Optogenetics tool for light-operated induced protein degradation as well as construction method and application of optogenetics tool

Abstract

The invention relates to the field of optogenetics, in particular to an optogenetics tool for light-operated induced protein degradation and a construction method and application of the optogenetics tool. The invention relates to an optogenetics tool for light-operated induced protein degradation, which is characterized by comprising a fusion system of a truncated body mTRIM211-80 of mTRIM21 and CRY2, the base sequence of the mTRIM211-80 is as shown in SEQ ID NO. 1 (sequence identifier number 1); the base sequence of the CRY2 is as shown in SEQ ID NO. 2. The optogenetics tool is used for inducing the TRIM21 to form a polymer by utilizing the blue light photosensitive protein CRY2 and is used for the targeted regulation and control of the protein degradation under the driving of the blue light. Targeted degradation of protein can be achieved by utilizing Intrabody (intracellular antibody), time and space targeting is achieved, and after an optogenetics toolbox is optimized, the sensitivity and the reaction rate of the optogenetics toolbox are further improved.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of optogenetics, and relates to an optogenetic tool for light-controlled induction of protein degradation and a construction method and application thereof, in particular to an optogenetic tool for blue light-driven targeted regulation of protein degradation by utilizing blue light-sensitive protein CRY2 to induce TRIM21 to form a multimer and utilizing intracellular antibody Intrabody. BACKGROUND

[0002] Protein homeostasis is a necessary condition for the normal functioning of cellular proteins. The accumulation of abnormal proteins (such as damaged, misfolded or aggregated proteins) is associated with many diseases, including cancer. Therefore, rapid and controllable targeted degradation of misfolded proteins to maintain protein homeostasis is crucial for cell function and overall health.

[0003] Currently, genetic methods for regulating protein balance at the DNA and RNA levels, such as 1) CRISPR system, at the genomic DNA level, by interfering with the corresponding gene, to achieve knock-out of the target protein. 2) Using siRNA or shRNA to silence mRNA and other technologies have been proven to be able to effectively regulate protein expression levels. However, these methods lack spatiotemporal specificity, permanently knock out or knock down protein expression at the gene level, and are not suitable for degrading synthesized proteins. In addition, proteolysis targeting chimera (PROTACs) and molecular glue target and degrade proteins through the ubiquitin proteasome system (UPS). Although they have certain potential, these methods also face challenges in the design and development of new drugs, including lack of spatiotemporal specificity, difficulty in screening design, etc.

[0004] The ubiquitin-proteasome pathway is an important system for regulating protein levels in the body. TRIM21 (Tripartite motif containing 21) as a member of the E3 ubiquitin ligase RING family contains several key domains: RING domain, promotes ubiquitin ligase activity and mediates substrate protein ubiquitination; B-box domain, involved in dimerization and multimerization with other TRIM family members or itself; coiled-coil domain, allowing TRIM21 to form homodimers or multimers; PRYSPRY domain, providing antibody binding ability Figure 1 A).

[0005] The development of optogenetic technology makes it possible to regulate targeted degradation of proteins in the body. CRY2 is a light-sensitive protein with a maximum absorption peak at a wavelength of ~470 nm blue light, and TRIM21 functions as an E3 ubiquitin ligase in the ubiquitin-proteasome pathway. SUMMARY

[0006] In response to the current problems of rapid protein degradation to maintain protein homeostasis, such as poor protein targeting, unsatisfactory sensitivity and reaction rate, in order to achieve rapid, reversible and spatiotemporal precise degradation of misfolded proteins, we have developed a degradation system that combines the ubiquitin-proteasome system with optogenetics, and allows light-regulated targeted protein degradation with temporal and spatial precision.

