Chimeric antigen receptor (CAR) targeting human epstein-barr virus, CAR-NK cells and uses thereof
By designing a chimeric antigen receptor CAR targeting EBV and transducing it into NK cells, the problem of insufficient efficacy of existing EBV epithelial cell therapies has been solved, achieving highly efficient killing and immune enhancement against EBV-infected nasopharyngeal carcinoma and B-cell lymphoma.
Patent Information
- Application Number
- CN202510471566.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-15
- Publication Date
- 2026-05-08
- Estimated Expiration
- 2045-04-15
AI Technical Summary
Existing technologies for epithelial cell therapy targeting EBV infection have insufficient targeting efficacy, especially for EBV-related epithelial cell malignancies. Furthermore, most treatments only target the gp350 protein, and there are no reports of cell therapies targeting the EBV glycoprotein gH/gL.
A chimeric antigen receptor (CAR) targeting human Epstein-Barr virus (EBV) was designed, comprising a single-chain antibody against EBV gH/gL, a transmembrane region, and an intracellular signal transduction region, and further comprising IL-15/IL-15Rα cytokines. CAR-NK cells targeting human EBV were prepared by transducing NK cells via a retroviral vector.
CAR-NK cells can efficiently recognize and kill EBV-infected nasopharyngeal carcinoma and B-cell lymphoma, enhancing the therapeutic effect. They also express the IL-15/IL-15Rα fusion protein gene, which improves the killing ability of NK cells, generates a long-lasting immune response, and has no serious toxic side effects.
Smart Images

Figure HDA0005360114080000011 
Figure HDA0005360114080000012 
Figure HDA0005360114080000021
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology engineering, and more specifically, to a chimeric antigen receptor CAR targeting human EB virus, CAR-NK cells, and their uses. Background Technology
[0002] Epstein-Barr Virus (EBV) belongs to the herpesvirus family and is highly contagious. Primary EBV infection can cause glandular fever, but unlike other viruses, EBV is not cleared by the body's immune system after primary infection and remains a lifelong carrier. Under certain conditions, infected EBV can be activated and cause cancer. EBV is a DNA oncogenic virus belonging to the lymphotropic virus genus. Latent infection is the most common mode of transmission, with over 90% of EBV infections remaining latent for life. The prognosis is generally good, but in immunocompromised individuals, EBV infection can be life-threatening. EBV can infect epithelial cells and B cells. Although the proportion of cancers directly caused by EBV is low, due to the high infection rate, EBV infection is associated with 200,000 new cancer cases and 140,000 cancer deaths worldwide each year. Epithelial cell malignancies are the most common EBV-related cancers, including gastric cancer and nasopharyngeal carcinoma. EBV is also associated with Burkitt's lymphoma and Hodgkin's lymphoma.
[0003] EBV is an enveloped virus that infects cells through complete fusion of its exposed membrane proteins with the host cell membrane. The membrane proteins involved include the fusion-promoting protein gB, as well as accessory proteins such as gp350, gp42, and gH / gL, which interact directly or indirectly with host cell receptors. EBV entry into B cells is initiated by the binding of the glycoprotein gp350 to complement receptor 2 (CR2-Fc). The viral glycoprotein complex, composed of gH, gL, and gp42, activates gB and promotes viral-B cell membrane fusion via gp42 binding to human leukocyte antigen (HLA) class II molecules. Both gH and gp42 are essential for viral-B cell fusion. Epithelial cell infection is caused by EBV BMRF2 binding to integrins, gH / gL binding to integrins and hepatocyte ligand receptor A2, followed by gB activation to promote virus-cell membrane fusion. The glycoproteins gH / gL and gB constitute the core fusion mechanism of the virus and are conserved across all herpesviruses.
[0004] Currently, most serum neutralizing antibodies that block B-cell infection target gp350. Almost all clinical trials for the treatment of EBV infection use gp350 as the sole immunogen. For example, Chinese patent 202111646561.5 provides a neutralizing monoclonal antibody that can recognize the EBV gp350 protein with high affinity. This antibody can block the binding of the gp350 protein to its ligand CR2.
