Salmonella detection primer combination and detection method

Abstract

The invention discloses a salmonella detection primer combination and a detection method, and relates to the technical field of bioengineering. The primer is fimY-RPA-F3, and the sequence of the primer is as shown in SEQ ID No: 7; and the sequence of the fimY-RPA-R3 is as shown in SEQ ID No: 8. In order to establish a salmonella RPA rapid detection method, by optimizing primer design, reaction conditions and a detection process, the detection sensitivity and specificity are improved, the detection time is shortened, and the operation process is simplified, so that the requirement of on-site rapid detection is met, and a technical support is provided for food safety supervision and public health prevention and control.

Description

TECHNICAL FIELD

[0001] The application relates to the field of bioengineering technology, and particularly relates to a Salmonella detection primer combination and a detection method. BACKGROUND

[0002] At present, Salmonella spp. widely exists in livestock and poultry, aquatic products and their products, and can easily cause gastrointestinal infections of human and animals, seriously threatening animal health and food safety, and occupying an important position in global public health. Salmonella can cause diarrhea, enteritis, arthritis, and even septicemia and other clinical symptoms in pigs, cattle, sheep and poultry. As a zoonotic pathogen, Salmonella can be transmitted from animals to humans through contaminated meat, animal products or other foods, resulting in a large number of cases of illness and death. The difference in clinical manifestations and mortality after infection in humans and animals depends on the strain serotype and host characteristics (breed, age, sex, gender, nutrition and immunity), and among various serotypes of Salmonella, Salmonella typhimurium and Salmonella enteritidis are the most common pathogenic serotypes. It is estimated that 104-106 Salmonella can infect adults, and in high-susceptible populations, the infection dose can be as low as 101-102 bacteria. Therefore, simple, rapid, reliable and effective Salmonella detection methods are conducive to the prevention and control of animal diseases and the occurrence of human foodborne infections.

[0003] Salmonella has a large number of hosts and can cause diseases in various livestock and poultry, with a high infection rate, resulting in decreased production performance and even death, causing huge losses to the breeding industry. Chickens infected with Salmonella exhibit different diseases, such as common chicken paratyphoid, chicken typhoid and chicken white dysentery. Chicken white dysentery can cause a large number of deaths in chicks, and chicken typhoid can cause liver and spleen parenchymal lesions and septicemic infectious diseases in young and adult chickens. The feed conversion rate of infected poultry decreases by 10%-15%, and the growth rate slows down, resulting in a decrease of about 5-10 grams in average daily weight gain. According to public data sources, the annual loss caused by non-typhoidal Salmonella (NTS) infection in poultry in Nigeria in 2020 reached 457 million US dollars, including direct animal losses, culling and compensatory slaughter, etc. Salmonella infection can also cause acute gastroenteritis and septicemia in pigs, and abortion in dairy cows. In addition, the products (meat, eggs, milk) of infected livestock and poultry need to be subjected to additional inspection and treatment, or forced to be sold at a lower price, resulting in a market value loss of up to 330 million euros in the European Union every year.

[0004] Traditional culture method is considered as the standard detection method for Salmonella, but it relies on medium culture, selective enrichment and biochemical identification, which is time-consuming, complicated and requires high technical skills. Molecular detection technology can realize rapid, high sensitivity and high specificity detection of pathogens by recognizing specific nucleic acid sequences of Salmonella, which not only greatly shortens the detection time, realizes quantitative and high-throughput detection, but also can detect multiple pathogens at the same time. However, these technologies usually rely on professional thermal cycler instruments and complex operation procedures, which are not convenient for on-site detection. The development of isothermal amplification technology, such as loop-mediated isothermal amplification, transposon-based DNA amplification, helicase-dependent amplification and recombinase polymerase amplification, promotes the implementation of on-site accurate detection of pathogens. RPA has significant advantages, such as no need for high temperature and complex temperature control equipment, compared with LAMP technology which requires 4-6 primers and 30-60 min amplification at 60-65 ℃, and the loop product is easy to cause non-specific amplification. RPA only needs a pair of primers, shorter reaction time and better specificity, which is suitable for on-site and resource-limited environment. TaqMan dual fluorescence probe detection technology developed by Guo Rui et al. can detect foodborne Salmonella and Shigella at a positive plasmid concentration of 5 copies / μL. Chen Lijun established a conventional PCR and Taqman qPCR detection method based on the highly homologous sequence STM1410 obtained from the whole genome analysis of 570 Salmonella strains, with sensitivities of 5×10 1 copies / μL and 5×10 0 copies / μL, respectively. Gong Jian Sen et al. established a PCR detection method for chicken white diarrhea Salmonella and chicken typhoid Salmonella based on pegB gene, with a sensitivity of 10.14 pg / reaction. Compared with the above molecular detection methods, the RPA reaction established in this test has a minimum detection limit of 1.56×10 1 copies / μL for DNA nucleic acid samples, with good sensitivity.

