Preparation and application of influenza A virus discrimination and drug resistance detection gene chip

Abstract

The invention relates to a gene chip for screening influenza virus and detecting drug resistance. A preparation method of the gene chip comprises the following steps: preparing a universal primer, preparing a subtype nucleic acid typing probe and a drug-resistant probe, preparing an oligonucleotide chip, establishing an RT-PCR (Reverse Transcription-Polymerase Chain Reaction) system and establishing a hybridization system. The gene chip prepared by the invention can be used for simultaneously discriminating five subtypes of influenza A viruses, including influenza A H1N1, seasonal H1N1, seasonal H3N2, avian H5N1 and swine H1N1 influenza viruses, and can be used for prompting the tamiflu resistance condition of the influenza A viruses. The gene chip has the advantages of rapidness, accuracy, high flux and high specificity, and can provide guidance for monitoring, clinical diagnosis and treatment of influenza viruses.

Description

Technical Field

[0001] The present invention relates to the technical field of gene chip detection, and in particular to the preparation and use of a gene chip for influenza A virus identification and drug resistance detection. Background Art

[0002] Influenza virus belongs to Orthomyxoviridae in virus taxonomy. Its genome is segmented single-strand negative-sense RNA. According to the antigenic properties of viral nucleoprotein (NP) and membrane protein (MP) and their genetic properties, influenza viruses are divided into three types, A, B and C. Influenza A viruses can be further divided into many subtypes according to the structural properties of their surface hemagglutinin (HA) and neuraminidase (NA) proteins and their genetic properties. So far, 16 subtypes of hemagglutinin (H1-16) and 9 subtypes of neuraminidase (N1-9) have been found in influenza A viruses. Because of the segmented genome, reassortment of genes between different strains of the same subtype is easy to occur. Especially, the HA gene of human influenza A viruses can constantly mutate, resulting in replacement of amino acid sequences in the encoded HA protein molecules and constant antigenic drift. Each time of antigenic drift often brings about influenza epidemic of different degrees. At present, there are two types of officially listed drugs that can be used to treat influenza. One is neuraminidase inhibitors, including oseltamivir phosphate (Tamiflu) and zanamivir (Relenza); the other is M2 channel blockers, including amantadine and rimantadine. The emergence of viral drug resistance is one of the main reasons for the failure of antiviral therapy. Because influenza viruses are segmented RNA viruses with high mutation rate, and with the development of antiviral therapy, drug selection pressure and other factors, the emergence of viral drug resistance is inevitable. Although the number of cases of drug-resistant influenza A H1N1 viruses is small and sporadic, it still attracts the attention of the public and researchers. Therefore, the monitoring and research of drug resistance of influenza A H1N1 viruses are of great significance. Influenza A viruses have multiple highly pathogenic subtypes, and there are only slight differences between various subtypes at the protein or nucleic acid level. There is a demand for distinguishing various subtypes of influenza viruses in clinic. This situation puts forward high technical and methodological requirements for accurately distinguishing several important subtypes. For different detection objects, virus nucleic acid detection and protein detection are usually used. Virus nucleic acid detection is widely used because of its high sensitivity. As an important member of nucleic acid detection methods, gene chip technology has been used for influenza virus typing in recent years. The gene chip technology for typing detection of influenza viruses mentioned in domestic and foreign literature and patent documents is mostly for the typing of a certain type of influenza virus, and the method for simultaneously distinguishing different subtypes of influenza viruses is rarely reported. The operation steps are complicated, not standardized, and the cost is high. The Chinese patent application with publication number CN1858249A and publication date November 8, 2006 discloses a method for detecting avian influenza virus H5N1 subtype based on liquid chip. However, this method can only detect H5N1 subtype, and cannot simultaneously distinguish influenza A viruses such as H1N1 and H3N2. Moreover, this method needs to use the first round of RT-PCR reaction product as the template for the second round of PCR, which is easy to contaminate and takes a long time for detection.LiX reported a chip that can simultaneously detect H1N1, H1N2, H3N2, H5N1, and H9N2, with a sensitivity of 10 copies / system. A Chinese patent application, published on March 25, 2009, with publication number CN101392298A, discloses a method for detecting influenza and H5N1 subtype avian influenza viruses using a liquid phase chip. This method can detect a variety of influenza A and B viruses, including the highly pathogenic H5N1 subtype avian influenza virus. This method requires amplification of viral RNA through a quadruple RT-PCR reaction, with a sensitivity of 1 pgRNA. Michal reported a Fluchip that can simultaneously identify H1N1, H3N2, and H5N1 influenza viruses, but the entire process takes 12 hours and costs approximately $20 per sample, making it time-consuming and expensive. Since the outbreak of influenza A (H1N1) in March 2009, there have been few reports of gene chips that can simultaneously distinguish influenza A (H1N1) viruses from more common seasonal influenza viruses (H1N1, H3N2, avian H5N1, and swine H1N1). Lu briefly reported a chip that can distinguish between influenza A (H1N1) and seasonal influenza viruses. This method uses a two-step method to amplify viral RNA and hybridize it to the chip, which is time-consuming and lacks specificity and sensitivity. Summary of the Invention