[0005] Although epithelial cell infection plays an important role in the EBV lifecycle and EBV-associated epithelial cell malignancies are more common than B-cell carcinomas, there are no reports of therapeutic efficacy of cell therapies targeting EBV glycoproteins (such as gH / gL) that target viral infection in B cells and epithelial cells. Summary of the Invention
[0006] Therefore, it is necessary to address the above-mentioned technical problems by providing a chimeric antigen receptor CAR targeting human EB virus, CAR-NK cells, and their applications.
[0007] To address the aforementioned technical problems, the first aspect of this invention proposes a chimeric antigen receptor (CAR) targeting human Epstein-Barr virus (EBV), comprising the following structure: a gH / gL single-chain antibody against EBV, a transmembrane region, and an intracellular signal transduction region.
[0008] Furthermore, the gH / gL single-chain antibody against EB virus contains the amino acid sequences of SEQ ID No:2 and SEQ ID No:3.
[0009] Furthermore, the chimeric antigen receptor CAR targeting human EB virus also includes the IL-15 / IL-15Rα cytokine, which contains the amino acid sequence SEQ ID No:1.
[0010] Furthermore, the transmembrane region is CD8™, and the intracellular signal transduction region is the co-stimulatory signaling domain CD137 of 4-1BB and the signaling domain CD247 of the human CD3 complex ζ chain.
[0011] Furthermore, the chimeric antigen receptor CAR targeting human EB virus also includes a hinge domain located between the single-chain antibody and the transmembrane region.
[0012] Furthermore, the chimeric antigen receptor CAR targeting human EB virus is composed of the following structures in tandem: signal peptide CD8 (SP), gH / gL single-chain antibody against EB virus, hinge domain, transmembrane region, intracellular signal transduction region, and IL-15 / IL-15Rα.
[0013] A second aspect of the present invention provides a CAR-NK cell targeting human EB virus, which is prepared from any of the chimeric antigen receptor CAR transduced NK cells targeting human EB virus.
[0014] Furthermore, the NK cells are obtained from umbilical cord blood.
[0015] The third aspect of this invention proposes a method for preparing CAR-NK cells targeting human EB virus, comprising: S1, constructing a retroviral vector containing a chimeric antigen receptor CAR; S2, retroviral packaging; S3, collecting umbilical cord blood to separate and purify NK cells, then activating the NK cells, obtaining NK cells by enrichment, culturing and activating them with factors CD16, OKE432 and IL15 at a certain concentration, and performing CAR gene transduction viral infection on the 4th day after activation; S4, collecting the activated NK cells after viral infection.
[0016] The fourth aspect of this invention discloses the use of the CAR-NK cells targeting human EB virus in the preparation of medicaments for treating human EB virus infection.
[0017] Compared with the prior art, the present invention has the following beneficial effects:
[0018] The CAR-NK cells targeting human EBV proposed in this invention utilize the broad-spectrum and highly efficient killing activity of NK cells. Their inherent cytotoxic activity can be activated through a non-CAR-dependent mechanism, and combined with CAR molecules, they efficiently recognize and kill EBV-infected nasopharyngeal carcinoma and B-lymphoma through antigen-antibody interaction, effectively killing tumor cells and enhancing therapeutic efficacy. Furthermore, the co-expression of the IL-15 / IL-15Rα fusion protein gene promotes IL-15 secretion by NK cells and increases IL-15 activity, significantly enhancing the killing ability of CAR-NK cells against EBV-infected nasopharyngeal carcinoma and B-lymphoma. This results in a sustained immune response without serious toxic side effects, helping to prevent tumor recurrence. Attached Figure Description
[0019] To more clearly illustrate the solutions in this application or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this application. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0020] Figure 1 The structures of the EBV gH / gL scfv CAR molecule and the IL-15 / IL-15Rα fusion protein in Example 1 of this invention are shown.
