Locusta migratoria zona pellucida membrane protein cell epitope peptide, hybridoma cell strain and anti-membrane protein epitope monoclonal antibody and application thereof

Abstract

The invention discloses a B cell epitope peptide hybridoma cell strain on migratory locust zona pellucida membrane protein LmPio and a monoclonal antibody and application thereof, LH10 is inserted into a passenger-carrying structural domain of a salmonella V-type secretion system MisL and is introduced into escherichia coli DH5alpha, the LH10 is displayed and expressed on the surface of DH5alpha thallus, the hybridoma cell strain is used as an immunogen, and the hybridoma cell strain can be used for detecting the B cell epitope peptide on the migratory locust zona pellucida membrane protein LmPio. After a mouse is immunized, splenocytes of the mouse are fused with Sp2 / 0 to obtain the LH10-resistant mAb hybridoma cell. The LH10 is inserted into a salmonella peg pilus operon and is introduced into an inert carrier bacterium S9H, the LH10 is subjected to functional display expression on the surface of an S9H thallus, and an S9H-peg-LH10-antibody direct mediated agglutination test established based on the display expression on the surface of the S9H thallus can specifically recognize an anti-LH10 mAb in a hybridoma cell supernatant, so that the monoclonal antibody aiming at the B cell epitope peptide LH10 on the membrane protein LmPio can be quickly screened out.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biomedical technology and biological medicine, and particularly relates to a locusta migratoria zona pellucida membrane protein cell epitope peptide, a hybridoma cell strain, a monoclonal antibody against a membrane protein epitope and application thereof. BACKGROUND

[0002] Membrane proteins are a class of proteins that can bind or integrate into the membrane of cells or organelles, and play a key role in the life activities of cells. According to the difficulty of separating the protein from the biological membrane and the position of the protein in the membrane, membrane proteins can be divided into two categories: peripheral membrane proteins and integral membrane proteins. Peripheral membrane proteins are water-soluble proteins that do not embed in the membrane and are not attached to the membrane by covalent bonds, but are combined with the membrane proteins or membrane molecules on the surface of the membrane by ionic bonds. They can be separated from the membrane as long as the ionic strength of the solution is changed or the temperature is increased, and the membrane structure is not destroyed. Integral membrane proteins are tightly combined with the membrane by strong hydrophobic interaction with the membrane, and are stably present on the membrane. They can only be separated from the membrane by treatment with a detergent. Integral membrane proteins can be divided into three types: single-topology proteins, lipid-anchored proteins and transmembrane proteins. Different types of membrane proteins have different functions and play very important roles in various life activities of organisms, such as cell proliferation and differentiation, energy conversion, signal transduction and material transport. It is estimated that about 60% of drug action targets are membrane proteins, which are ideal molecular targets. However, in the field of plant protection, there are existing problems such as high resistance of pesticides and serious lack of pesticide molecular target structures of membrane proteins at home and abroad. Studies have shown that membrane proteins are involved in the unique cuticle and exoskeleton biosynthesis pathway of insects during growth and development, and molting is a unique phenomenon of arthropods. Therefore, the key membrane proteins in the cuticle biosynthesis pathway of pests can be studied to screen safe and efficient pesticide molecular targets.

[0003] Zona Pellucida protein Piopio is a membrane protein, which is an important component of the apical extracellular matrix. The related functional research has been reported only in Diptera Drosophila melanogaster and Coleoptera Tribolium castaneum. It plays an important role in the formation of the apical extracellular matrix of the innermost layer of the epidermis of Drosophila embryo, and has an important function in metamorphosis and reproduction of Tribolium castaneum. The research on Zona Pellucida protein Piopio in Orthoptera insects has not been reported. In our previous research, it is found that the silencing of Piopio (LmPio) of Locusta migratoria leads to the appearance of the phenotype of molting death, which indicates that the Zona Pellucida protein gene Piopio plays an important role in maintaining the normal growth and development of insects and can be used as an important molecular target for pest control. However, the research on Zona Pellucida protein Piopio of Locusta migratoria is limited to the discovery of its phenotype, and the specific localization mode of the protein in the tissue and the molecular mechanism of its action are not clear. Therefore, we urgently need high-quality monoclonal antibodies to complete the follow-up biochemical experiments to clarify the mechanism of action, such as using immunohistochemistry (IHC) to accurately locate the expression site and mode of the protein. In addition, high-quality monoclonal antibodies are used to carry out immunoprecipitation (IP) and co-immunoprecipitation (Co-IP) experiments, hoping to fish other proteins interacting with LmPio, and then study the interaction network between proteins, which is of great significance to clarify and understand the specific mechanism of action of LmPio. SUMMARY

[0004] The technical problem solved by the present application is to provide a B cell epitope peptide of Zona Pellucida membrane protein LmPio of Locusta migratoria.

[0005] The technical problem solved by the present application is to provide a B cell epitope peptide of Zona Pellucida membrane protein LmPio of Locusta migratoria.

[0006] The technical problem solved by the present application is to provide a B cell epitope peptide of Zona Pellucida membrane protein LmPio of Locusta migratoria.

[0007] The technical problem solved by the present application is to provide a B cell epitope peptide of Zona Pellucida membrane protein LmPio of Locusta migratoria.

[0008] The technical problem solved by the present application is to provide a B cell epitope peptide of Zona Pellucida membrane protein LmPio of Locusta migratoria.

[0009] The technical problem solved by the present application is to provide a B cell epitope peptide of Zona Pellucida membrane protein LmPio of Locusta migratoria.

[0010] The technical problem solved by the present application is to provide a B cell epitope peptide of Zona Pellucida membrane protein LmPio of Locusta migratoria.

[0011] The last technical problem to be solved by the present application is to provide a preparation method of a monoclonal antibody against an epitope LH10.

[0012] Technical solution: In order to solve the above technical problems, the present application provides a B cell epitope peptide LH10 of Locusta migratoria pirothrin membrane protein LmPio, and the amino acid sequence of the B cell epitope peptide LH10 is LVTNQGRGFH, as shown in the sequence table SEQ ID NO. 3.

[0013] The present application also provides a nucleic acid molecule encoding the B cell epitope peptide LH10, and the DNA sequence of the nucleic acid molecule is CTGGTGACTAATCAAGGTCGAGGATTTCAT, as shown in the sequence table SEQ ID NO. 4.