[0003] The purpose of the present invention is to address some deficiencies in the field of influenza virus typing and drug resistance detection, and to develop a high-throughput, specific, sensitive, and rapid influenza A virus identification and drug resistance detection gene chip, which can simultaneously perform nucleic acid typing on common influenza A viruses and detect mutations in their Tamiflu resistance sites. In order to achieve the above-mentioned purpose, the present invention has developed a gene chip for detecting influenza A virus nucleic acid subtypes and drug resistance, and its preparation method is as follows: 1. Step 1: Prepare universal primers and select influenza virus NA gene as the detection target gene, so that universal amplification of influenza A H1N1, seasonal H1N1, seasonal H3N2, avian H5N1 and swine H1N1 viruses can be achieved through a single reaction. Preferably, three pairs of primer sequences and their corresponding amplification target virus types are shown in Table 1: Table 1 Primer sequences and corresponding amplification target viruses

[0004]

[0005] Step 2: Prepare subtype nucleic acid typing probes and drug resistance probes. Based on alignments between the NA gene sequences of the five influenza virus subtypes and within each influenza virus subtype, the typing probes were designed within the specific regions of the upstream and downstream primers. Each of the two influenza virus nucleic acid typing oligonucleotide probes corresponds to a subtype of influenza virus. The sequences of the influenza subtype nucleic acid typing probes and their corresponding target viruses are shown in Table 2. Table 2: Influenza Subtype Nucleic Acid Typing Probe Sequences and Their Corresponding Target Diseases.

[0006]

[0007] The H274Y codon on the NA gene of the N1 influenza virus mutated from CAT or CAC to TAT, and the E119V codon on the NA gene of the N2 virus mutated from GAA to GTA. With the drug-resistant mutant base as the center, drug-resistant detection probes were designed, with one wild-type and one mutant probe as a group. Probes that can accurately distinguish between wild-type and drug-resistant types of different subtypes of influenza viruses were screened through experiments. Influenza A H1N1, avian influenza H5N1 and swine influenza H1N1 share a pair of drug-resistant mutation detection probes, while seasonal H3N2 and seasonal H1N1 each use a pair of drug-resistant mutation detection probes. The drug-resistant detection probe sequences and corresponding target viruses are shown in Table 3:

[0008] Table 3 Drug resistance detection probe sequences and corresponding target diseases

[0009]