[0021] Figure 2 The expression results of EBV gH / gL protein in HK and B-LCL cells in Example 2 of this invention;
[0022] Figure 3The present invention uses flow cytometry to detect the expression rate of EBV gH / gL scfv and EBV gH / gL scfv CAR molecules that co-express IL-15 / IL-15Rα fusion protein;
[0023] Figure 4A This is a comparison of the killing effects of the NT group, G group, and G15 group on HK-1 cells after 14 days of culture in Example 5 of the present invention.
[0024] Figure 4B This is a comparison of the killing effects of the NT group, G group, and G15 group on HK-1 cells after 21 days of culture in Example 5 of the present invention.
[0025] Figure 5A This is a comparison of the killing effects of the NT group, G group, and G15 group on B-LCL cells after 14 days of culture in Example 5 of the present invention.
[0026] Figure 5B This is a comparison of the killing effects of the NT group, G group, and G15 group on B-LCL cells after 21 days of culture in Example 5 of the present invention.
[0027] Figure 6A The results of detecting TNF-α expression using the intracellular staining method for nasopharyngeal carcinoma cells in Example 6 of this invention;
[0028] Figure 6B The results of detecting IFN-γ expression using the intracellular staining method for nasopharyngeal carcinoma cells in Example 6 of this invention;
[0029] Figure 6C The results of detecting CD107a expression using the intracellular staining method for nasopharyngeal carcinoma cells in Example 6 of this invention;
[0030] Figure 6D The results of detecting Granzyme B expression using the intracellular staining method for nasopharyngeal carcinoma cells in Example 6 of this invention;
[0031] Figure 7A The results of detecting TNF-α expression using the intracellular staining method for lymphoma cells in Example 6 of this invention;
[0032] Figure 7B The results of detecting IFN-γ expression using the intracellular staining method for lymphoma cells in Example 6 of this invention;
[0033] Figure 7C The expression results of CD107a were detected by the intracellular staining method for cell lymphoma in Example 6 of the present invention.
[0034] Figure 7D The expression results of Granzyme B were detected by the intracellular staining method for cell lymphoma in Example 6 of this invention.
[0035] Figure 8 The results of tumor volume detection in the HK-1Luc animal model in Example 7 of this invention;
[0036] Figure 9 The results show the detection of the CD19+ ratio in the peripheral blood of the B-cell lymphoma animal model in Example 7 of this invention. Detailed Implementation
[0037] To enable those skilled in the art to better understand the present invention, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.
[0038] To enable those skilled in the art to better understand the present application, the technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the accompanying drawings.
[0039] Example 1: Structure of a chimeric antigen receptor CAR molecule targeting human EB virus
[0040] 1. The IL-15 / IL-15Rα fusion protein is composed of the following structures in series: human IL15 (IL15 for short), linker peptide (linker for short), and human IL15Rα (IL15Rα for short);
[0041] 2. For example Figure 1 As shown, the CAR molecule of G(gH / gL scfv) is composed of the following structures in tandem: signal peptide CD8αsignal peptide [abbreviated as CD8(SP)], gH / gL single-chain antibody against EB virus, CD8 hinge region (CD8 hinge) and transmembrane domain (CD8 TM), co-stimulatory signal domain CD137 of 4-1BB [abbreviated as 4 1BB(ID)], signal domain CD247 (abbreviated as CD3ζ) of human CD3 complex ζ chain, linked to red fluorescent protein (abbreviated as mCherry) through cleavage site T2A (abbreviated as T2A), and the gH / gL single-chain antibody against EB virus is composed of gH / gL scfv-VH, linker, and gH / gL scfv-VL in tandem.