[0005] Traditional detection technology for Salmonella is based on enrichment, separation and biochemical identification. Although it has good accuracy and specificity, it is difficult to meet the actual needs of rapid detection and high-throughput screening due to its complex operation and long detection period (usually 2-3 days). Rapid detection methods for Salmonella include selective media, immunological assays and nucleic acid assays, among which recombinase polymerase amplification (RPA) technology has become a research hotspot in the field of molecular rapid detection due to its constant temperature amplification, rapid reaction and low equipment requirements. Further systematic research and technical optimization of RPA technology in the application of rapid detection of Salmonella have important theoretical significance and practical value.

[0006] The target genes with high conservation and species specificity for the established Salmonella molecular detection methods include invA, stn, fimA, fimY and hilA, etc. These genes are widely present in Salmonella and closely related to pathogenicity. The invA gene encodes the invasion protein of type III secretion system, which is widely distributed in almost all Salmonella serotypes, and becomes the mainstream target of molecular detection because of its high conservation and correlation with invasion ability. Nuchchanart et al. designed a detection method based on loop-mediated isothermal amplification technology combined with immunochromatographic test strip technology, which realized the rapid qualitative detection of Salmonella in food samples within 60 min at 63℃. Stn gene encodes Salmonella enterotoxin, which not only participates in membrane integrity regulation, but also is an important biomarker for distinguishing different serotypes. Zhong Weijun et al. designed primers and fluorescent probes specific for amplifying stn target gene, and constructed a Salmonella nucleic acid fluorescent quantitative PCR detection system, and the positive plasmid detection sensitivity was 4 / μL. HilA gene is a key transcription factor in SPI-1 virulence island, which regulates the expression of multiple invasion-related genes, and its conservation ensures the universality of detection. Chu et al. used LAMP method for hilA gene, and the detection limit was 20 copies / reaction. FimY gene is a transcription factor for regulating type I pilus expression, and its sequence is highly conserved in Salmonella, and rarely homologous in other bacteria. There are reports that ordinary PCR, double-dilution digital PCR (ddPCR) and isothermal amplification detection methods have been established for FimY gene, and these reports and the method established in the present application have good sensitivity and specificity. FimY, as a single copy, highly conserved in Salmonella and related to adhesion pathogenicity, combined with RPA amplification technology, has the potential to become a reliable method for rapid on-site detection.

[0007] Therefore, it is an urgent problem for those skilled in the art to provide a Salmonella detection primer and detection method with high detection sensitivity and specificity, shortened detection time, simplified operation process, and meeting the needs of rapid on-site detection. SUMMARY

[0008] Therefore, the present application provides a Salmonella detection primer combination and detection method.

[0009] In order to achieve the above-mentioned purpose, the present application adopts the following technical solutions:

[0010] A Salmonella detection primer combination, the primer is,

[0011] The upstream primer fimY-RPA-F3 is AAAACGTACCGCAGCATTCCGCTCATTAGAT G, and the sequence is shown as SEQ ID No: 7;

[0012] Downstream primer fimY-RPA-R3: CGATAAGCGAGGTTTGGAGGCTGATAACAAG G, sequence as shown in SEQ ID No: 8.

[0013] Further, the primer also includes:

[0014] Upstream primer fimY-LFD-F: GAAGCCTTGTTATCAGCC, sequence as shown in SEQ ID No: 9;

[0015] Downstream primer fimY-LFD-R: BIOTIN-TGATAAGGTACGCTTTGCT, sequence as shown in SEQ ID No: 10;

[0016] Probe fimY-LFD-Probe: FAM-GCCTCCAAACCTCGCTTATCGGAAAGCT(THF)AGCCGTACTGACTGG-C3Spacer, sequence as shown in SEQ ID No: 11.

