RNAi medicine for treating lung adenocarcinoma by inhibiting SSR4 gene

By designing RNAi drugs targeting the SSR4 gene and using siRNA and shRNA molecules to inhibit the proliferation and invasion of lung adenocarcinoma cells, the problems of drug resistance and heterogeneity in the treatment of lung adenocarcinoma were solved, providing a new treatment method.

CN120771290APending Publication Date: 2025-10-14AFFILIATED HOSPITAL OF NANTONG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511148864.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-18
Publication Date
2025-10-14

AI Technical Summary

Technical Problem

The early symptoms of lung adenocarcinoma are not obvious, the lesions progress rapidly, and they are highly heterogeneous. Existing treatments are prone to drug resistance, and new therapeutic targets and drugs are needed.

Method used

RNAi drugs targeting the SSR4 gene are designed, and siRNA and shRNA molecules are used to inhibit SSR4 gene expression. They are delivered through lentiviral vectors or adenoviral vectors to inhibit the proliferation, migration and invasion of lung adenocarcinoma cells.

Benefits of technology

Effectively inhibiting SSR4 gene expression significantly weakened the proliferation, migration and invasion ability of lung adenocarcinoma cells, providing a new strategy for the treatment of lung adenocarcinoma.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005551834620000011
    Figure HDA0005551834620000011
  • Figure HDA0005551834620000021
    Figure HDA0005551834620000021
  • Figure HDA0005551834620000022
    Figure HDA0005551834620000022
Patent Text Reader

Abstract

The invention discloses application of a signal sequence receptor subunit delta gene SSR4 as a drug target in development of lung adenocarcinoma treatment drugs. The invention further discloses an RNAi molecule for inhibiting the SSR4 gene to treat lung adenocarcinoma. The RNAi molecule is a shRNA molecule with a target sequence selected from SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 7 and SEQ ID NO: 10. The shRNA molecule disclosed by the invention can be used for preparing a medicine for treating lung adenocarcinoma.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to the use of the SSR4 gene as a drug target for treating lung adenocarcinoma and an RNAi drug molecule for inhibiting the SSR4 gene. Background Art

[0002] Lung adenocarcinoma (LUAD), the most common subtype of lung cancer, is one of the most common malignant tumors with the highest morbidity and mortality rates. Despite significant advances in the diagnosis and treatment of LUAD in recent years, including advancements in imaging techniques, the development of molecularly targeted therapies, and the introduction of immunotherapy, numerous challenges remain. First, early symptoms of LUAD are often subtle or absent, leading many patients to be diagnosed at an advanced stage. Second, LUAD progresses rapidly and exhibits high heterogeneity, meaning that the same type of LUAD may exhibit distinct biological behaviors and responses to treatment in different patients. This presents challenges for personalized treatment, necessitating precise diagnostic and treatment strategies. Furthermore, LUAD is prone to developing drug resistance, particularly to chemotherapy and targeted therapies, which can significantly reduce treatment efficacy and even lead to recurrence and metastasis. Therefore, identifying new therapeutic targets, developing novel anti-tumor drugs, and exploring the combined use of multiple therapeutic approaches are key areas of current research.

[0003] Genes / proteins abnormally overexpressed in lung adenocarcinoma patients can be targeted for therapeutic development, such as RNAi (RNAi) drugs. RNAi (RNA interference) is a conserved biological response to double-stranded RNA that mediates resistance to endogenous parasites and exogenous pathogenic nucleic acids and regulates the expression of protein-coding genes. RNAi is currently considered precise, effective, and stable, and superior to antisense therapy in gene suppression. Antisense RNA produced intracellularly by expression vectors can be developed and used as new therapeutic agents. In the treatment of human diseases, an increasing number of biotechnology and pharmaceutical companies are participating in the research and development of RNAi drugs. Currently, RNAi therapeutics for dozens of diseases have entered Phase I to III clinical trials internationally. Because RNAi technology can specifically knock out or shut down the expression of specific genes, it has been widely used to explore gene function and treat infectious diseases and malignancies, making it an ideal therapeutic approach for blocking gene expression. Summary of the Invention

[0004] During clinical practice and research, our research group unexpectedly discovered that signal sequence receptor subunit δ (SSR4) was highly expressed in lung adenocarcinoma tissue from patients with lung adenocarcinoma. Furthermore, we found that the SSR4 gene was highly expressed in lung adenocarcinoma cells. The signal sequence receptor subunit δ gene, SSR4, encodes the transporter-associated protein δ (TRAPδ) subunit. The TRAP complex consists of four transmembrane subunits (α, β, γ, and δ), which are present in the endoplasmic reticulum (ER) and are involved in the transport of proteins across the ER membrane. Studies have shown that the TRAP complex participates in the regulation of humoral immunity by directing the secretion and transport of immunoglobulins. Previous studies have found that the SSR family is highly expressed in human primary melanoma, liver cancer, and other tumors, and plays a role in promoting tumor cell survival, suggesting that they can serve as target molecules for tumor suppression. However, there are currently no reports on the expression and research of the SSR4 gene in lung adenocarcinoma. Therefore, 80 shRNA sequences were designed targeting the conserved region of the SSR4 gene. By infecting lung adenocarcinoma cells H1299, A549, PC9, and H1975, several shRNA molecules were confirmed to effectively inhibit the proliferation, migration, and invasion of these lung adenocarcinoma cells, suggesting that SSR4 can be used as a therapeutic target for lung adenocarcinoma. Furthermore, these shRNA molecules can effectively inhibit the SSR4 gene and thus serve as therapeutic drugs for lung adenocarcinoma. Based on these findings, the present invention includes the following technical solutions.

[0005] The first aspect of the present invention provides the use of the signal sequence receptor subunit δ (SSR4) gene (NCBI accession number 6748) as a drug target in the development of therapeutic drugs for lung adenocarcinoma.

[0006] A second aspect of the present invention provides a drug for treating lung adenocarcinoma, wherein the active pharmaceutical ingredient (API) is a substance that inhibits the expression of the SSR4 gene.