[0042] 3. For example Figure 1As shown, the CAR molecule structure of G15(gH / gL scfv IL-15 / IL-15Rα) adds the IL-15 / IL-15Rα sequence to the gH / gL scfv CAR molecule. It is linked to the gH / gL scfv CAR through the P2A ribosomal jumping sequence with furin cleavage site (P2A for short). The IL-15 / IL-15Rα sequence is then linked to red fluorescent protein (mCherry) through the cleavage site T2A (T2A for short).
[0043] Table 1: Amino acid sequences of related structures
[0044] amino acid sequence name amino acid sequence number IL-15 / IL-15Rα SEQ ID No:1 gH / gL scfv-VH SEQ ID No:2 gH / gL scfv-VL SEQ ID No:3 CD8 hinge-TM-41BB-CD3Z SEQ ID No:4 mCherry SEQ ID No:5
[0045] Example 2 Identification of Target Cells
[0046] 1. Culture target cells
[0047] 1.1 Luciferase-expressing nasopharyngeal carcinoma HK cell line: HK-1Luc (1640 medium + 10% fetal bovine serum + 100 U / ml penicillin + 100 μg / ml streptomycin).
[0048] 1.2 Luciferase-expressing lymphocytic tumor cell line: B-LCL Luc (1640 medium + 10% fetal bovine serum + 100 U / ml penicillin + 100 μg / ml streptomycin).
[0049] 2. Identification of EBV gH / gL expression in HK-1 and B-LCL target cells
[0050] 2.1 DNA was extracted from HK and B-LCL cells using an omega DNA extraction kit and amplified by PCR. The primers used were: gH-qF upstream primer 5'-3' (SEQ ID No:6): ATACTCGAGAT GCAGTTGCTCTGTG; gH-qR downstream primer 5'-3' (SEQ ID No:7): CCCAAGCTTG AGTGTGCTCTTTCTTCATCA; gL-qF upstream primer 5'-3' (SEQ ID No:8): CCCAA GCTTATGCGTGCTGTTGGTGTATT; gL-qR downstream primer 5'-3' (SEQ ID No:9): CCCTCTAGACTAGCCCCCGCGATGCC. Table 2 shows the components and volumes of the PCR reaction solution.
[0051] Table 2: Concentration and Volume of Components in PCR Reaction Solution
[0052] Reagent Name Volume (μL) Cellular DNA 5 upstream primer 1 Downstream primer 1 dNTP Mixture (2.5mM) 2 5×PrimeSTAR GXL Buffer 4 PrimeSTAR GXL DNA Polymerase 1 <![CDATA[Dnase Free H2O]]> 6 Total 20μL
[0053] 2.2 All PCR amplification products were identified by agarose gel electrophoresis, and the results are as follows: Figure 2 The images shown from left to right are HK-1(gH), HK-1(gL), B-LCL(gH), B-LCL(gL), HK-1(GAPDH), B-LCL(GAPDH), blank group, and DL2,000 DNA marker. The electrophoresis results are consistent with those of gH (2118bp), gL (411bp), and GAPDH (111bp).
[0054] Example 3: Preparation of Retroviruses
[0055] Retroviruses were prepared by co-transfecting 293T / 17 cells with SFG-gH / gL CAR and SFG-IL-15 / IL-15Rα-gH / gL CAR-NK target plasmids with pRDF (env) and pEQ-PAM3(-E) (gag-pol) (packaging plasmids).
[0056] 1. Prepare 293T / 17 cells: Thaw one tube of frozen 293T / 17 cells at 37°C and seed them into two 10cm cells. 2 Cell culture dishes, seeding density approximately 2 × 10⁶ 6 Cells per dish, replenished with 10 mL of whole culture per dish; change the medium on the second day, and after the cells are stable, passage 293T17. On the sixth day, when passaged, plate the cells into 10 cm dishes for retrovirus packaging, 2–4 × 10⁻⁴. 6 293T / 17 (10 mL) was inoculated into a 10 cm dish, and plasmid transfection was performed 12–16 h after inoculation.