[0010] Step 3: Prepare an oligonucleotide chip. In a preferred embodiment, each oligonucleotide probe in step 2 is diluted with 2× spotting solution (6×SSC, 0.1% SDS) to a final concentration of 50 μM when spotting. Use a commercially available gene chip spotter to spot the probes on a blank aldehyde-modified glass slide, and the spotting amount of the probes is 3 nl. After the oligonucleotide chip is prepared, it is left to dry at room temperature for at least 18 hours before use. The chip is characterized in that the oligonucleotide probe array includes both influenza subtype nucleic acid typing probes and drug resistance detection probes, and its probe array is shown in Table 4. The substrate control probe is a 20T sequence, labeled with cy3 at the 5' end and modified with NH2 at the 3' end, which is used to monitor the quality of the aldehyde-based substrate; the negative probe is a plant gene sequence unrelated to the virus, used to indicate specificity; the universal sequence is a conserved sequence of influenza A virus; primers 1, 2, and 3 are the reverse complementary sequences of primers NR21, NR22, and NF5, respectively, and each sequence is modified with NH2 at the 3' end. Table 4 Oligonucleotide probe array

[0011] Chip matrix control Primer 1 Primer 2 Primer 3 Universal sequence Negative probe Negative probe Chip matrix control NEW-1 NEW-2 H1N1-1 H1N1-2 H3N2-1 H3N2-2 AIV-1 AIV-2 NEW-1 NEW-2 H1N1-1 H1N1-2 H3N2-1 H3N2-2 AIV-1 AIV-2 NEW-1 NEW-2 HN1-1 H1N1-2 H3N2-1 H3N2-2 AIV-1 AIV-2 OSE-1 OSE-2 OSE-3 OSE-4 OSE-5 OSE-6 SIV-1 SIV-2 OSE-1 OSE-2 OSE-3 OSE-4 OSE-5 OSE-6 SIV-1 SIV-2 OSE-1 OSE-2 OSE-3 OSE-4 OSE-5 OSE-6 SIV-1 SIV-2 Chip matrix control Negative probe Negative probe Universal sequence Primer 3 Primer 2 Primer 1 Chip matrix control

[0012] Step 4: Establishing the RT-PCR system The RT-PCR system in the gene chip of the present invention is characterized by a triple asymmetric RT-PCR reaction system. A suitable RT-PCR system can further improve the sensitivity of chip detection. The absolute concentration and relative ratio of the labeled primer and the unlabeled primer, the amount of Taq enzyme, and other factors were optimized. The preferred RT-PCR system is shown in Table 5: Table 5 RT-PCR system formula

[0013]