[0007] Preferably, the above-mentioned pharmaceutical active ingredient is an RNAi molecule.

[0008] Specifically, the above-mentioned RNAi molecule is an siRNA molecule or shRNA molecule targeting the conserved region of the SSR4 gene, preferably an RNAi molecule that can effectively inhibit the proliferation, migration and invasion of lung adenocarcinoma cells H1299, A549, PC9 and / or H1975, or an RNAi molecule that can effectively promote the apoptosis of lung adenocarcinoma cells H1299, A549, PC9 and / or H1975.

[0009] Furthermore, the RNAi molecule is an siRNA molecule or shRNA molecule targeting a target sequence of the SSR4 gene selected from SEQ ID NOs: 1, 4, 7 and 10, wherein the gene of the shRNA molecule comprises a sense strand and an antisense strand:

[0010] Target sequence: 5'-GCAAGAACAGGGTCCAGAACA-3' (SEQ ID NO: 1), herein named shRNA-321,

[0011] Sense strand 5'-3':

[0012] CACC GCAAGAACAGGGTCCAGAACA TTCAAGAGA TGTTCTGGACCCTGTTCTTGC TTTTTTG (SEQ ID NO: 2),

[0013] Antisense strand 5'-3':

[0014] GATCCAAAAAA GCAAGAACAGGGTCCAGAACA TCTCTTGAA TGTTCTGGACCCTGTTCTTGC (SEQ ID NO: 3);

[0015] Target sequence: 5'-GGAAGGCTCAGAGGAATAACG-3' (SEQ ID NO: 4), herein designated as shRNA-498,

[0016] Sense strand 5'-3':

[0017] CACC GGAAGGCTCAGAGGAATAACG TTCAAGAGA CGTTATTCCTCTGAGCCTTC C TTTTTTG (SEQ ID NO: 5),

[0018] Antisense strand 5'-3':

[0019] GATCCAAAAAA GGAAGGCTCAGAGGAATAACG TCTCTTGAA CGTTATTCCTCTG AGCCTTCC (SEQ ID NO: 6);

[0020] Target sequence: 5'-CATCCCGCCTCTGTTTACAGT-3' (SEQ ID NO: 7), herein designated as shRNA-532,

[0021] Sense strand 5'-3':

[0022] CACCG CATCCCGCCTCTGTTTACAGT TTCAAGAGA ACTGTAAACAGAGGCGGGA TG TTTTTTG (SEQ ID NO: 8),

[0023] Antisense strand 5'-3':

[0024] GATCCAAAAAA CATCCCGCCTCTGTTTACAGT TCTCTTGAA ACTGTAAACAGAG GCGGGATGC (SEQ ID NO: 9);

[0025] Target sequence: 5'-GGCCTTGTGATCTACTACTTG-3' (SEQ ID NO: 10), herein named shRNA-620,

[0026] Sense strand 5'-3':

[0027] CACC GGCCTTGTGATCTACTACTTG TTCAAGAGA CAAGTAGTAGATCACAAGGCC TTTTTTG (SEQ ID NO: 11),

[0028] Antisense strand 5'-3':

[0029] GATCCAAAAAA GGCCTTGTGATCTACTACTTG TCTCTTGAA CAAGTAGTAGATCA CAAGGCC (SEQ ID NO: 12).

[0030] In particular, the two sequences shRNA-620 and shRNA-498 had a more significant inhibitory effect on the SSR4 gene.

[0031] Alternatively, the shRNA molecules are provided in the form of their expression plasmids. Preferably, the plasmid vector is a viral vector such as a lentiviral vector or an adenoviral vector.

[0032] Furthermore, the plasmid vector of the above-mentioned shRNA molecule expression plasmid is the mammalian cell interference plasmid-lentiviral vector pGPU6 / GFP / Neo, and accordingly, the shRNA molecule expression plasmids are named pGPU6 / GFP / Neo-SSR4-Homo-321 (abbreviated as sh-SSR4-3), pGPU6 / GFP / Neo-SSR4-Homo-498 (abbreviated as sh-SSR4-4), pGPU6 / GFP / Neo-SSR4-Homo-532 (abbreviated as sh-SSR4-5) and pGPU6 / GFP / Neo-SSR4-Homo-620 (abbreviated as sh-SSR4-6).

[0033] In one embodiment, the above-mentioned drug is a pharmaceutical composition, which contains, in addition to a therapeutically effective amount of the shRNA molecule described above as an active ingredient, a pharmaceutical composition further comprising a pharmaceutically acceptable carrier such as LNPs (lipid nanoparticles).

[0034] In another embodiment, the above-mentioned drug is a pharmaceutical composition, which, in addition to a therapeutically effective amount of the shRNA molecule described above, further comprises one or more other pharmaceutical ingredients that inhibit SSR4 gene expression or inhibit SSR4 function.

[0035] In another embodiment, the above-mentioned medicament is a pharmaceutical composition, which comprises one or more other therapeutic ingredients for treating lung adenocarcinoma in addition to the therapeutically effective amount of the shRNA molecule as described above.

[0036] Alternatively, the medicament of the present application can be in various forms as long as it is suitable for administration for treating lung adenocarcinoma and properly maintains the biological activity of the active ingredients, i.e. nucleic acid RNA and / or DNA molecules and plasmids. For example, the medicament can be in the form of an injection or a gel. The injection can be suitable for subcutaneous injection, intramuscular injection, intravenous injection or intravenous drip. For example, for an injection administration system, the dosage form can be a lyophilized powder. The injection can be administered subcutaneously, intramuscularly, intravenously or intravenously by gradual infusion over time. Given the appropriate formulation for a given route, for example, the agents that can be used in the methods and compositions described herein can be administered intravenously, intranasally, by inhalation, intraperitoneally, intramuscularly, subcutaneously, intracavity, and if necessary, delivered by means of a peristaltic pump, a port, or by other means known to those skilled in the art. Preferably, the lung adenocarcinoma to be treated is administered intravenously or intramuscularly.