[0014] The present application also provides an expression cassette, a recombinant vector, a recombinant strain, an immunogen or a detection system containing the nucleic acid molecule.

[0015] The present application also provides the recombinant strain or the immunogen, which is obtained by inserting the nucleic acid molecule into the MisL passenger domain of the type V secretion system of Salmonella and introducing it into a carrier bacterium.

[0016] The present application also provides the recombinant strain or the detection system, which is obtained by inserting the nucleic acid molecule into the peg fimbria operon gene of Salmonella and introducing it into an inert carrier bacterium S9H.

[0017] The present application also provides a preparation method of the recombinant strain or the immunogen, comprising the following steps: inserting the nucleic acid molecule into the MisL passenger domain of the type V secretion system of Salmonella and introducing it into a carrier bacterium to obtain.

[0018] The present application also provides a preparation method of the recombinant strain or the detection system, comprising the following steps: inserting the nucleic acid molecule into the peg fimbria operon gene of Salmonella and introducing it into an inert carrier bacterium S9H to obtain.

[0019] The present application also provides a hybridoma cell line, which is preserved in the China Center for Type Culture Collection, and the preservation date is May 8, 2025, the preservation number is CCTCC NO: C2025152, the classification name is hybridoma cell line 2C7-7G Hybridoma cell line 2C7-7G, and the hybridoma cell line 2C7-7G is a hybridoma cell line targeting a monoclonal antibody of the LmPio epitope LH10 (LVTNQGRGFH) of Locusta migratoria pirothrin membrane protein, and the preservation address is Wuhan, Wuhan University, China.

[0020] The present invention also provides an anti-LH10 monoclonal antibody, which is obtained by immunizing an animal with the immunogen or secreting the hybridoma cell line.

[0021] The present invention also provides a method for preparing the anti-LH10 monoclonal antibody, comprising the following steps: selecting female BALB / c mice aged 8-10 weeks, intraperitoneally injecting liquid paraffin, and 7-10 days later intraperitoneally injecting the hybridoma cells according to claim 6 in the logarithmic growth phase; collecting ascites after the abdomen of the mouse is significantly swollen, centrifuging to remove cell debris and other precipitates, and obtaining the supernatant after purification.

[0022] The present invention also provides a specific preparation method of a monoclonal antibody against the B cell epitope peptide LH10 on the locust zona pellucida membrane protein LmPio, comprising the following steps:

[0023] (1) Obtaining B cell epitope peptides: Using bioinformatics technology to predict and analyze the antigenicity of various potential B cell epitope peptides in the locust zona pellucida membrane protein LmPio, the highest-scoring B cell epitope peptide LH10 was obtained;

[0024] (2) Preparation of epitope peptide immunogens: The LH10 epitope peptide was inserted into the passenger domain of the Salmonella V-type secretion system MisL, introduced into DH5α engineered bacteria, and the B cell epitope peptide LH10 was displayed on the bacterial surface as an immunogen;

[0025] (3) Animal immunization: 5-6 week-old BALB / c mice were subcutaneously injected with the epitope peptide immunogen at the back of the neck, with an immunization dose of 0.1 mL / mouse (recombinant strain concentration of 1×10 9 CFU / mL), immunization interval was 10 days, and immunization was performed 3 times;

[0026] (4) Preparation of the detection system: The B cell epitope peptide LH10 is inserted into the Salmonella Peg pili operon gene and introduced into the inert carrier bacteria S9H. The B cell epitope peptide LH10 can be functionally displayed on the surface of the S9H bacteria. The S9H-peg-LH10-antibody direct-mediated agglutination test established based on the expression on the surface of the S9H bacteria can specifically identify specific antibodies against the B cell epitope peptide LH10 in mouse serum and can produce an agglutination reaction, thereby qualitatively and quantitatively monitoring the B cell epitope peptide LH10 specific antibodies and antibody titers in the serum of immunized mice;

[0027] (5) Cell fusion: spleen cells from BALB / c mice immunized three times were fused with myeloma cells Sp2 / 0 in vitro;

[0028] (6) ELISA screening of hybridoma cells: Hybridoma cells can be screened 2 weeks after fusion. The detection system S9H-peg-LH10-antibody direct mediated enzyme-linked immunosorbent assay (ELISA) is used to screen the hybridoma cell culture wells that secrete the desired antibody from a large number of culture wells. If the OD value of the recombinant bacteria S9H expressing the B cell epitope peptide LH10 is 450 The OD reading is compared with the control system S9H-peg (S9H engineered bacteria containing only Peg, derived from Chinese invention patent ZL202211488632.8, target antigen of B cell epitope of novel coronavirus receptor binding domain and its expression and application in Peg pili display) 450 If the reading is equal to or greater than 0.2, it is assumed to be a positive hybridoma cell well, and the ELISA screening results are further verified using the S9H-peg-LH10-antibody direct agglutination test established based on S9H bacterial surface expression;

[0029] (7) Screening hybridoma cell lines secreting specific antibodies by glass plate agglutination method: The S9H-peg-LH10-antibody direct-mediated agglutination test established based on S9H bacterial surface expression was used to screen hybridoma cells that can secrete specific antibodies against the epitope peptide LH10. If the cell supernatant contains the target antibody, white agglutinated particles can be observed with the naked eye within 2 minutes, and it is defined as a positive cell culture well. A positive cell culture well will produce specific anti-LH10 monoclonal antibodies. If no white agglutinated particles appear, it is defined as an antibody-negative cell culture well.

[0030] (8) Cloning of hybridoma cells: The positive hybridoma cells obtained from the original wells in step (7) were cloned three times and expanded to obtain a monoclonal hybridoma cell line that secreted antibodies stably and was named 2C7-7G;

[0031] (9) Preparation and purification of specific monoclonal antibodies: Five 8-week-old BALB / c female mice were intraperitoneally injected with 0.5 mL of liquid paraffin per mouse for blocking. The hybridoma cell line 2C7-7G was expanded and cultured to the logarithmic growth phase. 1×10 6 A dose of 10 cells / mouse was inoculated into the peritoneal cavity of mice treated with occlusion. When the abdomen became significantly enlarged and the skin became taut, ascites was collected by puncture or drainage and centrifuged at 12,000 rpm for 5-10 minutes to remove the precipitate. Ascites fluid antibodies were purified using saturated ammonium sulfate to obtain monoclonal antibodies targeting the B cell epitope peptide LH10 on the zona pellucida membrane protein LmPio of the locust.