[0014] The preferred RT-PCR amplification conditions are: reverse transcription at 50°C for 30 minutes, denaturation at 94°C for 2 minutes; amplification for 45 cycles, denaturation at 94°C for 20 seconds, annealing at 55°C for 20 seconds, extension at 72°C for 20 seconds, and extension at 72°C for 2 minutes. 5. Step 5: Establishing the Hybridization System. An appropriate hybridization system significantly improves the specificity and sensitivity of the chip. Through optimization, the hybridization solution composition, hybridization conditions, and post-hybridization wash conditions were determined to ensure both specificity and sensitivity. In the hybridization system, the RT-PCR product and hybridization solution were mixed in equal volumes. The preferred final concentrations of the hybridization solution components are 4×SSC, 0.3% SDS, 5% formamide, and 16 μM 20T-NH2. The preferred hybridization condition is hybridization in a 45°C waterbath for 1 hour. The preferred wash conditions are 20 seconds each in Wash Solution A (1×SSC, 0.2% SDS), Wash Solution B (0.2×SSC), and Wash Solution C (0.1×SSC) at room temperature. The influenza A virus screening and drug resistance detection gene chip prepared above includes an oligonucleotide chip, an RT-PCR system, a hybridization solution, a washing solution A, a washing solution B, and a washing solution C. A preferred embodiment uses a commercially available RNA extraction kit to extract viral RNA, such as Qiagen's QIAampviralRNAminikit, and the extraction is carried out with reference to the corresponding RNA extraction kit instructions. The extracted viral RNA is amplified using the RT-PCR system according to the amplification conditions in step four. The RT-PCR product is mixed with an equal volume of hybridization solution, added to the oligonucleotide chip, hybridized according to the hybridization conditions of step five, and then washed according to the washing conditions of step five. The washed chip is scanned using a commercially available chip scanner (such as GenePix4000B), and the results are interpreted using analysis software. Various types of influenza viruses, parainfluenza viruses, and common respiratory viruses are selected as samples, and the gene chip prepared above is used for detection to investigate the specificity of the chip. A total of 10 sensitivity reference substances, including 5 subtypes of influenza virus wild type and mutant types, are selected to investigate the minimum detection limit of the chip. The sensitivity of the chip was evaluated by RNA extracted from serially diluted influenza A (H1N1) viruses. Results: The chip was able to detect 103 copies / system of in vitro transcribed RNA for each influenza virus subtype, and for influenza A (H1N1) virus samples, the chip sensitivity reached 103 PFU / ml. Using the gene chip prepared by the present invention, 130 throat swabs of suspected influenza A (H1N1) patients admitted to the 302 Hospital and other institutions were tested. Forty-one of these patients tested positive for influenza A (H1N1) virus on the chip. These 41 cases were then verified using real-time fluorescence quantitative PCR reagents and sequencing, and all were positive for influenza A (H1N1) virus.The present invention has developed a fluorescence-based gene chip that can type five common influenza A virus subtypes, including influenza A (H1N1), seasonal H1N1, seasonal H3N2, avian H5N1, and swine H1N1. It can also detect drug-resistant mutations in these viruses, including the H274Y resistance mutation in four N1 influenza viruses and the E119V resistance mutation in H3N2. Performance evaluations have shown that the gene chip can accurately distinguish influenza A from influenza B, parainfluenza, and other common respiratory viruses, and can accurately type five different influenza A subtypes with good specificity. The present invention can detect 10 copies / system of in vitro transcribed RNA for all five influenza virus subtypes. Testing of throat swabs from suspected influenza patients demonstrated a high concordance rate with real-time fluorescence quantitative RT-PCR and sequencing methods. The present gene chip and corresponding preparation method belong to the field of influenza virus nucleic acid detection. Compared with conventional culture methods, this method is faster and more accurate, and compared with immunological methods and other nucleic acid detection methods, it has the advantages of high throughput and high specificity. Another outstanding advantage of the present invention is that it can detect Tamiflu resistance while performing high-throughput influenza virus typing. The gene chip of the present invention has strong practicality and can provide guidance for influenza virus monitoring, clinical diagnosis, and treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Agarose gel electrophoresis of universal amplification products from five influenza virus subtypes. In the figure, M represents a molecular weight standard (band sizes from top to bottom are 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp, respectively); 1 represents influenza A (H1N1) virus; 2 represents seasonal influenza A (H1N1) virus; 3 represents a negative control; 4 represents avian influenza A (H5N1) virus; 5 represents swine influenza A (H1N1) virus; and 6 represents seasonal influenza A (H3N2) virus.

[0016] Figure 2Diagram of the final probe array for the influenza A virus nucleic acid identification and drug resistance detection gene chip. Each dot in the diagram represents a single spotting of a probe, and the three vertical dots represent three replicates of a single probe. Regions A to F correspond to subtype-specific probes for each influenza virus subtype. The two probes in region A correspond to influenza A (H1N1), the two probes in region B correspond to seasonal influenza (H1N1), the two probes in region C correspond to seasonal influenza (H3N2), the two probes in region E correspond to avian influenza (H5N1), and the two probes in region F correspond to swine influenza (H1N1). Regions F to H correspond to drug resistance detection probes, with W representing wild type and M representing drug-resistant mutants. Region F corresponds to drug resistance detection probes for influenza A (H1N1), avian influenza (H5N1), and swine influenza (H1N1), region G corresponds to drug resistance detection probes for seasonal influenza (H1N1), and region H corresponds to drug resistance detection probes for seasonal influenza (H3N2). Other dots represent negative probes, positive probes, primer-complementary sequence probes, and on-chip control probes.

[0017] Figure 3 Results of gene chip specificity evaluation for influenza A virus nucleic acid screening and drug resistance detection. Figures 1-4 represent influenza A (H1N1) viruses; 5 represents avian influenza (H5N1) viruses; 6-8 represent seasonal influenza (H1N1) viruses; 9-12 represent seasonal influenza (H3N2) viruses; 13 represents mumps virus; 14 represents adenovirus; 15 represents measles virus; 16 represents rubella virus; 17 represents parainfluenza virus; and 18-24 represent influenza B viruses.