[0037] The present application finds that SSR4 can be used as a biomarker for lung adenocarcinoma and as a target for treating lung adenocarcinoma. Several shRNA molecules, shRNA-321, shRNA-498, shRNA-532 and shRNA-620, designed to screen the conserved region of SSR4, can effectively inhibit the expression of SSR4 gene. For example, cell infection experiments show that the shRNA molecules significantly inhibit the expression of SSR4 gene in lung adenocarcinoma H1299 cells; CCK8 experiments show that shRNA-620 and shRNA-498 inhibit the proliferation of lung adenocarcinoma H1299 cells; cell scratch experiments show that shRNA-620 and shRNA-498 reduce the migration ability of H1299 cells; Transwell experiments show that shRNA-620 and shRNA-498 inhibit the invasion and migration of lung adenocarcinoma H1299 cells. The above results show that these shRNA molecules can inhibit the expression of SSR4 gene and achieve the purpose of inhibiting the growth of lung adenocarcinoma, and play a role in gene therapy, providing a new treatment strategy for the clinical treatment of lung adenocarcinoma. BRIEF DESCRIPTION OF DRAWINGS

[0038] 图1 Bioinformatics analysis showed the expression and prognosis of SSR4 in lung adenocarcinoma tissues. Among them, A-B: according to GSE31210 and UALCAN database, the expression of SSR4 in lung adenocarcinoma tissues was significantly higher than that in normal tissues; C: HPA database immunohistochemical image showed that SSR4 was strongly expressed in lung adenocarcinoma; D: GSE31210 data survival analysis showed that the overall survival rate of patients with high expression of SSR4 was lower.

[0039] 图2 The expression of SSR4 in various lung adenocarcinoma cells was shown, and qRT-PCR and Western blotting verified the interference efficiency of shRNA of SSR4 gene. Among them, A: qRT-PCR detected the mRNA expression of SSR4 in various lung adenocarcinoma cell lines, and H1299 cells had the highest expression; B: qRT-PCR verified the interference effect of shRNA-620 and shRNA-498 on SSR4 mRNA in H1299 cells, which was significantly lower than that of NC group; C: Western blotting detected the interference of shRNA-620 and shRNA-498 on the protein level of SSR4 in H1299 cells, and the interference group was significantly reduced. In the figure, sh-SSR4-3, sh-SSR4-4, sh-SSR4-5 and sh-SSR4-6 are the abbreviations of expression vectors pGPU6 / GFP / Neo-SSR4-Homo-321, pGPU6 / GFP / Neo-SSR4-Homo-498, pGPU6 / GFP / Neo-SSR4-Homo-532 and pGPU6 / GFP / Neo-SSR4-Homo-620, and the following is the same.

[0040] 图3 Cell scratch test was used to verify the effect of SSR4 knockdown on lung adenocarcinoma cell migration. The results of cell scratch test showed that the migration ability of H1299 cells in shRNA-620 and shRNA-498 groups was significantly decreased compared with the control group (P<0.001).

[0041] 图4 Transwell experiment was used to evaluate the effect of SSR4 knockdown on lung adenocarcinoma cell invasion and migration. After SSR4 knockdown, the migration and invasion ability of H1299 cells was significantly weakened compared with the control group (P<0.01).

[0042] 图5 CCK8 experiment was used to verify the effect of SSR4 knockdown on lung adenocarcinoma cell proliferation. After SSR4 knockdown, the proliferation ability of H1299 cells was significantly weakened compared with the control group (P<0.001). DETAILED DESCRIPTION

[0043] The discovery of new biomarkers and therapeutic targets for lung adenocarcinoma can provide new approaches for lung adenocarcinoma treatment, including various types of therapeutic drugs, such as small molecule inhibitor compounds, antibody drugs, and RNAi drugs.

[0044] RNAi drugs primarily include small interfering RNA (siRNA) molecules and short hairpin RNA (shRNA) molecules. These two types of RNAi molecules differ in size, mechanism of action, and delivery method. For example, the use of shRNA generally requires the construction of an expression vector, such as a plasmid or viral vector, to introduce the DNA sequence encoding the shRNA into cells, where it is transcribed by RNA polymerase III into the siRNA.

[0045] Relatively speaking, the advantages of shRNA molecules include: their encoding genes are generally cloned into plasmids or viral vectors to construct expression vectors, which can achieve high transfection efficiency even in difficult-to-transfect cell types. They can be continuously transcribed in large quantities within cells, stably expressed and exerted over long periods of time, and can silence target genes for several weeks. shRNA has relatively low off-target effects, possibly because it undergoes specific processing and action within the cell, making its binding to the RISC complex more stable and specific. Furthermore, shRNA is more suitable for situations requiring long-term and stable inhibition of gene expression, such as establishing stable gene-silencing cell lines and conducting long-term gene function studies in animal models.

[0046] In our clinical practice and pathological studies, we have found that SSR4 is highly expressed in lung adenocarcinoma tissue from patients, particularly in lung adenocarcinoma cells. We hypothesize that there is a specific relationship between SSR4 levels and lung adenocarcinoma. SSR4 may be used as a biomarker and / or therapeutic target for lung adenocarcinoma, potentially enabling the development of therapeutic drugs for lung adenocarcinoma. These drugs could include chemical agents, genetically engineered drugs, and nucleic acid drugs.

[0047] Therefore, we attempted to use RNAi technology to knock down the SSR4 gene level in lung adenocarcinoma cells H1299, A549, PC9 and / or H1975 by designing a series of shRNA molecules and infecting lung adenocarcinoma cells, and observe the cell invasion activity, cell migration ability and cell proliferation.

[0048] Experiments have shown that several shRNA molecules, including shRNA-321, shRNA-498, shRNA-532 and shRNA-620, especially shRNA-498 and shRNA-620, can significantly inhibit the expression of SSR4 gene in cells, showing their potential as therapeutic drugs for lung adenocarcinoma.

[0049] As used herein, the terms "shRNA," "shRNA sequence," "shRNA molecule," "double-stranded shRNA," or "double-stranded shRNA molecule" are interchangeable and have the same meaning and scope. ShRNA is a double-stranded structure formed by annealing of the sense and antisense strands.

