the negative control contains a completely unmethylated gene corresponding to the artificial synthetic sequence after bisulfite conversion. The concentration of the positive control and the negative control plasmids is 10 3 copies per microliter.

[0059] Table 3

[0060] Components Specifications Volume (μL) Buffer (with magnesium ion) 5× 10 dNTPs Each 2.5 mM 5 Upstream primer of detection region 10 μM 0.5 Downstream primer of detection region 10 μM 0.5 Probe of detection region 10 μM 0.3 Upstream primer of ACTB 10 μM 0.5 Downstream primer of ACTB 10 μM 0.5 Probe of ACTB 10 μM 0.2 Hot-start DNA polymerase 5 U / μL 0.3 DNA to be tested / 5 Purified water / To 50

[0061] The PCR reaction conditions are shown in Table 4 below. The PCR instrument used is an ABI 7500 fluorescent quantitative PCR instrument.

[0062] Table 4

[0063]

[0064] Ct value reading: After the completion of PCR, the baseline of the detection region and the internal reference gene amplification curve is adjusted separately. The specific method is to set the average value of the fluorescence value of the minimum Ct value of the sample in one PCR before 1-2 cycles as the baseline value, and set the threshold at the inflection point of the S-shaped amplification curve. The PCR instrument software will automatically obtain the Ct value of each gene of the sample. When the sample has no amplification, the Ct value is recorded as 50.

[0065] Quality control: Each time PCR, the negative control should have no amplification, and the positive control should have a clear exponential growth period, and the Ct value of the positive control should be between 26-30, and the Ct value of the sample internal reference gene should be ≤33. After the negative control, the positive control and the internal reference gene all meet the above requirements, it indicates that this experiment is effective, and the next step of sample result analysis can be carried out. Otherwise, the experiment is invalid, and the detection should be performed again.

[0066] Result analysis and interpretation method: Calculate the difference between the Ct values of the target region and the internal reference gene of each sample, i.e., ΔCt1 value, calculate the difference between the Ct values of the target region positive control and the internal reference gene positive control in each detection, i.e., ΔCt2, then subtract the value of ΔCt2 from ΔCt1 value, i.e., obtain ΔΔCt. Take ΔΔCt as the methylation level index, compare the methylation levels of the target region and the control region in renal papillary cell carcinoma, renal clear cell carcinoma, bladder cancer and prostate cancer tissues, and the results are shown in the following table 5.Figure 1 shown.

[0067] Attachment Figure 1 In the data, group 1 represents papillary renal cell carcinoma, group 2 represents adjacent renal cell carcinoma, group 3 represents prostate cancer, group 4 represents bladder cancer, and group 5 represents clear cell renal cell carcinoma. *** indicates a significant difference, and NS indicates no significant difference.

[0068] By the attached Figure 1 It can be seen that the methylation levels of the target area and the comparison area in renal papillary cell carcinoma are higher than those in adjacent tissues. The methylation level of the target region in renal papillary cell carcinoma was significantly higher than that in prostate cancer, bladder urothelial carcinoma and renal clear cell carcinoma, indicating that detecting the methylation level of the target region can distinguish renal papillary cell carcinoma from the other three types of cancer; while the methylation level of comparison region 1 was significantly different only between renal papillary cell carcinoma and prostate cancer, and there was no significant difference between renal papillary cell carcinoma and bladder urothelial carcinoma, or between renal papillary cell carcinoma and renal clear cell carcinoma, indicating that the methylation level of comparison region 1 cannot distinguish renal papillary cell carcinoma from bladder urothelial carcinoma, or between renal papillary cell carcinoma and renal clear cell carcinoma; the methylation levels of comparison regions 2 and 3 were significantly different between renal papillary cell carcinoma and prostate cancer, and between renal papillary cell carcinoma and renal clear cell carcinoma, but there was no significant difference between renal papillary cell carcinomas and bladder urothelial carcinoma, indicating that the methylation levels of comparison regions 2 and 3 cannot distinguish renal papillary cell carcinoma from bladder urothelial carcinoma. It can be seen that among all the detection areas, only the target area can distinguish papillary cell renal cell carcinoma from other types of urinary system cancers.