[0032] Beneficial effects: Compared with the prior art, the present application has the following remarkable advantages: the present application adopts two different recombinant carrier bacteria as immunogen and detection system respectively. Both of them display the same B cell epitope peptide LH10, so that the screened mAb has high specificity and avoids cross reaction with other B cell epitope peptides. When using the host (mouse) live carrier strain as immunogen, strong immunogenicity is exhibited, which can be used as endogenous adjuvant, without the need of expressing and purifying protein antigen, without the need of additional adjuvant, and the number of immunization is simplified from 4-5 times to 3 times, and the total immunization time is shortened from 1.5-2 months to 1 month. The preparation process of mAb is effectively shortened and the preparation cost is reduced. After screening and identification by B cell epitope peptide LH10 directly mediated ELISA and glass plate agglutination test, the hybridoma cell secreting the monoclonal antibody against the B cell epitope peptide LH10 of the locust zona pellucida membrane protein LmPio can be conveniently, quickly and visually screened. The present application inserts LH10 into the peg pilus operon of Salmonella and introduces it into the inert carrier bacteria S9H, and LH10 is functionally displayed and expressed on the surface of S9H bacteria. Based on the S9H-peg-LH10-antibody directly mediated agglutination test established based on the surface display and expression of S9H bacteria, the mAb against LH10 in the supernatant of hybridoma cells can be specifically recognized, and the monoclonal antibody against the B cell epitope peptide LH10 on the membrane protein LmPio can be quickly screened. BRIEF DESCRIPTION OF DRAWINGS

[0033] Figure 1 Figure 1 is the result graph of S9H-peg-LH10-antibody directly mediated agglutination test for detecting the antibody and antibody titer of the culture supernatant of hybridoma cell strain 2C7-7G;

[0034] Figure 2 Figure 2 is the result graph of S9H-peg-LH10-antibody directly mediated agglutination test for detecting the antibody and antibody titer of the mouse ascites prepared by hybridoma cell strain 2C7-7G;

[0035] Figure 3 Figure 3 is the result graph of Western blot verification of the anti-locust LmPio B cell epitope peptide LH10 monoclonal antibody. Figure 3 A is the Western blot verification result of incubating the cell supernatant antibody at a dilution of 1:50 as the primary antibody, Figure 3 B is Figure 3 A is the gray value analysis result of each protein indicated by the yellow arrow in A, Figure 3 C is Figure 3 A is the gray value analysis result of each protein indicated by the red arrow in A; Figure 3 D is the Western blot verification result of incubating the mouse ascites antibody at a dilution of 1:500 as the primary antibody, Figure 3 E is Figure 3The yellow arrows in D show the grayscale value analysis results of each protein. Figure 3 F is Figure 3 The grayscale value analysis results of each protein are shown by the red arrows in D. DETAILED DESCRIPTION

[0036] Before further describing the specific embodiments of the present invention, it should be understood that the scope of the present invention is not limited to the specific embodiments described below. It should also be understood that the terms used in the examples are intended to describe specific embodiments and are not intended to limit the scope of the present invention. The experimental procedures in the following examples, where specific conditions are not specified, were generally performed under conventional conditions or according to the conditions recommended by the respective manufacturers.

[0037] When the embodiments provide numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the understanding of the prior art by those skilled in the art and the description of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention may also be used to implement the present invention.

[0038] Example 1 Preparation of Monoclonal Antibodies Against B Cell Epitope Peptide LH10 on Locust Zona Pellucida Membrane Protein LmPio 1. Analysis of B Cell Epitope Peptides on Locust Zona Pellucida Membrane Protein LmPio and Determination of Dominant Epitope Peptides

[0039] The protein structure related to the target protein was obtained by using the Uniprot database BLAST (https: / / www.uniprot.org / blast) function, the PDB file was exported and opened with PyMOL, and the domain, transmembrane domain and intracellular and extracellular domain information with a residue model confidence score (pLDDT) ≥ 90 in the protein model were recorded. Subsequently, the position of the functional domain in the protein was obtained by using the NCBI conserved domain database (taking the amino acid sequence of LmPio protein with accession number XP_046984875.1 as an example); the resolved glycosylation position of zonulin protein LmPio was retrieved by protein database PDB (https: / / www.rcsb.org / ); and the possible glycosylation sites were recorded in PyMOL (indicating the glycosylation masking region) by homologous alignment. The target antigen contained in the functional domain of the target protein (extracellular) was predicted by using the online tools Bepipred 2.0 (http: / / tools.iedb.org / bcell / ) and support vector machine epitope prediction online website SVMTriP (http: / / sysbio.unl.edu / SVMTriP / ). Finally, the above information was summarized in the Prot function block of SnapGene, and the surface exposure of all candidate target antigens was evaluated by PyMOL to avoid glycosylation masking or domain interaction region masking, and the target antigen that could be further implemented and verified was optimized. The bioinformatics software (online analysis program) analysis results are shown in Table 1, and the B cell epitope 2 with the amino acid sequence L 119 VTNQGRGFH 128 is named LH10.

[0040] Table 1: Prediction results of LmPio protein B cell epitope sequence

[0041]

[0042] 2. Preparation of immunogen

[0043] The recombinant strain DH5α-pBR-MisL-LH10 was constructed by replacing the substitution site (DNA sequence is AACGATGATGATTCCGAAACGGACAGGCTG) in the msiL gene sequence (reference sequence from the whole genome of Salmonella gallinarum 287 / 91 strain, GenBank accession number AM933173.1, 3860919-3863786) with the DNA sequence of LH10 nucleic acid molecule (CTGGTGACTAATCAAGGTCGAGGATTTCAT) synthesized by Nanjing Qikexing Biotechnology Co., Ltd. (SEQ ID NO. 1, 2868 bp).