[0057] 2. Retroviral plasmid transfection of 293T / 17
[0058] 2.1 Use the Lipofectamine 3000 transfection kit to transfect plasmids. Prepare the Lipofectamine 3000 mix according to the instructions, and then prepare the plasmid mixture DNA Master Mix in the order shown in Table 3.
[0059] Table 3: DNA Master Mix
[0060] Reagent Name Required amount per serving Opti-MEM 1mL P3000Regent 30μL SFG vector plasmid 3.75μg pRDF 2.5μg pEQ-PAM3(-E) 3.75μg
[0061] 2.2 SFG vector plasmids include SFG-gH / gL scfv CAR, SFG-IL-15 / IL-15Rα-gH / gL scfv CAR and SFG.CNb30_opt.IRES (empty control); gH / gL CAR is labeled G and IL-15 / IL-15Rα-gH / gL CAR is labeled G15.
[0062] 2.3 After incubating Lipofectamine 3000mix and DNA Master Mix at room temperature for 5 min, Lipofectamine 3000mix was added dropwise to DNA Master Mix and incubated at room temperature for 20 min. The incubated DNA-liposome mixture was then added dropwise to a 293T / 17 culture dish and gently mixed in a cross shape. GFP fluorescence was observed under a fluorescence microscope 48 and 72 h after transfection. The virus was collected, filtered through a 0.45 μm needle filter, and stored at -80℃ for later use.
[0063] Example 4: Preparation and Detection of CAR-NK Cells
[0064] 1. Isolation and purification of NK cells
[0065] Umbilical cord blood was collected from healthy pregnant women. After centrifugation at 300g for 10 minutes, the supernatant plasma was collected, and the lower cell layer was diluted 1:1 with PBS. The cells were gently pipetted, and 1.5 ml of Purification Factor Cocktail was added. The mixture was gently mixed and incubated at room temperature for 20 minutes. The cells were then resuspended in an equal volume of PBS and gently mixed. In a separate 50 ml centrifuge tube, 15 ml of Ficoll solution was added to each tube. The umbilical cord blood was carefully added to the Ficoll solution at a 2:1 ratio. The tubes were centrifuged at 1200g for 20 minutes. After centrifugation, the white membrane layer was collected, washed twice with at least 5 volumes of PBS, centrifuged at 100g for 10 minutes, and the supernatant was discarded. AO / PI counts were performed, and the CD3 / CD56 ratio was detected by flow cytometry.
[0066] 2. Activation of NK cells
[0067] NK cell activating factor OKE432, CD16, and IL15 were added at a certain concentration, 1 ml per well, to coat a treated tissue culture 24-well plate. The plate was incubated at 4°C for at least 16 hours. 3 x 10⁻⁶ ions were added to each well. 6 NK cells.
[0068] 3. Retroviral infection of NK cells
[0069] 3.1 Prepare the appropriate volume of RetroNectin solution with PBS to coat the 24-well plate. Prepare PBS and RetroNectin according to the instructions. Seal the edges of the wells with Parafilm and coat overnight at 4°C.
[0070] 3.2 On the fourth day of NK cell activation, CAR gene transduction was performed. Viral fluid was coated onto the cells, removed 12 hours prior to activation, thawed at 4°C, and RetroNectin solution was recovered. 2 mL of viral fluid was added to each well, gently adhering to the cell wall. The cells were sealed with parafilm, centrifuged at 2000g for 60 min, and then re-accumulated. Activated NK cells were harvested at 0.2–0.3 × 10⁻⁶ cells / well. 6 2 ml of NK cells were added to each well at a concentration of [number] cells / mL, and the cells were incubated at 1000 g for 10 min at 37°C in a 5% CO2 incubator. Cells were harvested 72 h after viral infection to detect the expression rate of CAR molecules. FlowJo software was used for analysis. The results are shown below. Figure 3 As shown, the expression rate of CAR molecules in the G15 group was approximately 77.8%, the expression rate of CAR molecules in the G group was approximately 90.1%, and the expression rate of CAR molecules in the Non-Transduced group (NT group) was 0.29%.