[0017] A Salmonella detection method, comprising the following steps:

[0018] (1) Prepare 50 μL RPA reaction system: Rehydration Buffer 29.5 μL, the upstream primer fimY-RPA-F3 and downstream primer fimY-RPA-R3 each 2.4 μL (10 μmol / L), template DNA 2 μL and ddH2O 11.2 μL; negative control is ddH2O; after premixing, move into freeze-dried enzyme reaction tube, and make freeze-dried powder completely dissolved, add 2.5 μL MgoAc (280 nm / L) before starting the test, mix well, and place in 20-30℃ water bath after off-lying for 20-30 min;

[0019] (2) After amplification, quickly transfer to low-temperature termination reaction, take the product after purification recovery by kit, and detect by 1% AGE;

[0020] (3) Result judgment: 1% AGE detection result shows that the amplification band is about 300 bp, then the result is positive; if there is no band, the result is negative.

[0021] A Salmonella detection method, comprising the following steps:

[0022] (1) Prepare 50 μL RPA-LFD reaction system:

[0023] Nfo enzyme 1 μL, Nfo enzyme cutting Buffer 5 μL, the probe fimY-LFD-Probe 0.6 μL (10 μmol / L), the upstream primer fimY-LFD-F and the downstream primer fimY-LFD-R each 2.4 μL (10 μmol / L), template DNA 2 μL, and ddH2O is supplemented to 50 μL; the negative control is ddH2O; after premixing, it is moved into the freeze-dried enzyme reaction tube, and the freeze-dried powder is completely dissolved, 2.5 μL MgoAc (280 nm / L) is added before starting the test, and after mixing and orderly separation, it is placed in a 20-30 DEG C water bath for 20-30 min;

[0024] (2) after amplification, it is quickly transferred to low-temperature termination reaction, 20 μL RPA amplification product is mixed with 80 μL LFD Buffer, and the liquid absorption end is placed in the above-mentioned mixed reaction system at the bottom pad of the test paper strip;

[0025] (3) result determination: the detection line and the quality control line are both colored positive; only the quality control line is colored negative; if the quality control line is not colored, the test is invalid.

[0026] Further, the reaction temperature in step (1) is preferably 25 DEG C.

[0027] Further, the reaction time in step (1) is preferably 25 min.

[0028] Through the above technical solution, compared with the prior art, the beneficial effects of the present application are:

[0029] The Salmonella RPA basic detection method is established and optimized, and the amplification can be better completed under the condition of 25 DEG C and 25 min, the detection sensitivity of the positive plasmid is 1.56 x 10 1 copies / μL, and there is no cross reaction with Pasteurella multocida, Escherichia coli, Listeria, Staphylococcus aureus and Pseudomonas aeruginosa. 10 clinical samples are detected by the newly established method, and the coincidence rate is 100% compared with the classic PCR detection method of the same target gene. The present application provides a reliable scheme for on-site detection of Salmonella, and provides technical support for livestock product processing and Salmonella prevention and control. BRIEF DESCRIPTION OF DRAWINGS

[0030] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or the prior art description. Obviously, the drawings in the following description are only embodiments of the present application, and those skilled in the art can obtain other drawings according to the provided drawings without creating any creative labor.

[0031] Figure 1For the cloning of the fimY of the present application, M: DL2000 DNA Marker; 1, 2: fimY target fragment PCR results; 3: negative control;

[0032] Figure 2 For the RPA amplification (A) and RPA-LFD (B) results of the present application, Figure 2 A: RPA basic amplification; Figure 2 B: RPA-LFD reaction; M: DL2000 DNA Marker; 1: fimY-RPA-F3 / fimY-RPA-R3 amplification product after purification; 3: primer, probe amplification results; 2, 4: negative control;

[0033] Figure 3 For the optimization of the reaction temperature of the present application, Figure 3 A: Optimization of RPA basic reaction temperature; Figure 3 B: Optimization of RPA-LFD reaction temperature; M: DL2000 DNA Marker; 1-7: 10℃, 15℃, 20℃, 25℃, 30℃, 35℃, 40℃; 8: negative control;

[0034] Figure 4 For the optimization of the reaction time of the present application, Figure 4 A: Optimization of RPA basic reaction time; Figure 4 B: Optimization of RPA-LFD reaction time; M: DL2000 DNA Marker; 1-7: 10min, 15min, 20min, 25min, 30min, 35min, 40min; 8: negative control;