[0044] The above chimeric gene was used as a template (1 ng of chimeric gene in 1 μL) (SEQ ID NO. 1, 2868 bp), the genome of the standard strain of Salmonella gallinarum NCTC 13346 (purchased from China Institute for Control of Veterinary Drug and Feedstuffs, China National Veterinary Micro-organism Culture Collection Center) as a positive control, the genome of avian pathogenic E. coli isolate APEC-XM (Liu Jiaqi, Wu Shuxucon, Yin Yi, Zhang Dong, Xia Benben, Ren Wenkai, Zhu Guoqiang. Construction of a mouse model of neonatal E. coli meningitis of the coliform type caused by avian E. coli [J]. China Poultry, 2019, 41(10): 26-30.) and E. coli engineering bacteria DH5a genome as a negative control, and primers SP misl Up (5'-GAC GCTAGC ATGCCAACTCCCCAAAATTACT-3', the underlined part represents the enzyme digestion site Nhe I, and the primer was synthesized by Nanjing Qikexing Biotechnology Co., Ltd.) and SP misl Down (5'-CGC GTCG AC TCAGAAACTGTATTTCATCCCCAA-3', the underlined part represents the enzyme digestion site Sal I, and the primer was synthesized by Nanjing Qikexing Biotechnology Co., Ltd.) were used for PCR amplification. The amplification system was as follows: pfu high-fidelity DNA Polymerase (Beijing Zhenben Gold Biotechnology Co., Ltd., 2.5 U / μL) 2 μL, 5 × pfu DNA polymerase buffer 10 μL, dNTPs 5 μL, each 2 μL of upper and lower primers (10 mM), 2 μL of recombinant gene DNA fragment (1 ng / μL) or APEC-XM genome (250 ng / μL) or DH5a genome (250 ng / μL) or the genome of Salmonella gallinarum NCTC 13346 (250 ng / μL), and 27 μL of ultrapure water. After uniform mixing of the above system, PCR amplification was performed using a thermal cycler (Bio-Red), and the program was as follows: pre-denaturation at 95 °C for 3 min, a total of 35 cycles of amplification, including denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, and extension at 72 °C for 3 min, further amplification at 72 °C for 5 min, and the temperature was reduced to 12 °C after amplification. A 1% agarose gel was prepared, electrophoresed at 110 V for 50 min, stained with ethidium bromide, and imaged under a UV imager. The negative control had no amplification band, the positive control had an amplification size of 2886 bp, and the misl-LH10 PCR product was 2886 bp. The PCR amplification product of misl-LH10 was recovered using a universal DNA purification kit (Tiangen Biotech (Beijing) Co., Ltd.).

[0045] The pBR322 plasmid was extracted, and the PCR amplification product of misl-LH10 and the pBR322 plasmid were double-digested with Nhe I and Sal I restriction endonucleases (NEB). The linear DNA fragments were then ligated using T4 DNA ligase (NEB) in a 16°C metal bath overnight. The next day, the ligated product was transformed into DH5α competent cells, and resistance screening was performed by coating solid medium containing 100 μg / mL ampicillin. A single colony from the plate was inoculated into LB liquid medium containing 100 μg / mL ampicillin and grown to the stationary phase. The plasmid was then extracted and digested with Nhe I and Sal I, followed by a double digestion with the two restriction endonucleases. A 1% agarose gel was prepared and electrophoresed at 110V for 50 minutes. The resulting fragments were stained with ethidium bromide and imaged under a UV imager. The single digestion product of the recombinant plasmid pBR-MisL-LH10 with Nhe I and Sal I was 6813 bp. The double digestion product contained a 3939 bp linear vector fragment and a 2874 bp linear misL-LH10 DNA fragment. The DH5α strain containing the correct recombinant plasmid pBR-MisL-LH10 was designated the DH5α-pBR-MisL-LH10 recombinant strain. The constructed immunogen recombinant strain DH5α-pBR-MisL-LH10 was verified and stored in a -70°C freezer in the laboratory.

[0046] The recombinant strain DH5α-pBR-MisL-LH10, ​​which was revived, verified, and preserved, was cultured in a shaking incubator at 37°C for 16 h. The cells were centrifuged at 4000 r / min for 5 min, the supernatant was discarded, and the cells were washed three times with an equal amount of sterile 1×PBS (1×PBS powder purchased from Norvegian, product number: G101, pH 7.4, mixed with 1 L of ultrapure water) and the OD was measured. 600 , adjust the bacterial concentration to 1×10 9 CFU / mL, reserve for future use.

[0047] 3. Preparation of detection system

[0048] Peg-LH10 chimeric gene (SEQ ID NO. 2, 4829 bp) was synthesized by Nanjing Qikexing Biotechnology Co., Ltd. The chimeric gene obtained by replacing the site GTGAAACCGGATGAGGCGGGGAATTACACT of the Peg operon gene sequence (Peg pilus operon gene sequence reference sequence is Salmonella enterica CYX strain, GenBank accession number CP113540.1, 1702724-1707552) with LH10 (LH10 gene DNA sequence is CTGGTGACTAATCAAGGTCGAGGATTTCAT) was named Peg-LH10. The above chimeric gene was used as a template (1 μL, containing 1 ng of chimeric gene), and chicken white diarrhea Salmonella standard strain CVCC 526 genome (purchased from China Institute for Control of Veterinary Drug, China Veterinary Microbial Culture Collection Center) was used as a positive control, avian pathogenic E. coli isolate APEC-XM genome (Liu Jiaqi, Wu Shuxucon, Yin Yi, Zhang Dong, Xia Bintong, Ren Wenkai, Zhu Guoqiang. Construction of a mouse model of neonatal E. coli meningitis of the E. coli type caused by avian E. coli [J]. China Poultry, 2019, 41 (10): 26-30.) and E. coli engineering bacteria DH5α genome as negative controls, and SP Peg Up (5'-CGC GCTAGC ATGAAACGTTCACTTATTGCTGCT-3', the underlined sequence represents the Nhe I restriction enzyme site, respectively, and the primer was synthesized by Nanjing Qikexing Biotechnology Co., Ltd.) and SP Peg Down (5'-CGT GGATCCTTAATTATAAGATACCACGATTAATGC-3' The underlined sequences represent BamH I restriction enzyme sites, and the primer was synthesized by Nanjing Qikeng Biotechnology Co., Ltd.). The amplification system was as follows: pfu high-fidelity DNA Polymerase (Beijing Zison Biotechnology Co., Ltd., 2.5 U / μL), 2 μL, 5x pfu DNA polymerase buffer 10 μL, dNTPs 5 μL, 2 μL of each of the upstream and downstream primers (10 mM), 2 μL of recombinant gene DNA fragment (1 ng / μL) or APEC-XM genome (250 ng / μL) or DH5a genome (250 ng / μL) or CVCC 526 genome (250 ng / μL), and 27 μL of ultrapure water. The above system was mixed uniformly, and PCR amplification was performed using a thermal cycler (Bio-Red) with the following program: pre-denaturation at 94°C for 5 min, 30 cycles of amplification, including denaturation at 94°C for 30 s, annealing at 52°C for 30 s, and extension at 72°C for 3.5 min, further amplification at 72°C for 10 min, and temperature reduction to 12°C after amplification. A 1% agarose gel was prepared, electrophoresed at 110 V for 50 min, stained with ethidium bromide, and imaged under a UV imager. The PCR product of Peg-LH10 was 4847 bp; the positive control was 4850 bp; and the negative control had no amplification band. The PCR amplification product of Peg-LH10 was recovered using a universal DNA purification kit (Tiangen Biotech (Beijing) Co., Ltd.).