[0071] Example 5: Effectiveness-to-Target Kill Ratio Experiment
[0072] Target cells were seeded in 48-well plates, with HK-1Luc and B-LCL Luc at a ratio of 1*102. 5 / 500μL RPMI 1640 complete medium / per well, seeding plate; NT group, G group, and G15 group cells cultured for 14d and 21d respectively were added to 15ml centrifuge tubes at the corresponding effector-target ratios (1:1, 5:1, 10:1), centrifuged, and resuspended in 500μL NK cell culture medium and co-cultured with HK-1Luc and B-LCL Luc for 6h respectively.
[0073] Figure 4A and 4B The study showed the killing rate of HK-1Luc by three groups of NK cells. In the NT group, the killing rate of HK-1 was 8.91±1.12% at an effector-to-target ratio of 1:1. With increasing effector-to-target ratio, the killing efficiency stabilized at 26.92±9.07% (5:1) and 26.85±7.98% (10:1). The killing rates of HK-1 in the G and G15 groups were significantly higher than those in the NT group (P<0.05), achieving a killing rate of 70%–90% even at a low effector-to-target ratio (5:1). Figure 4A As shown, after 14 days of culture, NK cells transduced in groups G and G15 showed no significant difference in cytotoxicity when co-cultured with HK-1 (P > 0.05). However, with increasing NK cell culture time, as... Figure 4B As shown, at 21 days, the G15 group, which co-expressed the IL-15 / IL-15Rα fusion protein, unexpectedly showed a stronger killing effect on HK-1 cells than the corresponding second-generation CAR NK cell group G (P<0.01).
[0074] Figure 5A and 5BThe killing rates of three groups of NK cells and B-LCL are shown, such as... Figure 5A As shown, the killing rate of B-LCL in group G was 34.25±5.73% at an effector-to-target ratio of 1:1. With increasing effector-to-target ratio, the killing efficiency remained stable at 62.3±8.06% (5:1) and 68.3±11.64% (10:1), which was higher than that in group NT (P<0.05). The killing effect of group G weakened with increasing NK cell culture time, but unexpectedly, as... Figure 5B As shown, at day 21 of NK cell culture, the G15 group, which co-expressed the IL-15 / IL-15Rα fusion protein, still maintained a relatively strong killing effect, significantly stronger than the corresponding second-generation CAR NK cells (P<0.05).
[0075] Example 6 Intracellular factor ICS detection
[0076] The expression of CD107a, IFN-γ, TNFα, IL-2 and Granzyme B cytokines was detected by ICS when NK cells were co-cultured with HK-1Luc and B-LCL Luc to explore the activity and specificity of their cytokine immune responses.
[0077] 1. Co-culture of target cells: Count the target cells, resuspend them in NK cell culture medium, and culture at a concentration of 1×10⁻⁶ cells / mL. 5 Cells were seeded in 96-well U-bottom plates at a ratio of 100 μL / well. Non-Transduced CAR-NK, G CAR-NK, and G15 CAR-NK were counted and seeded at an effector-to-target ratio of 5:1 (1 × 10⁵ cells / 100 μL / well). CD107aPE-Cy 7 flow cytometry antibody (1 μL / Test) and BFA solution (2 μL / Test) were added simultaneously. Cells were incubated in a 1:1000 Monensin solution at 37°C with 5% CO₂ for 12 h and then harvested for flow cytometry staining.
[0078] 2. Antibody incubation and flow cytometry detection
[0079] 2.1 After co-culturing for 12 hours, the U-shaped 96-well plate was centrifuged at 400g for 5 minutes at a flat angle. After centrifugation, the liquid in the well plate was gently shaken off, and the plate was gently tapped on a clean paper towel. Cell pellets were visible at the bottom after centrifugation.