[0035] Figure 5 For the sensitivity experiment of the present application, Figure 5 A: RPA basic sensitivity test; Figure 5 B: RPA-LFD sensitivity test; M: DL2000 DNA Marker; 1-7: 1.56×10 0 ~ 2.26×10 6 copies / μL; N: negative control;

[0036] Figure 6 For the specificity experiment of the present application, Figure 6 A: RPA basic specificity test; Figure 6 B: RPA-LFD specificity test; M: DL2000 DNA Marker; 1-5: Escherichia coli, Pseudomonas aeruginosa, Pasteurella multocida, Listeria, Staphylococcus aureus; 6: negative control;

[0037] Figure 7 Reproducibility test of the present application, Figure 7 A: RPA basic reproducibility test; Figure 7 B: RPA-LFD reproducibility test; M: DL2000 DNA Marker; 1: 1.56 x 10 6 copies / μL; 2: 1.56 x 10 4 copies / μL; 3: 1.56 x 10 2 copies / μL; N: negative control;

[0038] Figure 8 RPA basic, RPA-LFD and PCR detection results of the present application, Figure 8 A: RPA basic detection; Figure 8 B: RPA-LFD detection; Figure 8 C: PCR detection; M: DL2000 DNA Marker; 1-10: clinical samples; N: negative control. DETAILED DESCRIPTION

[0039] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0040] Example 1

[0041] Materials and methods

[0042] Strains and clinical samples

[0043] Strains used in this experiment: Salmonella typhimurium SL1344 strain, Escherichia coli CVCC10141 strain, Pseudomonas aeruginosa ATCC9027 strain, Listeria CVCC0586 strain, Staphylococcus aureus CVCC26003 strain and Pasteurella multocida isolated strain. Ten clinical samples of sick chickens from chicken farms in Qiqihar City were collected, and the genomic DNA was extracted and stored at -80℃.

[0044] Main reagents and instruments

[0045] Genomic DNA extraction kit was purchased from Xin Hai Gene Detection Co., Ltd.; RPA kit (TwistAmp Basic) was purchased from Twist Dx Company in the United Kingdom; HybriDetect Dipsticks was purchased from Milenia Biotec Company in the United Kingdom; E. coli DH5α competent cells, ligase and pMD-18T vector were purchased from Dalian Baobio Engineering Co., Ltd.; Endonuclease IV (Nfo) was purchased from Nanjing Jujian Biological Technology Co., Ltd.; PCR product recovery kit, 2x TaqPlus Master Mix II, DL2000 DNA Marker, Ultra GelRed Nucleic Acid Stain and 6x Loading Buffer were purchased from Shanghai Sangon Biological Engineering Co., Ltd.; flexcycler2 PCR instrument of Analytik Jena Company in Germany; electric heating constant temperature water tank of Shanghai Yiheng Scientific Instrument Co., Ltd.; electrophoresis instrument of Beijing Liu Yi Biological Technology Co., Ltd.

[0046] Design and synthesis of primers and probes

[0047] Through the alignment analysis of the gene sequences of Salmonella fimY gene KF499357.1, JQ665438.1 and M90677.1 published on GeneBank, the conserved sequence was further determined, and the PCR primer was designed for the construction of positive clone (Table 1). According to the requirements of RPA reaction on the amplification sequence and efficiency, multiple specific primers were designed for test according to the TwistAmp product manual and related literature. The base number of RPA primer is usually more than that of conventional PCR primer (30-35 bp), and multiple consecutive G and C bases should be avoided, and the content is controlled between 20% and 80%. The downstream primer of RPA-LFD method is modified with FAM label at 5' end, and C3 (CS Spacer) interval is added at 3' end. The modification inside the probe must introduce THF (tetrahydrofuran). The design of primers and probes uses Primer 5 software, focuses on the compatibility between the probe and the primer, reduces the compatibility of the two, and ensures the specificity by BLAST comparison after the design is completed. The primers and probes were synthesized by Shanghai Sangon Biological Engineering Co., Ltd. (Table 1).

[0048] Table 1 RPA primer sequence

[0049]

[0050] Note: BIOTIN is biotin, FAM is a fluorescent group, (THF) is a dealkylation site, and C3Spacer is a blocking group.