[0007] This application constructed TRIM21 truncations of different lengths, retaining the complete N-terminal RING domain and a small amount of α-helix, and used the optogenetic protein CRY2 to simulate TRIM21 multimerization. In order to improve the efficiency of light-induced protein degradation, the effects of different CRY2 photosensitive mutants on the system were studied. After screening, mCherry-CRY2 PHR Clust-mTRIM21(1-80) is defined as a Flash-Away system for light-controlled protein degradation, and uses intracellular antibodies (including: Monobody antibodies, Nanobody antibodies, Binder peptides (pDI, LCB3)) to specifically target the corresponding proteins, thereby realizing a specific targeted light-regulated degradation system for the target protein.

[0008] The technical solutions of the present invention are as follows:

[0009] In the first aspect, the present application provides an optogenetic tool for light-induced protein degradation, including a truncated form of mTRIM21 1-80 , CRY2's fusion system;

[0010] mTRIM21 1-80 The base sequence is shown in SEQ ID NO.1;

[0011] The base sequence of CRY2 is shown in SEQ ID NO.2.

[0012] As a specific embodiment of the present application, the CRY2 includes CRY2 mutant E490G, CRY2 mutant E490R, and CRY2 mutant CRY2-Clust;

[0013] The base sequence of the CRY2 mutant E490G is shown in SEQ ID NO.3;

[0014] The base sequence of the CRY2 mutant E490R is shown in SEQ ID NO.4;

[0015] The base sequence of the CRY2 mutant CRY2-Clust is shown in SEQ ID NO.5.

[0016] As a specific embodiment of the present application, the CRY2 is a CRY2 mutant CRY2-Clust.

[0017] As a specific embodiment of the present application, the protein degraded by the optogenetic tool includes at least one of MLKL, Actin, a fusion protein with an ALFA tag, MDM2 and a Spike protein.

[0018] In a second aspect, the present application provides a method for constructing the above-mentioned optogenetic tool, comprising the following steps:

[0019] (1) mTRIM21 1-80 Fusion system with a light-sensitive protein CRY2;

[0020] (2) Construct a targeted protein degradation system using an intracellular antibody Intrabody.

[0021] As a specific embodiment of the present application, the process of step (1) includes:

[0022] A1 Constructing a CRY2 PHR Inserting mCherry2-C1 into a mCherry-CRY2 PHR vector using a homologous recombination method; 1-80 Using pGEMHE-mCherry-mTRIM21 as a template to amplify mTRIM21 1-80 , and introducing NheI restriction sites, inserting mTRIM21 PHR into the mCherry-CRY2 1-80 vector through a single NheI enzyme site, to generate mTRIM21 PHR -mCherry-CRY2 1-80 ;

[0023] A2 Using pGEMHE-mCherry-mTRIM21 as a template to amplify mTRIM21 PHR , and introducing BspEI and BglII restriction sites, cutting the mCherry-CRY2 1-80 vector using BspEI and BamHI (BglII and BamHI are isocaudarneric enzymes), and inserting mTRIM21 PHR into the mCherry-CRY2 PHR , to generate mCherryCRY2 1-80 -mTRIM21 .

[0024] As a specific embodiment of the present application, the process of step (2) includes:

[0025] Intrabody was synthesized by gBlock to specifically recognize the protein to be degraded, and the above fragment was inserted into the fusion system of step (1) or mCh-CRY2 using the NheI enzyme cutting site PHR In the vector, a targeted degradation system is established.

[0026] In a third aspect, the application provides the application of the above-mentioned optogenetic tool or the above-mentioned method in specific targeted protein degradation.

[0027] As a specific embodiment of the application, an intracellular antibody Intrabody is used to target the degradation of the corresponding protein.

[0028] The intracellular antibody Intrabody includes one or more of Monobody antibodies, Nanobody antibodies, and Binder small peptides.

[0029] As a specific embodiment of the application, the degradation of the corresponding protein is detected by confocal time-lapse photography and Western Blot.