[0050] For simplicity, the terms "SSR4" and "DNA" are sometimes used interchangeably in this document. Those skilled in the art will understand that they refer to different substances in different contexts. They will readily understand their meaning based on the context. For example, when describing the function or class of signal sequence receptor subunit δ, SSR4 refers to the protein; when describing a gene, it refers to the gene encoding signal sequence receptor subunit δ.

[0051] Similarly, for ease of description, RNA, such as shRNA, is sometimes used interchangeably with the names of its encoding gene. Those skilled in the art will understand that they represent different substances in different descriptions, and their meanings are readily understood by those skilled in the art based on the context.

[0052] There are many methods for preparing shRNA molecules and siRNA, such as chemical synthesis, in vitro transcription, enzyme cleavage of long-chain dsRNA, vector expression of RNA, PCR synthesis of RNA expression elements, etc. The emergence of these methods provides researchers with a variety of options to better achieve gene silencing efficiency.

[0053] The above-mentioned shRNA molecules, such as shRNA-498 and shRNA-620, can be used as active pharmaceutical ingredients in the treatment of lung adenocarcinoma, and can be prepared into RNAi drugs.

[0054] Optionally, in addition to a therapeutically effective amount of the RNAi molecules shRNA-321, shRNA-498, shRNA-532 and shRNA-620, the RNAi drug may also contain other SSR4 expression inhibitors as auxiliary active ingredients to enhance the therapeutic effect of the shRNA molecules on lung adenocarcinoma.

[0055] The terms "enhancement" or "improvement" are used herein to refer to a statistically significant increase. In some embodiments, "enhancement" or "increase" or "improvement" generally refers to an increase of at least 10% compared to a reference level (e.g., in the absence of a given treatment or medicament), and can include, for example, an increase of at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99% or more.

[0056] In another embodiment, the above-mentioned drug, in addition to a therapeutically effective amount of the above-mentioned RNAi molecule, further comprises one or more SSR4 gene inhibitors and / or drug components for treating lung adenocarcinoma. Such a pharmaceutical composition may have the effect of treating lung adenocarcinoma.

[0057] As used herein, the term "effective amount" refers to the therapeutic amount required to alleviate at least one or more symptoms of a disease or condition, and refers to a sufficient amount of a drug to provide the desired effect. Thus, the term "therapeutically effective amount" refers to a therapeutic amount sufficient to elicit a specific effect when administered to a typical subject. In various contexts, an effective amount, as used herein, also includes an amount sufficient to delay the development of a disease condition, alter the course of a disease condition (for example, but not limited to, slowing the progression of a disease condition), or reverse a disease condition. It should be understood that many methods are known in the art to determine an effective amount for a given application. For example, pharmacological methods for dosage determination can be used in therapeutic settings. In the context of therapeutic or prophylactic applications, the amount of composition administered to a subject will depend on the type and severity of the disease and individual characteristics, such as overall health, age, sex, weight, and tolerance to drugs. It also depends on the extent, severity, and type of the disease. Those skilled in the art will be able to determine an appropriate dosage based on these and other factors. For example, a therapeutically effective amount of an RNAi molecule can be determined through clinical investigation. The appropriate effective dosage also takes into account therapeutic factors such as the dosage form, the individual's constitution, weight, age, course of the condition, and site of administration.

[0058] The dosage range of the agent depends on efficacy and includes an amount sufficient to produce the desired effect, such as slowing the progression of lung adenocarcinoma or even causing reversal of the condition. The dose should not be so large as to cause unacceptable adverse side effects. Generally, the dosage will vary with the patient's age, condition, and sex and can be determined by those skilled in the art. The dosage can also be adjusted by the individual physician if any complications occur.

[0059] The dosage form of the shRNA or siRNA drug of the present invention can be in various forms, as long as it is suitable for administration to the corresponding disease and properly maintains the biological activity of the nucleic acid RNA and / or DNA molecules and plasmids. For example, for an injectable drug delivery system, the dosage form can be a lyophilized powder. In addition to the injectable dosage form, the drug can also be a gel. The dosage form of the RNAi drug can be in various forms, as long as it is suitable for administration to treat lung adenocarcinoma and properly maintains the biological activity of the nucleic acid RNA and / or DNA molecules and plasmids of the active pharmaceutical ingredient. For example, for an injectable drug delivery system, the dosage form can be a lyophilized powder. The injection can be administered by subcutaneous injection, intramuscular injection, intravenous injection, or intravenous infusion over time. Given an appropriate formulation for a given route, for example, the agents that can be used in the methods and compositions described herein can be administered intravenously, intranasally, by inhalation, intraperitoneally, intramuscularly, subcutaneously, intracavitary, and, if necessary, can be delivered by means of a peristaltic pump, a venous port, or by other means known to those skilled in the art. Preferably, the patient to be treated for lung adenocarcinoma is administered intravenously or intramuscularly.

[0060] Optionally, the above-mentioned pharmaceutical dosage form may contain any pharmaceutically acceptable carriers and adjuvants, as long as they are suitable for the corresponding administration system and properly maintain the biological activities of the RNAi molecule and the expression plasmid.

[0061] The phrase "pharmaceutically acceptable" as used herein refers to compounds, materials, compositions and / or dosage forms that are suitable for use in contact with human and animal tissues without excessive toxicity, irritation, allergic reaction or other problems or complications, commensurate with a reasonable benefit / risk ratio, within the scope of reasonable medical judgment. Pharmaceutically acceptable carriers are well known in the art and include liquid or solid fillers, diluents, excipients, solvents or encapsulating materials. Each carrier must be "acceptable" in the sense that it is compatible with the other ingredients of the formulation and harmless to the patient, including, for example, aqueous solutions (such as water or physiologically buffered saline) or other solvents or vehicles (such as glycols, glycerol, oils (such as olive oil) or injectable organic esters). Excipients can be selected, for example, to achieve delayed release of the agent or to selectively target one or more cells, tissues or organs. For the purposes of the present invention, the pharmaceutical composition can be in dosage unit form, such as powder injections, solutions, injections, etc.