[0051] Extraction of genomic DNA

[0052] Salmonella typhimurium, Pasteurella multocida, Escherichia coli, Listeria, Staphylococcus aureus and Pseudomonas aeruginosa were streaked on Martin broth plates and incubated at 37°C for 12-16h. Single colonies were inoculated into 5mL Martin broth and incubated at 37°C with shaking until the OD 600 The value was about 1, and 1.5mL of the culture was used for DNA extraction with the kit. The product was stored at -20°C for later use.

[0053] Construction of recombinant plasmid and calculation of plasmid copy number

[0054] PCR primers fimY-PCR-F and fimY-PCR-R were used to specifically amplify the fimY target fragment under the conditions described in the PCR premix system. The amplified product was recovered and purified, ligated to pMD18-T vector, and heat-transformed into E. coli DH5a competent cells. The cells were cultured in A+LB solid medium under the selection conditions, and typical colonies were picked from the culture plate and inoculated into 5mL A+LB liquid medium. The cells were cultured at 37°C for 10-12h, and 1.5mL of the bacterial solution was used for plasmid extraction. The extracted plasmid was used for amplification identification of primers fimY-PCR-F and fimY-PCR-R, and for sequencing analysis. The plasmid concentration (ng / μL) was detected by microspectrophotometer, and the copy number was calculated according to the following formula:

[0055]

[0056] Construction results of pMD 18T-fimY / DH5a

[0057] The 538bp species-specific fimY gene was amplified using the DNA extracted from Salmonella typhimurium as the template. The recombinant strain pMD 18T-fimY / DH5a was obtained after cloning. The recombinant plasmid extracted from the strain was used as the template for PCR amplification and 1% AGE identification. The target band (538bp, Figure 1 ) was observed, and the sequencing results also showed that the fimY gene was successfully cloned.

[0058] Construction of reaction system

[0059] According to the TwistAmp basic manual, a 50 μL RPA reaction system was prepared: Rehydration Buffer 29.5 μL, upstream primer, downstream primer 2.4 μL (10 μmol / L) each, template DNA 2 μL and ddH2O 11.2 μL, negative control was ddH2O, after premixing, it was moved into the freeze-dried enzyme reaction tube, and the freeze-dried powder was completely dissolved, 2.5 μL MgoAc (280 nm / L) was added before the test started, mixed, and placed in a 37℃ water bath for 30 min after separation. After amplification, it was quickly transferred to a low-temperature termination reaction, and the product was purified and recovered by a kit, and then detected by 1% agarose gel electrophoresis (AGE).

[0060] The previous study of the application showed that the RPA amplification product can also be detected in time by 1% AGE, which simplifies the reaction process and shortens the detection time.

[0061] The experimental results showed that, according to the RPA basic reaction standard system, the template was the same positive plasmid, the designed primers were tested, the amplification product was purified by a gel recovery kit, and then detected by 1% AGE. The primers fimY-RPA-F3 and fimY-RPA-R3 with longer conservative sequences and better amplification effect were selected for subsequent method establishment (300 bp) Figure 2 A).

[0062] The RPA-LFD reaction used its corresponding primers and probes, the probe was 0.6 μL, the Nfo enzyme was 1 μL, the Nfo enzyme cutting buffer was 5 μL, and ddH2O was supplemented to 50 μL, and the rest of the conditions were consistent with RPA Basic.

[0063] After the reaction, 20 μL of RPA amplification product was mixed with 80 μL of LFD buffer buffer, and the liquid end was placed in the above mixed reaction system by holding the bottom pad of the test paper strip. The results were determined: the detection line and the quality control line were both positive; only the quality control line was negative; if the quality control line did not develop color, the test was invalid.

[0064] The experimental results showed that the RPA-LFD reaction used primers and probes screened by software, and the detection of recombinant plasmid obtained the expected result Figure 2 B).

[0065] Reaction temperature optimization

[0066] In order to screen the most suitable reaction temperature, the same concentration (1.56×10 9copies / μL) pMD18T-fimY plasmid as template, the reaction system was the same as 1.6, and the prepared RPAbasic and RPA-LFD reaction tubes were placed at 10℃, 15℃, 20℃, 25℃, 30℃, 35℃ and 40℃, respectively, and the reaction was terminated at 30min. The amplification results were verified by 1% AGE and LFD, respectively.