[0018] Figure 4 Chip detection of Tamiflu-resistant mutations in seasonal H1N1 influenza virus and sequencing comparison. A shows the chip detection results of the present invention. The red box indicates a positive probe for the seasonal H1N1 drug-resistant mutation, indicating that the influenza virus is Tamiflu-resistant. B shows the sequencing peak graph, where the boxed base is T, indicating that the sequence has mutated from wild-type CAT to TAT. C shows the sequencing result comparison graph. The boxed base T is the sequencing result. The first four sequences above it are mutant (T), and the last 11 sequences are wild-type (C).

[0019] Figure 5 Sequencing and alignment of drug-resistant mutations across five influenza virus subtypes. Figure A shows the drug-resistant mutation site of influenza A (H1N1): CAC to TAC; B shows the drug-resistant mutation site of avian influenza (H5N1): CAC to TAC; C shows the drug-resistant mutation site of swine influenza (H1N1): CAC to TAC; D shows the drug-resistant mutation site of seasonal influenza (H3N2): GAA to GTA; and E shows the drug-resistant mutation site of seasonal influenza (H1N1): CAT to TAT.

[0020] Figure 610 Sensitivity reference chip detection results. Figure -1 and -2 represent 104copies / system and 103copies / system, respectively. 1: wild-type H1N1 influenza A virus; 2: mutant H1N1 influenza A virus; 3: wild-type seasonal H1N1 influenza virus; 4: mutant seasonal H1N1 influenza virus; 5: wild-type seasonal H3N2 influenza virus; 6: mutant seasonal H3N2 influenza virus; 7: wild-type H5N1 avian influenza virus; 8: mutant H5N1 avian influenza virus; 9: wild-type H1N1 swine influenza virus; 10: mutant H1N1 swine influenza virus.

[0021] Figure 7 RT-PCR product agarose electrophoresis of gradient-diluted H1N1 influenza A virus. M: DL2000 molecular weight marker (from top to bottom, the band sizes are 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp); 1: 10-fold dilution of virus culture solution; 2: 100-fold dilution of virus culture solution; 3: 1000-fold dilution of virus culture solution; 4: 10000-fold dilution of virus culture solution; 5: 100000-fold dilution of virus culture solution.

[0022] Figure 8 Chip detection results of gradient-diluted H1N1 influenza A virus. 1: 10-fold dilution of virus culture solution; 2: 100-fold dilution of virus culture solution; 3: 1000-fold dilution of virus culture solution; 4: 10000-fold dilution of virus culture solution; 5: 100000-fold dilution of virus culture solution; 6: negative control.

[0023] Figure 9 Results of chip detection of H1N1 influenza A virus in throat swabs. The numbers represent sample numbers, and NTC represents the negative control. DETAILED DESCRIPTION

[0024] The following examples are intended to illustrate and not to limit the present application. Example 1: Development of a gene chip for the identification of influenza A virus nucleic acid and drug resistance detection Figure 1 .