[0062] The preparation of pharmacological compositions comprising active ingredients dissolved or dispersed therein is well known in the art and does not need to be limited based on the formulation. Typically, such compositions are prepared as injectable liquid solutions or suspensions, however, solid forms of solutions or suspensions suitable for being placed in a liquid before use can also be prepared. The preparation can also be emulsified or present in the form of a liposome composition. The active ingredient can be mixed with a pharmaceutically acceptable and compatible excipient for the active ingredient, and in an amount suitable for the therapeutic methods described herein. Suitable excipients include, for example, water, saline, glucose, glycerol, ethanol, etc. and combinations thereof. In addition, if necessary, the composition can contain a small amount of auxiliary substances, such as wetting agents or emulsifiers, pH buffers, etc., which enhance or maintain the effectiveness of the active ingredient. The therapeutic composition as described herein can include pharmaceutically acceptable salts of the components thereof. Pharmaceutically acceptable salts include acid addition salts (formed with the free amino groups of the polypeptide), which are formed by inorganic acids such as hydrochloric acid or phosphoric acid, or organic acids such as acetic acid, tartaric acid, mandelic acid, etc. Salts formed from free carboxyl groups can also be derived from inorganic bases, for example, sodium, potassium, ammonium, calcium or iron hydroxides, and organic bases such as isopropylamine, trimethylamine, 2-ethylaminoethanol, histidine, procaine, and the like. Physiologically tolerable carriers are well known in the art. Exemplary liquid carriers are sterile aqueous solutions that contain nothing other than the active ingredient and water, or contain buffers such as sodium phosphate, saline, or both at physiological pH, such as phosphate-buffered saline. Furthermore, aqueous carriers can contain more than one buffer salt, as well as salts such as sodium chloride and potassium chloride, glucose, polyethylene glycol, and other solutes. In addition to water, the liquid composition can also contain a liquid phase. Examples of such other liquid phases are glycerol, vegetable oils (e.g., cottonseed oil), and water-oil emulsions. The amount of active agent, such as siRNA or shRNA, used in the present invention to effectively treat a particular disease or condition, such as lung adenocarcinoma, will depend on the nature of the disease or condition and can be determined by standard clinical techniques.

[0063] As used herein, the terms "treat," "therapy," "treatment," or "improvement," when used in reference to a disease, condition, or medical condition, such as lung adenocarcinoma, refer to the therapeutic treatment of a condition, wherein the goal is to reverse, alleviate, ameliorate, inhibit, slow, or stop the progression or severity of a symptom or condition. The term "treat" includes reducing or alleviating at least one adverse effect or symptom of a condition. A treatment is generally "effective" if one or more symptoms or clinical markers are reduced. Alternatively, a treatment is "effective" if the progression of the condition is reduced or stopped. That is, "treatment" includes not only improvement of symptoms or markers, but also stopping or at least slowing the progression or worsening of symptoms that would be expected in the absence of treatment. Beneficial or desired clinical outcomes include, but are not limited to, relief of one or more symptoms, a reduction in the extent of the defect, a stable (i.e., no worsening) or decreased level of SSR4 gene expression, a reduction in lung adenocarcinoma (LUAD), and an increased lifespan compared to the lifespan expected in the absence of treatment.

[0064] A therapeutically effective amount is an amount of the agent sufficient to produce a statistically significant, measurable change in inhibiting SSR4 gene expression, promoting normal cell growth, etc. Such an effective amount can be measured in clinical trials and animal studies.

[0065] The efficacy of a given treatment (e.g., inhibition of SSR4 gene expression and / or lung adenocarcinoma) can be determined by a skilled clinician. However, if, for example, any or all signs or symptoms of inhibition of SSR4 gene expression and / or treatment of lung adenocarcinoma are altered in a beneficial manner, or other clinically acceptable symptoms are improved or even alleviated, for example, by at least 10% after treatment with an agent described herein, then the treatment is considered to be "effective treatment," as that term is used herein. Efficacy can also be measured by the individual's failure to worsen, as assessed by the need for hospitalization or medical intervention (i.e., cessation of disease progression). Methods for measuring these indicators are known to those skilled in the art and / or described herein.

[0066] An effective amount for treating a disease is an amount sufficient to result in effective treatment of the disease as that term is defined herein when administered to a mammal in need thereof. The efficacy of an agent can be determined by assessing, for example, physical indicators of inhibiting SSR4 gene expression and / or treating lung adenocarcinoma.

[0067] The above-mentioned agents can be administered by subcutaneous injection, intramuscular injection, intravenous injection, or intravenous infusion over time. Given an appropriate formulation for a given route, for example, the agents useful in the methods and compositions described herein can be administered intravenously, intranasally, by inhalation, intraperitoneally, intramuscularly, subcutaneously, intracavitary, and, if desired, delivered by peristaltic pump, intravenous port, or other means known to those skilled in the art. Preferably, the agent is administered intravenously or intramuscularly to the patient being treated for lung adenocarcinoma. Local administration directly to areas of high SSR4 gene expression, such as lung tissue, is also specifically contemplated.

[0068] For example, therapeutic compositions comprising at least one pharmaceutical agent can be conventionally administered in unit doses. When applied to therapeutic compositions, the term "unit dose" refers to physically discrete units suitable as unitary dosage forms for administration to a subject, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required physiologically acceptable diluent (i.e., carrier or vehicle).

[0069] The composition is administered in a therapeutically effective amount in a manner compatible with the dosage formulation. The amount and timing of administration will depend on the subject to be treated, the subject's body's ability to utilize the active ingredient, and the extent of the therapeutic effect desired.

[0070] The exact amount of active ingredient, such as RNAi and expression plasmid, that needs to be administered depends on the physician's judgment and varies from individual to individual. However, suitable dosage ranges for systemic administration are disclosed herein and depend on the route of administration. Suitable dosing regimens are also variable, but are represented by an initial administration, followed by repeated administration at intervals of one or more hours by subsequent injections or other administrations. Alternatively, it is contemplated that continuous intravenous infusion is sufficient to maintain blood concentrations within the range specified for in vivo treatment.