[0049] DNA purification kit to recover pBR322 plasmid DNA, the PCR amplification product of Peg-LH10 and pBR322 plasmid were double digested by Nhe I and BamH I restriction enzymes (NEB company) respectively, and then the linear DNA fragments were connected by T4 DNA ligase (NEB company) in a 16℃ metal bath overnight. The next day, the ligation product was transformed into S9H competent cells, and resistance screening was performed by coating with 100 μg / mL ampicillin solid medium. The S9H strain of the application was preserved in the laboratory (S9H inert carrier bacteria were derived from Chinese invention patent ZL202010427735.8, a general inert carrier Salmonella and its potential applications). Single colonies on the plate were inoculated into 100 μg / mL ampicillin LB liquid medium to grow to the platform phase, and the plasmid was recovered and then single-enzyme digested and double-enzyme digested by Nhe I and BamH I respectively. A 1% agarose gel was configured, and after electrophoresis at 110V for 50min, it was stained with ethidium bromide and imaged under a UV imager. The Nhe I and BamH I single-enzyme digestion products of the recombinant plasmid Pbr-Peg-LH10 were 9050bp; the double-enzyme digestion products of the vector included a 4215bp linear vector and a 4835bp Peg-LH10 linear DNA fragment. The S9H strain containing the correct recombinant plasmid pBR-Peg-LH10 was the S9H-Peg-LH10 recombinant bacteria. The constructed strain S9H-Peg-LH10 was verified and stored in the laboratory refrigerator at -70℃. The pBR-Peg recombinant plasmid was transformed into S9H bacteria to obtain the recombinant bacteria S9H-Peg, which was verified and stored in the laboratory refrigerator at -70℃. Compared with S9H-Peg-LH10, the S9H-Peg control recombinant strain only had the difference of B cell epitope peptide LH10, and was used as a control system for the detection system.

[0050] 4. Animal immunization and serum antibody titer determination

[0051] The immunogen recombinant strain DH5α-pBR-MisL-LH10 prepared in step 2 was used as an immunogen, and 4 5-6 week old BALA / c mice were injected subcutaneously at multiple points on the neck. The immunization was performed three times, the immunization interval was 10 days, and the immunization dose was 0.1 mL per mouse (the concentration of the recombinant strain was 1×10 9 CFU / mL). The retro-orbital plexus was used for blood collection, and the S9H-peg-LH10-antibody direct mediated agglutination test was established by using the S9H bacteria surface display expression constructed in step 3 to detect the specific antibodies and antibody titers in the mouse serum. The operation method is as follows: 20 μL of normal saline was added to a disposable 96-well hemagglutination plate, 20 μL of the above treated immune mouse serum was taken and blown repeatedly until completely mixed, and then 20 μL was sucked into the second well, and the operation was performed in turn.n Fold dilution. Take 5 μL of the supernatant from the first well and mix with 5 μL of the control system strain S9H-Peg which lacks only the single factor epitope and 5 μL of the S9H-Peg-LH10 detection system which expresses the LH10 epitope on the glass plate. Shake the glass plate for 2 min to mix thoroughly. Observe whether white agglomeration particles (antigen-antibody complex aggregates mediated by the LH10 epitope recognition antibody) appear. If white agglomeration particles appear in the detection system but not in the control system, it indicates that specific antibodies against the LmPio protein LH10 epitope have been detected, and the result is positive. If neither the control system nor the detection system has agglomeration particles, it is negative. Specific antibody titer testing is performed in the first well of the fold dilution. If the first well is positive and the second well is negative, the antibody titer is 1:2 1 and so on. After three immunizations, the mice produce specific antibodies against the target antigen. The antibody titers of the four mice after three immunizations are shown in Table 2. The antibody titer of No. 2 mouse reached 1:256, so No. 2 mouse was selected for subsequent cell fusion experiments.

[0052] Table 2 Detection of antibody titer changes of four mice after three immunizations by plate agglutination test

[0053]

[0054] Note: "-" indicates a negative test result; "+" indicates a positive test result.

[0055] 5. Cell fusion and positive well screening

[0056] (1) Preparation of myeloma cells Two weeks before fusion, Sp2 / 0 cells stored in the laboratory were resuscitated. When the cells were full and had clear and regular outlines, and the live cell rate was ≥ 95% as determined by trypan blue staining, the cell culture system was determined to have reached the fusion induction standard. Thirty-six to forty-eight hours before fusion, the bone marrow cells were expanded. On the day of fusion, the cells were gently blown off the bottle wall with a curved dropper, collected in a 50 mL centrifuge tube or fusion tube, and centrifuged at 1000 r / min for 5-10 min. The supernatant was discarded. Add 30 mL of DMEM medium (GIBCO Company, C11995500BT) and centrifuge at 1000 r / min for 5-10 min. Discard the supernatant, then resuspend the cells in 10 mL of DMEM medium and mix well for use.