[0069] Example 2

[0070] This embodiment provides a method for using a patient's urine sample to predict whether the sample has prostate cancer by detecting the methylation level of the CpG dinucleotide site in the Chr7:99392794-99392876 region in the urine DNA, and comparing the predicted result with the patient's actual diagnosis result to evaluate the accuracy of methylation prediction.

[0071] 1. Training set and test set

[0072] 1. Urine Sample Collection

[0073] Urine samples were collected from 47 patients with renal papillary cell carcinoma and 98 patients with urinary system interference diseases. Each patient collected 20 milliliters and added to the urine preservative liquid (No. AA18) of Wuhan Aimesen Life Science Co., Ltd. to preserve the DNA in the urine. The volume ratio of urine and preservative liquid is 10:1. Renal papillary cell carcinoma is confirmed by surgical pathology, and urinary system benign disease samples include bladder cancer, renal clear cell carcinoma, prostate cancer, kidney / ureter / bladder stones, urinary system inflammation samples, and interference samples are diagnosed and confirmed by doctors according to the clinical standards of various diseases.

[0074] 2. Genome extraction

[0075] Before genome extraction, the urine sample added with preservative liquid was thoroughly mixed, and 2 milliliters of urine suspension (mixed solution of urine and preservative liquid) was taken for genome extraction. The urine DNA extraction kit is nucleic acid extraction reagent (type: free DNA rapid extraction transformation) of Wuhan Aimesen Life Science Co., Ltd. The DNA extraction process includes protease K cell lysis, magnetic bead adsorption of DNA, nucleic acid washing, rinsing, and elution steps.

[0076] a. Lysis and binding: 100 microliters of protease K was added to the tube. 2 milliliters of urine suspension was added to the tube containing protease K, and 2 milliliters of lysis and binding liquid and 20 microliters of magnetic beads were sequentially added to the tube. After mixing up and down, it was placed in a mixing instrument at room temperature for 30 minutes, and the magnetic beads were kept in suspension.

[0077] b. Washing: Place the centrifuge tube on the magnetic stand, and after 2 minutes of magnetic absorption, the solution is clear, and the residual magnetic beads on the tube cap are washed several times by inverting until the whole magnetic absorption is completed. Carefully aspirate the waste liquid, add 2 milliliters of washing liquid, and vortex mix for more than 10 times to completely disperse the magnetic beads. After 2 minutes of magnetic absorption, the solution is clear, and the residual magnetic beads on the tube cap are washed several times by inverting until the whole magnetic absorption is completed.

[0078] c. Rinsing: Carefully aspirate the waste liquid, first add 500 microliters of rinsing liquid, and after the magnetic beads are washed to the bottom, transfer the magnetic bead suspension to a new 2 milliliter centrifuge tube. Add 500 microliters of rinsing liquid to completely wash the residual magnetic beads on the 5 milliliter centrifuge tube wall to the bottom. After instantaneous centrifugation, transfer all the magnetic bead suspension to a 2 milliliter centrifuge tube, vortex mix for more than 10 times to completely disperse the magnetic beads. After 2 minutes of magnetic absorption, the solution is clear, and the residual magnetic beads on the tube cap are washed several times by inverting until the whole magnetic absorption is completed. Repeat the rinsing once.

[0079] d. Elution: The centrifuge tube was taken out and centrifuged briefly to collect the residual liquid, placed on the magnetic stand to complete the absorption of magnetism, and then the residual liquid was sucked with a small gun head. The centrifuge tube was opened and placed for 5 minutes to make the surface of the magnetic beads matt. 50 microliters of elution solution TE was added, and the magnetic beads were dispersed by gently shaking and placed at 56°C for 10 minutes. Every 3 minutes, the magnetic beads were taken out and gently shaken to keep them in a suspended state.