[0071] The present invention has verified at the cellular level the inhibitory effects of individual shRNA molecules such as shRNA-321, shRNA-498, shRNA-532 and shRNA-620 on the SSR4 gene and on the proliferation, migration / metastasis and invasion of lung adenocarcinoma cells, or on the promotion of apoptosis of lung adenocarcinoma cells.

[0072] To make the present invention more clearly understood, preferred embodiments are described in detail below with reference to the accompanying drawings. Those skilled in the art should understand that the following embodiments are only used to illustrate the present invention and are not intended to limit the present invention.

[0073] Example

[0074] In the embodiments of the present invention, if there is no specific description of the experimental operating temperature, the temperature generally refers to room temperature (10-30° C.).

[0075] This article involves the addition amount, content and concentration of various substances, and the percentages mentioned therein, unless otherwise specified, refer to the percentage by mass.

[0076] In the embodiments, the shRNA molecule and its expression plasmid can be expressed in the same way. For example, shRNA-321 can represent both the shRNA-321 molecule itself and its expression vector pGPU6 / GFP / Neo-SSR4-Homo-321 (or sh-SSR4-3). Those skilled in the art will easily understand that they represent different organism forms in different expression contexts.

[0077] Statistical Analysis: All numerical variables in this study are expressed as mean ± standard error. Two-group comparisons were performed with the two-tailed Student's t test, and three-group comparisons were performed with the ANOVA test. Statistical differences were considered when P < 0.05.

[0078] Example 1: Expression of SSR4 gene in lung adenocarcinoma tissue and prognostic analysis

[0079] By comparing the RNA and protein levels between lung adenocarcinoma tissues and normal lung tissues in public databases (GEO, UALCAN, and Human Protein Atlas), significant differences in SSR4 expression were observed.

[0080] The expression of SSR4 in lung adenocarcinoma tissues and normal lung tissues in the GSE31210 dataset was analyzed by bioinformatics methods. 图1 As shown in Figure A, the expression of SSR4 in lung adenocarcinoma tissue was significantly higher than that in normal lung tissue (P < 0.001); 图1 As shown in Figure B, the expression of SSR4 in lung adenocarcinoma tissue was also significantly higher than that in normal lung tissue (P < 0.05); 图1 As shown in Figure C, SSR4 was strongly positively stained in lung adenocarcinoma tissues as assessed by immunohistochemistry microarray analysis using the Human Protein Atlas database. These results suggest that SSR4 is highly expressed in lung adenocarcinoma tissues.

[0081] The prognostic effect of SSR4 in lung adenocarcinoma was analyzed using the GSE31210 dataset. 图1 As shown in middle D, the overall survival and disease-free survival rates of patients with high SSR4 expression in lung adenocarcinoma were lower than those of patients with low expression, suggesting that high SSR4 expression is not conducive to the patient's prognosis.

[0082] Example 2: Expression of SSR4 mRNA in lung adenocarcinoma cells and verification of SSR4 interference efficiency in H1299 cells

[0083] The specific experimental steps for determining the expression of SSR4 mRNA in lung adenocarcinoma cells are as follows.

[0084] Normal bronchial epithelial cells (BEAS-2b) and lung adenocarcinoma cells (H1299, A549, PC9, and H1975) were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Trizol reagent, reverse transcription kit, and fluorescence quantitative kit were purchased from Yisheng Biotechnology Co., Ltd. (Shanghai).

[0085] All cell lines were grown in RPMI 1640 medium supplemented with 1% penicillin-streptomycin and 10% fetal bovine serum (FBS) at 37°C in a humidified incubator with 5% CO2. All cell lines were maintained at low passage number. Total RNA was isolated from the cell lines using RNA Isolator Total Extraction Reagent. After discarding the medium and washing once with 1× phosphate-buffered saline (PBS), 1 mL of extraction reagent was added to each well of a 6-well plate. The cells were then transferred to a 1.5 mL EP tube and lysed by repeated pulses until complete lysis, followed by incubation on ice for 5 minutes. Subsequently, 200 mL of chloroform was added, and the mixture was shaken vigorously for 15 seconds, allowed to stand at 4°C for 5 minutes, and then centrifuged at 12,000 g for 15 minutes at 4°C. The upper aqueous phase was carefully transferred to a new EP tube, and an equal volume of pre-chilled isopropanol was added, mixed thoroughly, and allowed to stand at 4°C for 10 minutes. The mixture was then centrifuged at 12,000 g for 10 minutes at 4°C, and the supernatant discarded. Add 1 mL of anhydrous ethanol, shake thoroughly, and centrifuge at 12000g and 4°C for 5 minutes. Discard the supernatant and dry the precipitate at 25°C for 5 minutes, then add 30 mL of RNase-free ddH2O to dissolve the RNA precipitate. cDNA was then synthesized from the isolated RNA using the HiScript R III First Strand cDNA Synthesis Kit. The cDNA was diluted to 5 ng / mL in RNase-free water. qRT-PCR was performed using SYBR qPCR Master Mix and CFX96TM real-time system, with the following steps: pre-denaturation at 95°C for 30 seconds, 40 cycles of denaturation at 95°C for 10 seconds, and annealing and extension at 60°C for 30 seconds. qRT-PCR primers SSR4 and β-actin (internal reference gene) were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The primer sequences are as follows:

[0086] SSR4 gene PCR

[0087] Forward primer F: 5′-GAAAACAATTCCCTGTCACTCG-3′;

[0088] Reverse primer R: 5′-CTCGTCGAAGAATCTAACCTCA-3′.

[0089] β-actin internal reference PCR

[0090] Forward primer F: 5′-AGTTGCGTTACACCCTTTCTTG-3′;

[0091] Reverse primer R: 5′-GCTGTCACCTTCACCGTTCC-3′.