[0025] 2. Screening of specific probes

[0026] The screening of typing probes first eliminated the non-specific cross between the probe and other respiratory viruses, and then used RT-PCR products with 5 subtypes of influenza virus RNA as templates to hybridize with alternative probes respectively to examine the typing ability of the probes between different subtypes of influenza viruses. Finally, 10 subtype-specific probes were screened, with 2 subtype-specific probes corresponding to each subtype. The probe sequences and corresponding target viruses are shown in Table 2. In the screening of drug-resistant mutation site detection probes, it was finally determined that the discrimination ability of 21nt and 20nt probes was more than 2.5 times. Influenza A H1N1, avian influenza H5N1 and swine influenza H1N1 share a pair of drug-resistant mutation detection probes (wild type and mutant type), and seasonal H3N2 and seasonal H1N1 each use a pair of drug-resistant mutation detection probes. The probe sequences and corresponding target viruses are shown in Table 3. III. Preparation of oligonucleotide chips and probe arrays After completing the probe screening, the final probe array was determined, see Table 4 and Appendix. Figure 2. Wherein the four corners of the array are the chip matrix control, primer 1, 2, 3 are the reverse complement sequences of NR21, NR22 and NR5 respectively. The negative probe is a sequence from a rice gene: 5'-TGCATGAGGATTTATCCGTATGGATGCCTGCTACTTGTCG-3' (SEQ ID NO: 23). The universal sequence is a conserved sequence of influenza A virus: CATGGCTCGAATCGACCGTGGGTG (SEQ ID NO: 24) Four, RT-PCR system The feature of the RT-PCR system in the present application is a triple asymmetric RT-PCR system. A suitable RT-PCR system can further improve the sensitivity of the chip detection. The absolute concentration and relative proportion of the labeled primer and the non-labeled primer, the amount of Taq enzyme, and other factors are optimized. When the final concentration of the upstream and downstream primers is 0.1 μM:0.5 μM, and the amount of Taq enzyme is 3 U / system, the probe fluorescence value of the reference is strong, and the low copy template 103 copies / μl can still be detected. The final RT-PCR system is shown in Table 5, and the RT-PCR amplification conditions are as follows: 50°C reverse transcription for 30 min, 94°C denaturation for 2 min; 45 cycles of amplification, 94°C denaturation for 20 s, 55°C annealing for 20 s, 72°C extension for 20 s; 72°C extension for 2 min. Five, Establishment and optimization of hybridization system The hybridization solution composition, hybridization conditions and post-hybridization washing conditions that can ensure specificity and sensitivity at the same time are obtained by optimization. In the hybridization system, the RT-PCR product is mixed with the hybridization solution in equal volume, and the final concentration of each component of the hybridization solution is 4xSSC, 0.3% SDS, 5% formamide, and 16 μM 20T-NH2. The hybridization conditions are 45°C water bath hybridization for 1 hour. The washing conditions are as follows: each washing for 20 s in washing solution A (1xSSC, 0.2% SDS), washing solution B (0.2xSSC), and washing solution C (0.1xSSC) at room temperature. Example 2: Determination of gene chip positive judgment standard Cutoff value is the standard for judging whether the gene chip signal value is positive. Each typing probe selects a non-influenza virus (i.e. a negative strain) and a blank control for gene chip hybridization, and through repeated experiments and data statistics, the average value + 2SD of the background of the negative strain and the blank control is taken as the Cutoff value of each probe, as shown in Table 6. The discrimination ability of each mutation detection probe is more than 2.5 times as the judgment standard for whether the drug resistance site has a mutation. Table 6 Determination of Cutoff value of each probe.

[0027]

[0028] Example 3: Evaluation of specificity of influenza A virus nucleic acid discrimination and drug resistance detection gene chip Specificity is the most important evaluation index of a diagnostic method. The gene chip of the present application uses an optimized system and conditions to detect 24 strains of influenza viruses, parainfluenza viruses, and common respiratory viruses, and the detection results are shown inFigure 3 . As can be seen from the figure, the present invention can not only correctly distinguish influenza A virus from other common respiratory viruses and influenza B virus, but also correctly distinguish influenza A H1N1, seasonal H1N1, seasonal H3N2 and avian influenza H5N1 among influenza A viruses, with good specificity. In addition, the experiment screened out a seasonal H1N1 influenza virus with a mutation in the Tamiflu resistance mutation site. After sequencing verification, the results were consistent with the chip results, indicating that the chip resistance mutation site detection probe has good typing ability. The chip detection results and sequencing verification results of this strain are attached. Figure 4 Example 4: Evaluation of the sensitivity of influenza virus nucleic acid screening and drug resistance detection gene chip. Mutant plasmids of five subtypes of N1 influenza virus were constructed by PCR overlap extension method. After the mutant plasmids were sequenced and verified to be the correct sequence, they were used as templates to prepare in vitro transcribed RNA to construct influenza virus sensitivity reference products. The sequence alignment and sequencing results of the mutant plasmids are shown in the attached Figure 5 , as can be seen from the alignment graph and sequencing peak graph, the drug resistance site mutations of the five subtypes of influenza virus were successfully constructed. The constructed influenza virus sensitivity reference was used to evaluate the detection sensitivity of the chip for the five subtypes of influenza virus. Since the reference materials involved in the experiment included 10 wild-type and mutant types, 104 copies / μl and 103 copies / μl of in vitro transcribed RNA were selected for chip detection for each reference material. The results are shown in the attached Figure 6 . As can be seen from the figure, the chip can detect 103 copies / system of in vitro transcribed RNA for each subtype of influenza virus, and the detection limit of the chip is 103 copies / system of in vitro transcribed RNA. Another method was used to evaluate the sensitivity of influenza A (H1N1) virus. The virus culture fluid with a virus titer of 28PFU / ml was diluted 10 times to extract RNA, and the optimized chip method was used for detection. As a result, when the RNA extracted after the virus was diluted 100,000 times, the chip detection of influenza A (H1N1) probe signal value was still greater than the corresponding cutoff value, that is, influenza A (H1N1) virus with a concentration of 28PFU / ml can be detected using this chip method. The results of RT-PCR product electrophoresis are attached. Figure 7 , the corresponding chip test results are attached Figure 8 .