[0080] e. Collection: The centrifuge tube was taken out and centrifuged to collect the liquid on the tube cap and wall, placed on the magnetic stand to absorb magnetism for 1 minute, and then the supernatant DNA solution was carefully sucked.

[0081] 3. Bisulfite conversion

[0082] The extracted genomic DNA in step 2 was subjected to bisulfite conversion. The nucleic acid purification kit used was the nucleic acid purification kit from Wuhan Amison Life Science Co., Ltd. (Ehuanei preparation 20200843), and the specific experimental operation was referred to the kit instruction manual. In the final elution step, 25 μL of elution solution was used for DNA elution. In this process, unmethylated cytosine (C) was converted to uracil (U), and methylated cytosine remained unchanged. Uracil pairs with adenine (A) in the subsequent PCR step, and cytosine pairs with guanine (G), thereby distinguishing between methylated and unmethylated sequences.

[0083] 4. PCR reaction

[0084] The methylation level of the sample Chr7:99392794-99392876 region (target region) was detected by methylation-specific PCR, with ACTB as the internal reference gene. The primers and probes for PCR amplification of the target region and the internal reference gene were the same as those for the tissue sample PCR in Table 2.

[0085] Methylation-specific PCR was used to detect the DNA after bisulfite conversion. The PCR components, specifications, and volumes are shown in Table 5. Note that negative and positive control wells should be set up simultaneously for each sample detection. The negative and positive controls for urine samples are the same as those used for the tissue sample PCR described above.

[0086] Table 5

[0087]

[0088] The PCR reaction conditions are shown in Table 6. The PCR instrument used was an ABI 7500 fluorescent quantitative PCR instrument.

[0089] Table 6

[0090]

[0091]

[0092] Ct value reading: After PCR is completed, baseline adjustment is performed separately for the target region and the internal reference gene amplification curve. Specifically, the average of the fluorescence value 1-2 cycles before the minimum Ct value of the sample in one PCR is set as the baseline value, and the threshold value is set at the inflection point of the S-shaped amplification curve. The Ct value of each gene of the sample is automatically obtained by the PCR instrument software. When the sample has no amplification, the Ct value is recorded as 45.

[0093] Quality control: For each PCR, the negative control should have no amplification, the positive control should have a clear exponential growth period, and the Ct value of the positive control should be between 26 and 28. The Ct value of the internal reference gene of the sample should be ≤ 34. After the negative control, the positive control and the internal reference gene meet the above requirements, it indicates that this experiment is effective, and the next step of sample result analysis can be performed. Otherwise, the experiment is invalid and must be re-detected.

[0094] Result analysis and interpretation method: Calculate the difference between the Ct values of the target region and the internal reference gene of each sample, i.e. ΔCt1 value, calculate the difference between the Ct values of the target region positive control and the internal reference gene positive control in each detection, i.e. ΔCt2, then subtract ΔCt2 value from ΔCt1 value, i.e. ΔΔCt, take ΔΔCt as an indicator, draw a receiver operating characteristic curve (ROC) using R, and evaluate the ability of the indicator to distinguish between renal papillary uroepithelial carcinoma and other urinary system cancers and urinary system interference diseases. The ΔΔCt value when the Youden index is maximum is the best cut-off value.

[0095] 4. Result analysis

[0096] The ROC curve drawn by ΔΔCt of 47 cases of renal papillary cell carcinoma and 98 cases of urinary system interference disease urine sample DNA methylation detection is shown in the accompanying Figure 2 .

[0097] The accompanying Figure 2 , the best cut-off value of the ROC curve is 10.8, the sensitivity of the methylation detection method for prostate adenocarcinoma is 88.8%, the specificity is 89.4%, and the area under the curve (AUC) value is 0.892.

[0098] Example 3

[0099] In addition, urine samples of 20 cases of renal papillary cell carcinoma and 20 cases of urinary system interference diseases were collected, and DNA extraction, bisulfite conversion and methylation-specific PCR were performed on the urine samples according to the method described in Example 2. The samples in this example were used as an independent verification set, and the purpose was to further verify the accuracy of the target region methylation detection for renal papillary urothelial carcinoma.