[0067] The experimental results showed that the RPA basic amplification results were detected by 1% AGE, and the target band was visible at the expected size, and the product gradually increased with the increase of temperature, but the change was no longer obvious when the temperature was more than 25℃. Figure 3 A), RPA basic started from 15℃, the target band was visible at the expected size, and the product gradually increased with the increase of temperature, but the change was no longer obvious when the temperature was more than 25℃. According to the results of Figure 3 B, when the reaction temperature was above 25℃, the LFD detection signal was clear and stable, and there was no obvious difference in visual observation. In summary, 25℃ was selected as the most suitable reaction temperature.

[0068] Reaction time optimization

[0069] In order to determine the optimal reaction time, according to 1.6 system, the same concentration (1.56×10 9 copies / μL) pMD18T-fimY plasmid as template, according to the results of 1.7, the prepared RPAbasic and RPA-LFD reaction tubes were reacted at 25℃ water bath, and were terminated at 5, 10, 15, 20, 25, 30, 35min, respectively, and the amplification results were verified by 1% AGE and LFD.

[0070] The experimental results showed that the reaction temperature was 25℃, and the reaction time was set to 10, 15, 20, 25, 30, 35 and 40min. From Figure 4 A showed that the amplification band gradually increased within 10min-25min, and there was no obvious difference after 25min. RPA-LFD analysis Figure 4 B) showed that the detection line was basically consistent after 25min. In summary, 25min was selected as the best reaction time.

[0071] Sensitivity test

[0072] The reaction tube was prepared according to the established system, and the optimized reaction temperature and time were used. The plasmid with a concentration of 1.56×10 9 copies / μL was diluted by 10 times, and the reaction was carried out using 1.56×10 6～0 copies / μL plasmid as template, and the amplification results were verified by 1% AGE and LFD after termination.

[0073] The experimental results showed that the concentration of 1.56×10 9copies / μL of plasmid as RPA amplification template, and the reaction was terminated after 25 min at 25℃. The RPA products were detected by 1% AGE and LFD verification method. Figure 5 As shown in A-B, the sensitivities of RPA basic and RPA-LFD to template plasmid were both 1.56×10 1 copies / μL, and the test method still had good sensitivity compared with the existing PCR, fluorescent quantitative PCR and other detection methods for Salmonella.

[0074] Specificity test

[0075] The reaction formula and parameters of RPA basic and RPA-LFD were referred to the sensitivity test, and the DNA templates were extracted from Pasteurella multocida, Escherichia coli, Listeria, Staphylococcus aureus and Pseudomonas aeruginosa, respectively. After termination, 1% AGE and LFD verification method were used to verify the specificity, respectively.

[0076] The experimental results showed that the specificity test was carried out at 25℃ for 25 min, as shown in Figure 6 A-B, RPA basic and RPA-LFD did not amplify the genomic DNA of Pasteurella multocida, Escherichia coli, Listeria, Staphylococcus aureus and Pseudomonas aeruginosa, and the amplification of the negative control was negative, which was ideal in specificity.

[0077] Repeatability test

[0078] The reaction formula and parameters of RPA basic and RPA-LFD were referred to the sensitivity test, and 1.56×10 6 copies / μL, 1.56×10 4 copies / μL and 1.56×10 2 copies / μL of plasmid were used as templates, respectively, and three groups of repeated amplification tests were carried out at the same time, and the amplification results were verified by 1% AGE and LFD after termination.

[0079] The experimental results showed that, as shown in Figure 7 A-B, under the condition of 25℃ for 25 min, 1.56×10 6 , 1.56×10 4 and 1.56×10 2 copies / μL were used as templates, and RPA basic and RPA-LFD tests were repeated for three times, respectively. The results showed that the detection results of repeated tests for the same template were basically consistent, which showed good repeatability.

[0080] Clinical sample detection

[0081] Ten samples of chicken feces suspected to be infected with Salmonella from chicken farms in Qiqihar were collected, and genomic DNA was extracted as a template for detection using RPA basic and RPA-LFD methods. Meanwhile, the samples were detected using the PCR detection method for the fimY gene (526 bp) of Salmonella established by Yeh et al. The consistency of the detection results of the new method and the control method was compared to evaluate the applicability of the new method in the detection of Salmonella pathogens.