[0057] (2) Preparation of feeder cells

[0058] Take BALA / c mouse peritoneal macrophage as feeder cells. 1-2 days before cell fusion, BALA / c mice were euthanized by CO2 method, soaked in 75% alcohol for 5-10 min, removed the mice, disinfected, and used disinfected tweezers to lift the abdominal skin from the back, completely expose the peritoneum, inject 6-10 mL of DMEM medium (GIBCO, C11995500BT) into the abdominal cavity in batches, pay attention to avoid penetrating the intestinal tube or piercing the peritoneum; use alcohol cotton ball to gently press the abdomen and suck out the injected culture solution; centrifuge at 1000 rpm for 8 min, discard the supernatant, add HAT complete medium (90% DMEM medium + 10% FBS + 1% penicillin-streptomycin mixed antibiotic + 1% 50x HAT, FBS purchased from Biochannel, BC-SE-FBS08, penicillin-streptomycin mixed antibiotic purchased from Biochannel, BC-CE-007, 50x HAT purchased from GIBCO, 21060017) to resuspend, adjust the cell concentration to 2x10 5

[0059] (3) Cell fusion and positive hybridoma screening

[0060] Euthanize the 2nd BALA / c mouse after immunization by CO2 method, take its spleen cells and mix them with the above treated Sp2 / 0 cells in a 50 mL fusion tube, add DMEM medium to 30 mL, mix thoroughly, centrifuge at 1000 rpm for 10 min, discard the supernatant. Gently tap the bottom of the fusion tube with your palm to loosen the cells evenly, add 1 mL of PEG fusion agent (purchased from Roche, catalog number: 10783641001) preheated to 40°C within 45 s, add 1 mL of DMEM medium preheated to 40°C within 90 s. DMEM is constant volume to 30 mL, 37°C water bath for 30 min, 1000 rpm centrifuge for 10 min, discard the supernatant, resuspend with HAT complete medium (90% DMEM medium + 10% FBS + 1% penicillin-streptomycin mixed antibiotic + 1% 50x HAT, FBS purchased from Biochannel, catalog number BC-SE-FBS08, penicillin-streptomycin mixed antibiotic purchased from Biochannel, catalog number BC-CE-007, 50x HAT purchased from GIBCO, catalog number 21060017), add 100 μL of cell suspension to the above 96-well plate with feeder cells, and incubate in a 37°C 6% CO2 incubator. Observe the cell fusion state continuously.

[0061] ​Two weeks after fusion, positive hybridoma cells were screened using an enzyme-linked immunosorbent assay (ELISA) based on S9H-peg-LH10-antibody direct media. The recombinant strain S9H-peg-LH10 expressing the B cell epitope peptide LH10 was coated on the S9H surface in a 96-well plate. 100 μL of hybridoma cell supernatant was added to each well, and positive and negative serum controls were set up. 1× PBS (1× PBS powder was purchased from Novozymes, catalog number: G101, pH value Positive serum from mouse No. 2 and negative serum from SPF mice, which had undergone three immunizations, were diluted 1:200 (pH 7.4, mixed with 1 L of ultrapure water) and incubated at 37°C for 2 h. Washed three times with PBST (1×PBS + 0.1% Tween 20 + 1 L of ultrapure water; 1×PBS powder purchased from Norvegian, Catalog No. G101, pH 7.4; Tween 20 purchased from Solarbio, Catalog No. 14240301005), each for 3-5 min, and patted dry. Add 100 μL of HRP-labeled goat anti-mouse IgG secondary antibody (purchased from Beijing Bioson Biotechnology Co., Ltd.) to each well, incubated at 37°C for 1 h, washed three times with PBST, each for 3-5 min, and patted dry. 100 μL TMB colorimetric solution (purchased from Beijing Solebow Technology Co., Ltd.) was added to each well and reacted at 37°C for 20-30 min. 50 μL 2 mol / L H2SO4 stop solution (prepared in this laboratory) was added to each well to stop the reaction. The OD was read on a microplate reader. 450 nm value. If the OD of the recombinant strain S9H-Peg-LH10 expressing the B cell epitope peptide LH10 is displayed 450 The reading value is compared with the OD of the control system S9H-Peg 450 A reading equal to or greater than 0.2 was assumed to be a positive hybridoma well.

[0062] The glass plate agglutination method is used to confirm whether the above-mentioned presumed positive hybridoma cell wells are hybridoma cells with antibodies against the B-cell epitope peptide LH10. The method is as follows: the supernatant of the above-mentioned presumed positive hybridoma cells is aspirated from the 96-well plate, two 5 μL supernatant samples are added dropwise to the glass plate, and mixed with 5 μL of the control system strain S9H-Peg and the test system strain S9-Peg-LH10, ​​respectively. The glass plate is shaken back and forth to mix thoroughly. The agglutination reaction is determined within 2 minutes and the results are read. If white agglutinated particles appear by naked eye, while there are no agglutinated particles in the control system, it indicates that specific antibodies against the LmPio membrane protein B-cell epitope peptide LH10 have been detected, and the result is determined to be positive.

[0063] (4) Cloning of hybridoma cells

[0064] The positive hybridoma cells obtained from the original wells were subcloned three times using the limiting dilution method to obtain a monoclonal hybridoma cell line 2C7-7G that secretes stable antibodies. The method is as follows:

[0065] The day before, the feeder cells were prepared according to the method in "Cell fusion". The hybridoma cells in the original well were resuspended with HT-containing medium (90% DMEM medium + 10% FBS + 1% mixed antibiotics of penicillin and streptomycin + 2% 100xHT, FBS purchased from Biochannel, BC-SE-FBS08, mixed antibiotics of penicillin and streptomycin purchased from Biochannel, BC-CE-007, 100xHT purchased from GIBCO, 11067030), and the cell concentration was adjusted to 10 cells / mL by sequential dilution. The diluted cell suspension was aliquoted into sterile 96-well cell culture plates at 100 μL / well, ensuring that each well contained 1 cell.