[0030] Advantages of the application

[0031] (1) The designed optogenetic toolbox integrates the light-responsive ubiquitination activity of the mTRIM21 ring domain (RING domain) for protein degradation, and further integrates specific in vivo precise targeting. After exposure to blue light, the optogenetic toolbox can quickly and specifically degrade selected proteins in terms of time and space.

[0032] (2) The optogenetic toolbox obtained by the application can be used for targeted degradation of proteins in vivo, has time and space targeting, and after optimization of the optogenetic toolbox, the sensitivity and reaction rate thereof are further increased.

[0033] (3) After screening, mCherry-CRY2 PHR Clust-mTRIM21(1-80) is defined as a Flash-Away system for light-controlled targeted protein degradation. Intracellular antibodies Intrabody (including Monobody antibodies, Nanobody antibodies, and Binder small peptides (pDI, LCB3)) are used to specifically target the corresponding protein, thereby realizing a light-regulated degradation system of specific target proteins. BRIEF DESCRIPTION OF DRAWINGS

[0034] Figure 1 For the construction of the light-controlled protein degradation system, (A) the structural characteristics of mTRIM21 (top row); mTRIM21 fragments and mCherry-CRY2 PHRSchematic of fusion constructs (lower row); (B-C) Time-lapse confocal imaging of HeLa cells expressing the indicated constructs upon blue light illumination; 488 nm confocal laser (output power 5%) was used for 2 hours with 30 seconds intervals; scale bar, 10 pm; (D) Data are presented as normalized fluorescence intensity and shown as mean ± s.e.m; Abbreviations: mCh, mCherry; BL, blue light;

[0035] Figure 2 Optimization of Flash-Away system; where (A) C-terminal amino acid sequences of CRY2-WT, CRY2-Oligo, CRY2-Plus and CRY2-Clust; (B) Time-lapse confocal imaging of HeLa cells overexpressing the corresponding plasmids upon 1 hour blue light illumination (488 nm confocal laser (output power 5%) was used with 30 seconds intervals); scale bar, 10 pm; (C) Data are plotted as normalized fluorescence intensity and shown as mean ± s.e.m; (D) Immunoblot analysis of HeLa cells expressing Flash-Away with or without MG132 treatment upon 1 hour blue light illumination; (E) Statistics of protein levels on immunoblot; ****P < 0.0001; ns P > 0.05; Abbreviations: mCh, mCherry; BL, blue light;

[0036] Figure 3 Construction of light-controlled protein targeted degradation system using monobody; where (A) Mb33 binds human MLKL (PDB ID: 6UX8) through an epitope centered on the a4 helix of the 4HB domain; (B) Confocal images of HeLa cells co-expressing Mb33-Flash-Away and MLKL-Venus before and after blue light illumination (blue light illumination condition: 470 nm, 488 nm confocal laser was used with output power 5% for 1 hour illumination with 30 seconds intervals); scale bar, 10 pm;

[0037] Figure 4To construct a light-controlled protein targeted degradation system using nanobody; (A) Schematic diagram of nanobody-based Flash-Away disrupting actin; (B) Confocal images of HeLa cells expressing Nb-Actin-Flash-Away and YFP-LifeAct before and after blue light irradiation (irradiation at 470 nm using 488 nm confocal laser, output power 5%, for 1 hour, interval 30 seconds); scale bar, 10 μm; (C) Phalloidin staining results of HeLa cells expressing NbActin-Flash-Away or corresponding control group (Nb-Actin-mCh-CRY2) before and after blue light irradiation (left confocal results, blue light irradiation conditions: 470 nm, using 488 nm confocal laser, output power 5%, irradiation for 1 hour, interval 30 seconds); scale bar: 10 μm; the right is the statistical result; (D) Transwell assay of HeLa cells expressing NbActin-Flash-Away or corresponding control group (Nb-Actin-mCh-CRY2) after blue light; (E) Schematic diagram of the binding of Nb-ALFA to ALFA tag (PDB ID of Nb-ALFA: 6I2G); (F) Mid-layer confocal images of HeLa cells co-expressing Nb-ALFA-Flash-Away and ALFA-YFP before and after blue light irradiation (blue light irradiation conditions: using 488 nm confocal laser, output power 5%, irradiation for 1 hour, interval 30 seconds); scale bar: 10 μm.