[0080] 2.2 Add 250 μL of FACS buffer to each well and wash by centrifugation at 400 g for 5 min;
[0081] 2.3 To prepare LIVE / DEAD Fixable Dead Cell, add fluorescent dye reconstituted in DMSO to PBS, add 1 μL of dye to 999 μL of PBS at a ratio of 1:1000, add 100 μL of diluted dye solution to each sample, and incubate at 4°C in the dark for 30 min.
[0082] 2.4 Add 250 μL of PBS and wash once, 400 g * 5 min;
[0083] 2.5 Procedure for flow cytometry surface antibody staining: Take 2 μL of CD56 flow cytometry antibody and stain for 20 min, centrifuge at 400g for 5 min and discard the supernatant, then wash once with 250 μL of FACS buffer.
[0084] 2.6 Add 100 μL of BD Fixation / Permeabilization solution and resuspend, then fix at 4 °C for 20 min;
[0085] 2.7 Add 250 μL of 1×BD Perm / Wash buffer and centrifuge twice (400g*5min).
[0086] 2.8 Prepare cytokine antibody dilution buffer (50 μL BD Perm / Wash + 50 μL of Brilliant Stain Buffer, 1:1), 100 μL / Test, add 2 μL / Test of cytokine antibody (IFN-γPE, TNF-αBV510, Granzyme B PE-Texas Red), and incubate at 4℃ for 30 min;
[0087] 2.9 Wash twice with 250 μL 1×BD Perm / Wash buffer, and resuspend with 100 μL LFACS buffer before running.
[0088] 2.10 Under a 5:1 effector-to-target ratio, HK-1 and B-LCL were co-cultured. Figures 6A-6C and Figures 7A-7C As shown, compared with the NT group, the expression levels of TNF-α, IFN-γ, and CD107a were significantly increased in the G and G15 groups. Figure 6D and 7D As shown, the expression level of Granzyme B was significantly increased, with no difference in the NT group, G group and G15 group.
[0089] Example 6: In vivo tumor suppression experiment of CAR-NK cells
[0090] Using Saline, NT, G, and G15 groups as effector cells and HK 1Luc and B-LCL Luc as target cells, the inhibitory effects of NOD.Cg-Prkdcscid IL2rgtm1Wjl / SzJ(NSG) mice on subcutaneous transplantation of solid tumors and tail vein transplantation of hematologic malignancies were tested.
[0091] Twenty 6-8 week old NSG mice were used, and 3×10⁻⁶ NSG mice were subcutaneously injected into the abdomen. 6 HK-1Luc, until the average tumor volume grows to approximately 40 mm 3 Mice were randomly divided into Saline control group, NT control group, G control group, and G15 experimental group, and were injected with Saline (100 μl / mouse) or corresponding NK cells (2 × 10⁻⁶ cells / mouse) via tail vein, respectively. 7 (Number of mice / animal), with the day of injection of the test substance recorded as day 0 of treatment. Tumor volume and mouse weight were measured 4–5 times per week.
[0092] Twenty 6-8 week old NSG mice were used, and 1×10⁻⁶ NSG mice were injected into the tail vein. 6 100 B-LCL Luc. When the average proportion of B-LCL cells in the peripheral blood of mice reached 2%, the mice were randomly divided into Saline control group, NT control group, G control group, and G15 experimental group, and injected with Saline (100 μl / mouse) or corresponding NK cells (5 × 10⁶ cells / mouse) via the tail vein. 6 (Number of mice / animal), the day of injection of the test substance was recorded as day 0 of treatment. The proportion of peripheral blood B-LCL cells in mice was measured by flow cytometry three times a week.
[0093] like Figure 8 As shown, in the NSG mouse nasopharyngeal carcinoma subcutaneous model, the tumor volume of the G15 experimental group was 372±76 mm² 25 days after CAR NK cell infusion. 3 The tumor volume detected in group G was 654±53 mm. 3 The tumor volume was significantly smaller than that of the blank control group (tumor volume 1518±279 mm). 3 The results showed that the CAR molecules of gH / gL single-chain antibodies had the ability to target and recognize nasopharyngeal carcinoma cells, and the CAR-NK molecules co-expressing IL-15 / IL-15Rα fusion protein had a better ability to kill epithelial cell tumors.