[0092] The results suggest that the SSR4 gene is highly expressed in lung adenocarcinoma cells. 图2 As shown in middle A, the SSR4 gene is most significantly expressed in H1299 cells.

[0093] In order to investigate the effect of knocking down the SSR4 gene on the activity of lung adenocarcinoma cells, 80 double-stranded shRNA molecules targeting the conserved region of the SSR4 gene were designed, including: shRNA-321, shRNA-498, shRNA-532, shRNA-620, etc. GenePharma was commissioned to construct them on the lentiviral vector pGPU6 / GFP / Neo, and the expression plasmids were named pGPU6 / GFP / Neo-SSR4-Homo-321, pGPU6 / GFP / Neo-SSR4-Homo-498, pGPU6 / GFP / Neo-SSR4-Homo-532, and pGPU6 / GFP / Neo-SSR4-Homo-620, etc. For comparison, a negative control shRNA-NC was also designed and the company was commissioned to construct the plasmid pGPU6 / GFP / Neo-shNC. The target sequence of the negative control shRNA-NC is 5'-GTTCTCCGAACGTGTCACGT-3', and the sense chain 5'-3' is:

[0094] CACCG TTCTCCGAACGTGTCACGT CAAGAGATT ACGTGACACGTTCGGAGAA TTTTTTG,

[0095] The antisense strand 5'-3' is:

[0096] GATCCAAAAAA TTCTCCGAACGTGTCACGT AATCTCTTG ACGTGACACGTTCGGAGAAC .

[0097] The preparation for transfection and screening of SSR4 knockdown in H1299 cells includes the following steps:

[0098] H1299 cells were seeded in 6-well plates. When the cell density was about 70% on the second day, Lipofectamine The cells were transfected using the kit. The transfection group settings were: one well each of shRNA-321, shRNA-498, shRNA-532, shRNA-620, and shRNA-NC, with three replicates per well. Cell pellets were collected 48 hours after transfection.

[0099] The total RNA of each well was extracted and the qRT-PCR detection method was the same as above.

[0100] Whole cells were lysed in RIPA buffer containing 1% PMSF for 2 minutes, incubated at 4°C for 30 minutes, and then centrifuged at 14,000 rpm for 10 minutes at 4°C to obtain protein from the supernatant. BCA protein assay kit (P0010S; beyotime, Shanghai, China) was used for protein quantification. Equal protein samples (15 μg) were fractionated by SDS-PAGE and transferred to PVDF membranes. After blocking with 5% skim milk for 2 hours, anti-SSR4 (1:1000, 11655-2-AP, Proteintech) and β-actin (1:1000, 66009-1-Ig, Proteintech) were used at 4°C overnight, after which they were incubated with secondary antibodies. At 25°C for 40 minutes. Finally, liquid A and liquid B of the ECL kit (PE0010, Solarbio, China) were mixed (1:1), and 150 mL of ECL reagent was added to the surface of each protein band. The bands were then visualized using a BLT GelView 600Plus (BioLight, Zhuhai, China). The grayscale value of each band was analyzed using Image J software.

[0101] The experimental results are as follows 图2 As shown in B, qRT-PCR verified the knockdown effect of SSR4 in H1299 cells. Compared with the NC group, the SSR4 mRNA level in the experimental groups transfected with shRNA-620 and shRNA-498 was significantly reduced; 图2 As shown in middle C, Western blotting showed that the SSR4 protein level in the experimental groups transfected with shRNA-620 and shRNA-498 was significantly reduced compared with the NC group. The above results indicate that both shRNA-620 and shRNA-498 can effectively interfere with the expression of the SSR4 gene in H1299.

[0102] Example 3: Cell scratch assay to verify the effect of SSR4 knockdown on the migration of lung adenocarcinoma cells

[0103] The steps of the cell scratch assay are as follows.

[0104] Lung adenocarcinoma cells H1299 were plated into 6-well cell culture plates and cultured for 24 h before transfection. Cells were cultured in RPMI-1640 for 48 h and resuspended to adjust the concentration to 5 × 10 5 After the cells reached a density of approximately 90%, the culture medium was aspirated and the cells were washed three times with PBS. The cells were then scraped with the tip of a 200 μL pipette, streaking perpendicularly to the black line on the back of the well plate. After streaking, the cells were washed three times with PBS to remove unattached cells. The corresponding culture medium supplemented with 1% FBS was then added, and five randomly scratched areas were photographed using a microscope. The cells were cultured for an additional 24 hours, photographed using a microscope, and cell migration distance analyzed using ImageJ Launcher software.

[0105] The results of cell scratch test were as follows 图3 As shown, compared with the control group NC, the cell migration ability of the shRNA-620 and shRNA-498 groups was lower than that of the control group, and the difference was statistically significant (P < 0.001). The results showed that shRNA-620 and shRNA-498 reduced the cell migration ability in H1299 cells.

[0106] Example 4: Transwell assay to evaluate the effect of SSR4 knockdown on invasion and migration of lung adenocarcinoma cells

[0107] Transwell migration assay:

[0108] Transwell migration assay was used to evaluate cell migration. The assay was performed in a 24-well Transwell chamber (3470; Corning, USA). 4 A cell suspension (200 μL) of serum-free medium containing transfected cells was inoculated into the upper chamber, and 500 μL of RPMI 1640 medium supplemented with 20% FBS was added to the lower chamber. The cells were then cultured in a humidified incubator at 37°C with 5% CO2 for 24 hours. After aspirating the medium, non-migrated cells were removed with a cotton swab. The migrated cells were then fixed in 4% paraformaldehyde and stained with 0.1% crystal violet for 20 minutes, then counted and imaged using an inverted microscope.

[0109] Transwell invasion assay:

[0110] As previously described, cell invasion was assessed using the Transwell invasion assay in a 24-well Transwell chamber. To form a barrier, Matrigel (BD, USA) was diluted with serum-free RPMI 1640 (1:8) and added to the upper chamber and incubated at 37°C to gel overnight. The remaining steps were the same as those for the Transwell migration assay.