[0038] Figure 5 To construct a light-controlled protein targeted degradation system using Binder small peptide; (A) Three-dimensional structure of pDI peptide binding to MDM2 (PDB ID: 3JZO); (B) Confocal images of HeLa cells co-expressing GFP-Flash-Away-pDI and MDM2(1-118)-mCh before and after blue light irradiation; (C) Schematic diagram of SARS-CoV-2 Spike structure (top row); Three-dimensional structure of receptor binding domain (RBD) binding to human ACE2, in which the RBD core is slate gray, the binding interface is purple, and ACE2 is gray (PDB ID: 7U0N, bottom left); Cryo-EM structure of LCB3 (wheat color) binding to RBD (slate gray) (bottom right); (D) Confocal images of HeLa cells co-expressing LCB3-Flash-Away and YFP-RBD before and after blue light irradiation. (Blue light irradiation conditions: 470 nm, using 488 nm confocal laser, output power 5%, irradiation for 1 hour, interval 30 seconds); scale bar: 10 μm. DETAILED DESCRIPTION

[0039] EMBODIMENT 1

[0040] Blue light-induced photoreceptor CRY2 forms protein complex with truncated mTRIM21 Figure 1 A) According to the domain characteristics of mTRIM21, a series of truncated fragments of different lengths (mTRIM21-WT, mTRIM21 1-80 , mTRIM21 1-57 , mTRIM21 1-62 ) were constructed, in which mTRIM21 1-57 lacks 72 bases (AACCTCAGGCCCAATAGACATATAGCCAACATGGTGGAAAACCTTAAACAGATAGCCCAGAATACCAAGTAG) compared with mTRIM21 1-80 , mTRIM21 1-62 lacks 57 bases (AGACATATAGCCAACATGGTGGAAAACCTTAAACAGATAGCCCAGAATACCAAGTAG) compared with mTRIM21 1-80 , and the light-induced loop domain of mTRIM21 is aggregated to activate its E3 ligase activity.

[0041] Construction process of fusion system: Figure 1 A)

[0042] pGEMHE-mCherry-mTRIM21 (#105522, mouse TRIM21) and mCherry2-C1 (#54563) were obtained from Addgene. CRY2 PHR was inserted into mCherry2-C1 to construct mCherry-CRY2 PHR . The mTRIM21 fragments (WT, 1-80, 1-62, 1-57) were amplified using pGEMHE-mCherry-mTRIM21 as a template and NheI restriction sites were introduced, and the mTRIM21 fragments were inserted into mCherry-CRY2 PHR vector through NheI single enzyme cutting site, generating (mTRIM21-WT, 1-80, 1-62, 1-57)-mCherry-CRY2 PHR .

[0043] The mTRIM21 fragments (WT, 1-80, 1-62, 1-57) were amplified using pGEMHE-mCherry-mTRIM21 as a template and BspEI and BglII restriction sites were introduced, and mCherry-CRY2PHR The vector was digested (Note: BglII and BamHI are the same tail enzyme), and the mTRIM21 fragment was inserted into the mCherry-CRY2 PHR vector to generate mCherryCRY2 PHR -(mTRIM21-WT, 1-80, 1-62, 1-57).

[0044] After screening, mCherry-CRY2 PHR Clust-mTRIM21 (1-80) was defined as a Flash-Away system for light-controlled targeted protein degradation.