[0029] Example 5: Influenza A virus nucleic acid discrimination and drug resistance detection gene chip clinical sample detection 130 cases of suspected influenza patients' throat swabs or throat swab RNA were detected using the gene chip of the present application. Among them, 41 cases of chip detection of influenza A H1N1 virus were positive. These 41 cases were rechecked by "influenza A H1N1 virus real-time fluorescent RT-PCR kit (complex probe method)" and sequencing method, and all were positive for influenza A H1N1 virus. The results of real-time fluorescent RT-PCR are shown in Table 7, and part of the chip detection results are shown in the following Table 8. Figure 9 The results show that the gene chip of the present application is comparable in sensitivity to real-time fluorescent RT-PCR.

[0030]

[0031] In addition to the above examples, the present application also has other implementation manners. Any technical solution formed by equivalent substitution or equivalent transformation is within the protection scope required by the present application.

Claims

1. A gene chip for detecting influenza A virus nucleic acid subtypes and drug resistance, the preparation method comprising: 1) Step 1: Prepare 3 pairs of universal primers, the sequences of which are shown in Table 1: Table 1 Primer sequences 2) Step 2: Prepare 10 influenza subtype nucleic acid typing probes and 6 drug resistance detection probes, the sequences of which are shown in Tables 2 and 3: Table 2 Influenza subtype nucleic acid typing probe sequences Table 3 Drug resistance detection probe sequences 3) Step 3: Each oligonucleotide probe from Step 2 was diluted with 6×SSC, 0.1% SDS to a final concentration of 50 μM and spotted onto a blank, aldehyde-modified glass slide. The array is shown in Table 4. The on-slide matrix control probe was a 20T sequence labeled with Cy3 at the 5' end and amino-modified at the 3' end; the negative probe was a plant gene sequence unrelated to viruses; the universal sequence was a conserved sequence of influenza A virus; primers 1, 2, and 3 were the reverse complements of primers NR21, NR22, and NF5, respectively, each with an amino-modified 3' end. All probes were spotted at a volume of 3 nL and allowed to dry at room temperature for at least 18 hours before use. Table 4 Oligonucleotide probe array 4) Step 4: Prepare RT-PCR system, the formula is shown in Table 5: Table 5 RT-PCR system formula 5) Step 5: Prepare hybridization solution, which consists of 4×SSC, 0.3% SDS, 5% formamide, 16 μM 20T-NH2; prepare wash solution A, which consists of 1× SSC, 0.2% SDS; Prepare wash solution B, which consists of 0.2× SSC; Prepare wash solution C, which consists of 0.1×SSC.

2. The gene chip according to claim 1, further characterized in that Used for influenza A virus nucleic acid typing and influenza A virus Tamiflu resistance detection.

Images