[0111] The results of migration and invasion experiments were as follows 图4 As shown in the results, the migration and invasion abilities of lung adenocarcinoma cells H1299 were significantly weakened after transfection with shRNA-620 and shRNA-498. Statistical analysis showed that the number of migrating and invasive cells in H1299 cells transfected with shRNA-620 and shRNA-498 was significantly reduced compared to the negative control (P < 0.01). These experimental results indicate that interfering with SSR4 expression can significantly inhibit the metastasis and invasion abilities of lung adenocarcinoma cells.

[0112] Example 5: CCK8 assay verifies the effect of SSR4 knockdown on the proliferation of lung adenocarcinoma cells

[0113] H1299 cell proliferation was assessed using a cell counting kit-8 (CCK-8) assay kit (C0042; Beyotime, Shanghai, China). For CCK-8 assays, H1299 cells were seeded in 96-well plates at 1000 cells per well. After culturing for 0, 24, 48, 72, and 96 hours, 10 mL of CCK-8 reagent was added to each well and incubated at 37°C for 2 hours. The absorbance (OD value) at 450 nm was measured using a microplate reader.

[0114] The results of CCK8 experiments are as follows 图5 As shown, compared with the negative control group NC, the cell proliferation ability of the shRNA-620 and shRNA-498 transfection groups was lower than that of the control group at each time point, and the OD values ​​of the shRNA-620 and shRNA-498 transfection groups were extremely significantly reduced (P < 0.001). The results showed that shRNA-620 and shRNA-498 interference reduced the cell proliferation ability in H1299 cells.

[0115] In summary, the shRNA for inhibiting SSR4 gene expression provided by the present invention can be used as a targeted drug. Inhibiting the expression of SSR4 gene by shRNA can inhibit the migration and invasion ability of lung adenocarcinoma cells and reduce the proliferation ability of lung adenocarcinoma cells. It has good application prospects for the clinical development of lung adenocarcinoma targeted drugs.

Claims

1. Use of the signal sequence receptor subunit δ (SSR4) gene (NCBI accession number 6748) as a drug target in the development of therapeutic drugs for lung adenocarcinoma.

2. A drug for treating lung adenocarcinoma, characterized in that: The active ingredient of the drug is a substance that inhibits the expression of the SSR4 gene.

3. The drug according to claim 2, wherein The active pharmaceutical ingredient is an RNAi molecule.

4. The drug according to claim 3, wherein The RNAi molecule is a siRNA molecule or a shRNA molecule targeting the conserved region of the SSR4 gene.

5. The drug according to claim 3, wherein The RNAi molecule is an siRNA molecule or shRNA molecule targeting a target sequence of the SSR4 gene selected from SEQ ID NO: 1, 4, 7 and 10, wherein the gene of the shRNA molecule includes a sense strand and an antisense strand: Target sequence: 5'-GCAAGAACAGGGTCCAGAACA-3' (SEQ ID NO: 1), herein named shRNA-321, Sense strand 5'-3': CACC GCAAGAACAGGGTCCAGAACA TTCAAGAGA TGTTCTGGACCCTGTTCTTGC TTTTTTG(SEQ ID NO:2), Antisense strand 5'-3': GATCCAAAAAA GCAAGAACAGGGTCCAGAACA TCTCTTGAA TGTTCTGGACCCTGTTCTTGC (SEQ ID NO:3); Target sequence: 5'-GGAAGGCTCAGAGGAATAACG-3' (SEQ ID NO: 4), herein designated as shRNA-498, Sense strand 5'-3': CACC GGAAGGCTCAGAGGAATAACG TTCAAGAGA CGTTATTCCTCTGAGCCTTCC TTTTTTG(SEQ ID NO:5), Antisense strand 5'-3': GATCCAAAAAA GGAAGGCTCAGAGGAATAACG TCTCTTGAA CGTTATTCCTCTGAGCCTTCC (SEQ ID NO:6); Target sequence: 5'-CATCCCGCCTCTGTTTACAGT-3' (SEQ ID NO: 7), herein designated as shRNA-532, Sense strand 5'-3': CACCG CATCCCGCCTCTGTTTACAGT TTCAAGAGA ACTGTAAACAGAGGCGGGATG TTTTTTG(SEQ IDNO:8), Antisense strand 5'-3': GATCCAAAAAA CATCCCGCCTCTGTTTACAGT TCTCTTGAA ACTGTAAACAGAGGCGGGATGC (SEQ ID NO:9); Target sequence: 5'-GGCCTTGTGATCTACTACTTG-3' (SEQ ID NO: 10), herein named shRNA-620, Sense strand 5'-3': CACC GGCCTTGTGATCTACTACTTG TTCAAGAGA CAAGTAGTAGATCACAAGGCC TTTTTTG(SEQ ID NO:11), Antisense strand 5'-3': GATCCAAAAAA GGCCTTGTGATCTACTACTTG TCTCTTGAA CAAGTAGTAGATCACAAGGCC (SEQ ID NO:12)。 6. The drug according to claim 5, wherein The shRNA molecule is provided in the form of its expression plasmid.Preferably, the plasmid vector is a viral vector such as a lentiviral vector or an adenoviral vector.

7. The drug according to claim 6, characterized in that The plasmid vector of the shRNA molecule expression plasmid is pGPU6 / GFP / Neo.

8. The drug according to claim 5, wherein The drug is a pharmaceutical composition, which contains, in addition to a therapeutically effective amount of the shRNA molecule according to claim 5 as an active ingredient, a pharmaceutically acceptable carrier.

9. The drug according to claim 5, wherein The drug is a pharmaceutical composition, which, in addition to a therapeutically effective amount of the shRNA molecule according to claim 5, further comprises one or more other pharmaceutical ingredients that inhibit SSR4 gene expression or inhibit SSR4 function.

10. The drug according to claim 5, wherein The drug is a pharmaceutical composition, which, in addition to comprising a therapeutically effective amount of the shRNA molecule according to claim 5, further comprises one or more other pharmaceutical ingredients for treating lung adenocarcinoma.