[0082] The experimental results show that the clinical samples were detected using RPA basic and RPA-LFD methods, and the existing PCR detection method for the fimY gene of Salmonella was used as a comparison. As shown in Figs. A-C, the coincidence rates of RPA basic, RPA-LFD and conventional PCR on positive and negative samples were all 100%, indicating that the fimY gene RPA rapid detection method established in the application is equivalent to the conventional molecular detection method in effect, but RPA has obvious advantages in simplicity and on-site application. Figure 8 A-C, the coincidence rates of RPA basic, RPA-LFD and conventional PCR on positive and negative samples were all 100%, indicating that the fimY gene RPA rapid detection method established in the application is equivalent to the conventional molecular detection method in effect, but RPA has obvious advantages in simplicity and on-site application.

[0083] The above description of disclosed embodiments enables one of ordinary skill in the art to make or use the application. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein can be applied to other embodiments without departing from the spirit or scope of the application. Thus, the present application is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A primer combination for detecting Salmonella, characterized in that: The primers are, Upstream primer fimY-RPA-F3: AAAACGTACCGCAGCATTCCGCTCATTAGA TG, sequence shown in SEQ ID No: 7; Downstream primer fimY-RPA-R3: CGATAAGCGAGGTTTGGAGGCTGATAACA AGG, the sequence of which is shown in SEQ ID No:

8.

2. The Salmonella detection primer combination according to claim 1, characterized in that, The primers also include: Upstream primer fimY-LFD-F: GAAGCCTTGTTATCAGCC, sequence shown in SEQ ID No: 9; Downstream primer fimY-LFD-R: BIOTIN-TGATAAGGTACGCTTTGCT, sequence shown in SEQ ID No: 10; Probe fimY-LFD-Probe: FAM-GCCTCCAAACCTCGCTTATCGGAAAGC T(THF)AGCCGTACTGACTGG-C3Spacer, the sequence of which is shown in SEQ ID No:

11.

3. A method for detecting Salmonella, characterized in that: The following steps are involved: (1) Prepare 50 μL RPA reaction system: 29.5 μL Rehydration Buffer, 2.4 μL (10 μmol / L) of the upstream primer fimY-RPA-F3 and the downstream primer fimY-RPA-R3 described in claim 1, 2 μL of template DNA, and 11.2 μL of ddH2O; the negative control is ddH2O; after premixing, transfer to the lyophilized enzyme reaction tube and completely dissolve the lyophilized powder. Before the start of the experiment, add 2.5 μL of MgoAc (280 nm / L), mix well, centrifuge, and place in a 20-30°C water bath for reaction for 20-30 min; (2) After amplification, the reaction was quickly transferred to a low-temperature reactor to terminate the reaction. The product was purified and recovered using a kit and then detected using 1% AGE. (3) Result judgment: If the 1% AGE test result shows an amplified band of about 300 bp, the result is positive; if there is no band, the result is negative.

4. A method for detecting Salmonella, characterized in that: The following steps are involved: (1) Prepare 50 μL RPA-LFD reaction system: 1 μL of Nfo enzyme, 5 μL of Nfo digestion buffer, 0.6 μL (10 μmol / L) of the probe fimY-LFD-Probe described in claim 2, 2.4 μL (10 μmol / L) each of the upstream primer fimY-LFD-F and the downstream primer fimY-LFD-R described in claim 2, 2 μL of template DNA, and ddH2O to make up to 50 μL; negative control is ddH2O; after premixing, transfer to the lyophilized enzyme reaction tube and completely dissolve the lyophilized powder. Before the start of the experiment, add 2.5 μL of MgoAc (280 nm / L), mix well, centrifuge, and place in a 20-30°C water bath for reaction for 20-30 minutes; (2) After amplification, quickly transfer to a low-temperature termination reaction, mix 20 μL RPA amplification product with 80 μL LFD buffer, and place the pipette tip into the mixed reaction system by holding the bottom pad of the test strip; (3) Result determination: If both the test line and the quality control line show color, it is positive; if only the quality control line shows color, it is negative; if the quality control line does not show color, the test is invalid.

5. The detection method according to claim 3 or 4, characterized in that The reaction temperature in step (1) is preferably 25°C.

6. The detection method according to claim 3 or 4, characterized in that The reaction time of step (1) is preferably 25 min.

Images