[0094] like Figure 9As shown, in the NSG mouse B-lymphoma model, 25 days after CAR NK cell infusion, the proportion of peripheral blood B-LCL cells detected in the G15 experimental group was 8.84±1.06%, and the proportion of peripheral blood B-LCL cells detected in the G group was 10.3±0.75%, significantly lower than that in the control group (peripheral blood B-LCL cells were 14.86±1.51%). These results indicate that the CAR molecule containing the gH / gL single-chain antibody has the ability to target and recognize B-LCL cells, and the CAR-NK cell fusion protein expressing IL-15 / IL-15Rα has a superior ability to kill B-lymphocyte tumors.
[0095] Obviously, the embodiments described above are only some embodiments of this application, not all embodiments. The accompanying drawings show preferred embodiments of this application, but do not limit the patent scope of this application. This application can be implemented in many different forms; rather, the purpose of providing these embodiments is to provide a more thorough and comprehensive understanding of the disclosure of this application. Although this application has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing specific embodiments, or make equivalent substitutions for some of the technical features. Any equivalent structures made using the content of this application's specification and drawings, directly or indirectly applied to other related technical fields, are similarly within the scope of patent protection of this application.
Claims
1. A chimeric antigen receptor (CAR) targeting human EB virus, characterized in that, The CAR is selected from any of the following: (1) A chimeric antigen receptor consisting of the following structures in series: a signal peptide, a gH / gL single-chain antibody against EB virus, a hinge domain, a transmembrane region and an intracellular signal transduction region; wherein the gH / gL single-chain antibody against EB virus is composed of VH shown in SEQ ID NO:2, a linker peptide and VL shown in SEQ ID NO:3 in series. (2) Based on the chimeric antigen receptor described in (1), it further includes IL-15 / IL-15Rα cytokines, and the amino acid sequence of the IL-15 / IL-15Rα cytokines is shown in SEQ ID NO:
1.
2. The chimeric antigen receptor CAR targeting human EB virus according to claim 1, characterized in that, The transmembrane region is CD8™, and the intracellular signal transduction region is the co-stimulatory signaling domain CD137 of 4-1BB and the signaling domain CD247 of the human CD3 complex ζ chain.
3. The chimeric antigen receptor CAR targeting human EB virus according to claim 1, characterized in that, The amino acid sequences of the hinge domain, transmembrane region, and intracellular signal transduction region are shown in SEQ ID NO:
4.
4. A CAR-NK cell targeting human EB virus, characterized in that, It is prepared from chimeric antigen receptor CAR transduced NK cells targeting human EB virus as described in any one of claims 1 to 3.
5. The CAR-NK cells according to claim 4, characterized in that, The NK cells were obtained from umbilical cord blood.
6. The CAR-NK cells targeting human EB virus according to claim 5, characterized in that, The preparation method includes: S1, constructing a retroviral vector containing a chimeric antigen receptor (CAR); S2, packaging the retrovirus; S3, collecting umbilical cord blood to separate and purify NK cells, then activating the NK cells, obtaining NK cells using an enrichment method, co-culturing and activating them with factors CD16, OKE432 and IL15, and performing CAR gene transduction virus infection on the 4th day after activation; S4, collecting the activated NK cells after viral infection.
7. Use of the CAR-NK cells targeting human EB virus according to any one of claims 4 to 5 in the preparation of a medicament for treating human EB virus infection.
Citation Information
Patent Citations
A neutralizing antibody against Epstein-Barr virus and its application
CN114409766B
Super humanized antibodies
US20030039649A1
Recombinant modified vaccinia virus ankara (MVA) filovirus vaccine
US20170304427A1