[0100] According to the optimal cutoff value determined in Example 2, the diagnostic results of 20 cases of renal papillary cell carcinoma and 20 cases of urinary system interference diseases were predicted, and the results are shown in Table 7.

[0101]

[0102]

[0103]

[0104] The samples were determined to be positive or negative with a cutoff value of 10.8, and samples greater than the cutoff value were predicted to be interference samples, and samples less than or equal to the cutoff value were predicted to be prostate interference diseases. Comparing the prediction results with the true clinical diagnosis results of the samples, in 20 cases of prostate cancer samples, the number of methylation predicted to be cancer was 17, and the sensitivity of methylation detection for prostate cancer was 85% (17 / 20); in 20 cases of interference samples, the number of methylation predicted to be interference was 18, and the specificity of methylation detection for prostate cancer was 90% (18 / 20).

[0105] Although embodiments of the present application have been shown and described, it is to be understood that various modifications, substitutions, replacements and changes can be made to these embodiments without departing from the principles and spirit of the present application, and the scope of the present application is defined by the appended claims and their equivalents.

Claims

1. A specific methylation marker for auxiliary diagnosis of renal papillary cell carcinoma, characterized in that: The marker is a cytosine in at least one CpG site in the Chr7:99392794-99392876 region, taking the human genome GRCh38.p14 Primary Assembly as a reference genome.

2. The specific methylation marker for auxiliary diagnosis of renal papillary cell carcinoma according to claim 1, characterized in that: The marker is one or more of cytosine at positions Chr7:99392813, Chr7:99392820, Chr7:99392831, Chr7:99392855, and chr7:99392871.

3. Use of the specific methylation marker for auxiliary diagnosis of renal papillary cell carcinoma according to claim 1 or 2 in the preparation of an auxiliary diagnosis or screening product for renal papillary cell carcinoma, characterized in that: Auxiliary diagnosis or screening is achieved by detecting the methylation level of the marker.

4. Use of the specific methylation marker for auxiliary diagnosis of renal papillary cell carcinoma according to claim 3 in the preparation of an auxiliary diagnosis or screening product for renal papillary cell carcinoma, characterized in that: The reagent for detecting the methylation level of the marker comprises a primer pair, wherein the sequence of one primer is 5'TAGAATTTGGATAAGAAGGC 3', and the sequence of the other primer is 5'CTAACGCTATTCTTATACAACG 3'.

5. Use of the specific methylation marker for auxiliary diagnosis of renal papillary cell carcinoma according to claim 3 in the preparation of an auxiliary diagnosis or screening product for renal papillary cell carcinoma, characterized in that: The reagent for detecting the methylation level of the marker further includes a Taqman probe, and the probe sequence is 5'GAGTTTCGAGGGTGGTAC 3'.

6. Use of the specific methylation marker for auxiliary diagnosis of renal papillary cell carcinoma according to claim 3 in the preparation of an auxiliary diagnosis or screening product for renal papillary cell carcinoma, characterized in that: The product includes one or more of a kit, a chip, a computer system, and a sequencing library.

7. Use of the specific methylation marker for auxiliary diagnosis of renal papillary cell carcinoma according to claim 3 in the preparation of an auxiliary diagnosis or screening product for renal papillary cell carcinoma, characterized in that: The methylation level is detected by at least one of a methylation-specific PCR method, a sequencing method, a methylation-specific high-performance liquid chromatography method, a digital PCR method, a methylation-specific high-resolution melting curve method, a methylation-specific microarray method, and a methylation-sensitive restriction endonuclease method.

8. Use of the specific methylation marker for auxiliary diagnosis of renal papillary cell carcinoma according to claims 4 and 5 in the preparation of an auxiliary diagnosis or screening product for renal papillary cell carcinoma, characterized in that: The reagents include both the primer pair and the Taqman probe, and the product is a kit including the reagents.

Images