[0066] The cell culture plates were placed in a 37°C, 6% CO2 constant temperature and humidity incubator for 7 days, until the supernatant was completely yellow and a visible cell mass formed in the well. The specific antibody was detected by S9H-peg-LH10-antibody direct mediation-based enzyme-linked immunosorbent assay (ELISA) for the clone well, and the clone well secreting positive antibody was reserved to obtain the hybridoma cell strain 2C7-7G secreting specific antibody against LH10 epitope. The agglutination titer of the prepared monoclonal antibody was determined by agglutination experiment, and the hybridoma cell strain 2C7-7G culture supernatant antibody was diluted 2 n times with normal saline, and the agglutination test was performed using the control system S9H-Peg and the detection system S9H-Peg-LH10. Figure 1 A-H in the table are the agglutination results of the hybridoma cell strain 2C7-7G culture supernatant antibody, and H is the agglutination result of the last dilution (1:256), which is negative, and the rest are positive. The last positive dilution of the agglutination reaction is taken as the agglutination antibody titer of the serum, and the results are shown in Figure 1 The agglutination titer of the hybridoma cell strain 2C7-7G culture supernatant antibody is 1:128, i.e. the specific antibody titer of the mAb against LH10 epitope in this example reaches 1:128. The hybridoma cell strain 2C7-7G was preserved in the China Center for Type Culture Collection on May 8, 2025, and the preservation number is CCTCC NO: C2025152.

[0067] (5) Preparation and purification of hybridoma cell strain 2C7-7G ascites monoclonal antibody

[0068] The hybridoma cell strain 2C7-7G was cultured in large quantities, and five 8-week-old BALB / c female mice were injected with liquid paraffin into the abdominal cavity at 0.5 mL per mouse. After 7-10 days, the hybridoma cell strain 2C7-7G diluted with 1xPBS was inoculated into the abdominal cavity, 1x10 6A cell, daily observation of ascites production in mice, such as abdominal swelling, skin tension, can be collected ascites antibody. The ascites 12000 rpm centrifugation for 5-10 min, remove the precipitate, glass plate agglutination test to prepare the agglutination titer of antibodies in ascites, the mouse ascites antibody with 2 n times dilution, using the control system S9H-Peg, detection system for S9H-Peg-LH10 strain, plate agglutination test for diluted ascites antibody, Figure 2 A~P for ascites antibody agglutination results, Figure 2 P is the last dilution (1:65536) agglutination results for negative, the rest is positive. The last agglutination reaction positive dilution as the serum agglutination antibody titer, as shown in Figure 2 determination of the ascites antibody agglutination titer is 1:32768. That is, the specific antibody titer of the example for B cell epitope peptide LH10 reaches 1:32768, quantitative test using saturated ammonium sulfate (SAS) ascites antibody purification.

[0069] Example 2, anti-LmPio protein B cell epitope peptide LH10 monoclonal antibody Western blot analysis

[0070] Using SnapGene software to analyze the full length amino acid sequence of LmPio, the predicted protein molecular weight is 43.92 kDa, using ProP-1.0 to analyze the full length amino acid sequence of LmPio, it is found that the protein has furin cleavage site, after cutting has two proteins with protein molecular weight of 32.08 kDa and 11.86 kDa.

[0071] 2, anti-LmPio protein B cell epitope peptide LH10 monoclonal antibody Western blot verification and analysis

[0072] (1) extraction and quantification of total protein

[0073] Select the laboratory breeding of good physiological condition of locust (from Shanxi University of applied biology institute locust breeding room), according to T7RiboMAX TMThe dsRNA (dsLmPio) was synthesized by in vitro transcription according to the kit instructions of Express RNAi System (Promega, P1700), and dsGFP was synthesized as a control using the green fluorescent protein gene GFP. On the first day of the third instar (N3D1), each insect was injected with 6 μg of double-stranded RNA (including dsGFP and dsLmPio, respectively, with an injection concentration of 2 μg / μL and an injection volume of 3 μL), and on the fourth day of the third instar (N3D4), the epidermal tissue was taken for total protein extraction, and the epidermal tissue of the untreated locust on the first day of the fifth instar (N5D1) was also taken for total protein extraction. The specific method is as follows:

[0074] The epidermal tissue was placed in a mortar and ground with liquid nitrogen, then the ground tissue powder was placed in a 1.5 mL centrifuge tube, Western and IP cell lysis buffer (Beyotime Company, P0013) was added, and the volume covered the material, then 1% of the volume of the lysis buffer was added. Proteinase inhibitor (Solarbio Company, P8340) was added; after standing on ice for 30 min, centrifugation was performed at 4°C in a centrifuge at 10000g for 20 min, then the supernatant was transferred to a new 1.5 mL centrifuge tube to obtain N3D4-dsGFP total protein, N3D4-dsLmPio total protein and N5D1 total protein, respectively; the protein concentrations were measured by BCA method, and the protein concentrations were 4.0 μg / μL, 3.1 μg / μL and 4.8 μg / μL, respectively. The protein concentration was diluted to 2.5 μg / μL with SDS-PAGE loading buffer (Beyotime Company, P0015L) for standby.

[0075] (2) Western blot verification

[0076] The N3D4-dsGFP total protein, N3D4-dsLmPio total protein and N5D1 total protein prepared above were denatured at 98°C in a metal bath for 5 min, and the proteins were separated by 12% SDS-PAGE (Beyotime Company, P0458S), with consistent loading amount per well (50 μg, 20 μL per well), and LmPio protein expressed and purified from eukaryotic HEK293F cells was used as a positive control. The loading order was protein Marker (Beyotime Company, P0068), positive control (purified LmPio protein, protein concentration was 7.5 μg / μL, diluted to 2.5 μg / μL with SDS-PAGE loading buffer for standby), N5D1 total protein, N3D4-dsGFP total protein and N3D4-dsLmPio total protein. After running the gel, the membrane was transferred, blocked and incubated, and the specific method is as follows:

[0077] Membrane transfer: cut the same size PVDF membrane (Beyotime, FFP32) and soak it in methanol for 1 min before transferring it to the membrane transfer buffer. Use the universal protein transfer instrument (BIO-RAD, 1704150) to transfer the membrane. Place the transfer sponge (Beyotime, FFP32), PVDF membrane, protein gel and transfer sponge in the transfer device in order. The transfer conditions are: 2.5V, 1.3A, 15min.

[0078] Blocking: prepare a TBST solution containing 5% BSA as blocking solution. Place the transferred PVDF membrane in the blocking solution and block it in the refrigerator at 4°C overnight.

[0079] Incubation: dilute the hybridoma cell supernatant 2C7-7G (agglutination antibody titer 1:128) at 1:50 and the mouse ascites antibody prepared according to step 5(5) of Example 1 (1:32768) at 1:500 with TBST (Beyotime, ST673) solution containing 1% BSA as primary antibody incubation. Place the membrane in a 37°C incubator for 2h. Then wash the membrane with TBST solution for 3 times, 10min each time. Dilute the HRP-labeled goat anti-mouse IgG secondary antibody (purchased from Beijing Boao Sun Biotechnology Co., Ltd.) at 1:5000 with TBST solution containing 1% BSA as secondary antibody incubation. Place the membrane in a 37°C incubator for 2h in the dark. Then wash the membrane with TBST solution for 3 times, 10min each time (2 membranes are incubated: hybridoma cell supernatant 2C7-7G and mouse ascites each for 1). Use the chemiluminescence imaging system (BIO-RAD, 12003154) for imaging, use Image J for gray value analysis, and use Graphpad 10.1.2 for statistical data.

[0080] (3) Western blot result analysis

[0081] Use Western blot technology to incubate hybridoma cell supernatant monoclonal antibody at 1:50 dilution and mouse ascites monoclonal antibody at 1:500 dilution as primary antibody. The Western blot results of the positive control group are shown in Figure 3As shown, the hybridoma cell supernatant and mouse ascites antibody appeared a specific band of LmPio full-length protein size at the position of 43.92 kDa, and the gray value analysis result accounted for a large part, 75%. Due to the enzyme cutting effect of furin protease (the protease cutting occurs at the last arginine), the complete protein was cut by furin after the reaction process, and a 11.86 kDa band appeared (red arrow), accounting for a very small part, 25%, and the band at the blue arrow accounted for a very small part, which can be ignored. The Western blot results of N5D1 total protein, N3D4-dsGFP total protein and N3D4-dsLmPio showed that the hybridoma cell supernatant and mouse ascites antibody did not appear a 43.92 kDa band, but only a specific band at 11.86 kDa, which was due to the complete cutting of furin in locusts. Therefore, from the above results, it can be seen that the specificity effect of the hybridoma cell supernatant monoclonal antibody and the source ascites monoclonal antibody of the application is excellent, and the effect of the mouse ascites antibody is better than that of the hybridoma cell supernatant antibody.

[0082] In summary, the application discloses a B cell epitope peptide of Locusta migratoria zona pellucida membrane protein LmPio, a hybridoma cell strain, and a preparation method and application of a monoclonal antibody. A B cell epitope peptide LVTNQGRGFH (LH10) of the zona pellucida membrane protein is obtained through bioinformatics technology prediction, is functionally displayed and expressed on a biological carrier surface, and an immunogen is constructed for immunizing animals. After screening and identification through a system S9H-peg-LH10-antibody direct mediation enzyme-linked immunosorbent assay (ELISA) and a S9H-peg-LH10-antibody direct mediation agglutination test, a monoclonal antibody of the known B cell epitope peptide LH10 is obtained. The antibody is verified through Western blot to be specific. The prepared LmPio monoclonal antibody can accurately recognize a specific epitope of the membrane protein, avoids cross reaction, and provides a good foundation for subsequent biochemical experiments. The monoclonal antibody can be used for immunohistochemistry (IHC) in the future, is incubated with tissue sections or cell smears, and is used for accurately positioning and capturing an expression site and mode of the protein. In addition, the monoclonal antibody will also play an important role in immunoprecipitation (IP) and co-immunoprecipitation (Co-IP), is used for fishing other proteins interacting with LmPio, and is used for studying an interaction network between the proteins, which has important significance for clarifying and understanding a specific action mechanism of LmPio, and is expected to achieve good results in future experiments.

Claims

1. Locust zona pellucida membrane protein LmPio B cell epitope peptide LH10, ​​characterized in that: Its amino acid sequence is LVTNQGRGFH.

2. The nucleic acid molecule encoding the B cell epitope peptide LH10 according to claim 1, characterized in that: The DNA sequence of the nucleic acid molecule is CTGGTGACTAATCAAGGTCGAGGATTTCAT.

3. An expression cassette, a recombinant vector, a recombinant strain, an immunogen or a detection system comprising the nucleic acid molecule according to claim 2.

4. The recombinant strain or immunogen according to claim 3, characterized in that The recombinant strain or immunogen is obtained by inserting the nucleic acid molecule according to claim 2 into the MisL passenger domain of the Salmonella V-type secretion system and introducing the resultant into a carrier bacterium.

5. The recombinant strain or detection system according to claim 3, characterized in that The recombinant strain or detection system is a nucleic acid molecule of claim 2 inserted into Salmonella peg The fimbriae operon gene was introduced into the inert carrier strain S9H.

6. The method for preparing the recombinant strain or immunogen according to claim 4, characterized in that: The method comprises the following steps: inserting the nucleic acid molecule according to claim 2 into the MisL passenger domain of the Salmonella V-type secretion system, and introducing the nucleic acid molecule into a carrier bacterium to obtain the nucleic acid molecule.

7. The method for preparing the recombinant strain or detection system according to claim 5, characterized in that: The method comprises the following steps: inserting the nucleic acid molecule of claim 2 into Salmonella peg The fimbriae operon gene was introduced into the inert carrier strain S9H.

8. A hybridoma cell line, characterized in that The hybridoma cell line was deposited in the China Center for Type Culture Collection on May 8, 2025, with a deposit number of CCTCC NO: C2025152.

9. An anti-LH10 monoclonal antibody, characterized in that: The monoclonal antibody is obtained by immunizing an animal with the immunogen according to claim 3 or secreting the hybridoma cell line according to claim 8.

10. The method for preparing the anti-LH10 monoclonal antibody according to claim 9, characterized in that: The following steps are involved: Female BALB / c mice aged 8-10 weeks were selected and intraperitoneally injected with liquid paraffin. 7-10 days later, the hybridoma cells according to claim 8 in the logarithmic growth phase were intraperitoneally injected. After the abdomen of the mice was significantly swollen, ascites was collected, centrifuged to remove cell debris and other precipitates, and the supernatant was purified to obtain the obtained product.

Images