[0045] Using the light-gated protein CRY2 as a light switch to simulate the multimerization of TRIM21, the truncated body was initially placed in the light-sensitive protein CRY2 PHR N-terminal, after 2 hours of blue light irradiation, the fluorescence signal did not decrease significantly Figure 1 B, D), presumably due to the spatial hindrance of mCherry-CRY2 Figure 1 B). Later, the truncated body was moved to the C-terminal, and it was found that the C-terminal mTRIM21 1-80 The red fluorescence of the experimental group was significantly reduced after 2 hours of light irradiation, while other short truncated bodies did not have this phenomenon. It was speculated that the mTRIM21 1-80 fragment was placed at the C-terminal of CRY2 PHR C-terminal was effective Figure 1 C, D). This finding indicates that inducing the multimerization of the mTRIM21 RING domain mTRIM21 1-80 fragment can activate the E3 ligase activity, and subsequent experiments all use the mTRIM21 1-80 fragment.

[0046] Example 2 Degradation process

[0047] (1) HeLa cells were cultured in DMEM supplemented with 10% fetal bovine serum at 37°C in a 5% CO2 incubator.

[0048] (2) When the cells reached 70-80% density, transfection was performed using Lipofectamine 3000 (Invitrogen) according to the instructions. The steps are as follows:

[0049] Dilute the Lipofectamine TM 3000 reagent: prepare a sterile centrifuge tube, add an appropriate amount of Opti-MEM TM culture medium (serum-free) to the centrifuge tube, and add the corresponding amount of Lipofectamine TM 3000 reagent. Blow and suck several times with a pipette, mix thoroughly, and stand at room temperature for 5 minutes for standby.

[0050] Prepare DNAmaster mix: Take another sterile centrifuge tube, add the appropriate amount of Opti-MEM TM medium, add the DNA to be transfected according to the recommended ratio of DNA to P3000 TM reagent (usually 1 μg of DNA corresponds to 1-2 μL of P3000 TM reagent), and add P3000 TM reagent to the diluted DNA solution. Slowly blow and suck the mixture with a pipette for 5-10 times, mix thoroughly, and then stand at room temperature for 5 minutes to complete the preparation of the DNA master mix.

[0051] Mix DNA with Lipofectamine TM 3000 reagent: Add the diluted DNA solution prepared in step 2 to the diluted Lipofectamine TM 3000 reagent tube in step 1 according to a 1:1 volume ratio. Gently vortex the centrifuge tube to ensure uniform mixing.

[0052] Incubate: Incubate the mixed DNA-lipid complex solution at room temperature for 15-20 minutes to allow the liposome to fully bind with the DNA to form a stable complex.

[0053] Add cells: Slowly add the incubated DNA-lipid complex to the cell culture dish with a pipette to ensure uniform distribution of the complex. Continue to culture under normal cell culture conditions, and then observe the transfection effect or perform related detection according to experimental requirements.

[0054] (3) Incubate the cells in a 5% CO2 incubator at 37°C for 24 hours. Note that the plasmid transfection is performed 8 hours before the HeLa cells are changed.

[0055] (4) Observe the protein degradation under blue light irradiation.

[0056] Confocal time-lapse photography: Use a 488 nm confocal laser with a 5% output power, irradiate once every 30 seconds for 1 hour, and observe the corresponding protein degradation.

[0057] Western Blot: Use a 470 nm LED lamp (4 mW cm -2 ), irradiate once every 30 seconds for 1 hour, and detect the corresponding protein degradation using Western Blot.

[0058] Example 3

[0059] To improve the efficiency of light-induced protein degradation, the effect of CRY2 photosensitive mutants on the system was studied.

[0060] CRY2 mutants E490G and E490R (referred to as CRY2 Oligo and CRY2 Plus, respectively) and CRY2-Clust (containing an additional 9 amino acids ARDPPDLDN at the C-terminus) were constructed and the corresponding variants were selected to replace wild-type CRY2 as the activation switch Figure 2 A).

[0061] The base sequence of the CRY2 mutant E490G is shown as SEQ ID NO. 3;

[0062] The base sequence of the CRY2 mutant E490R is shown as SEQ ID NO. 4;

[0063] The base sequence of the CRY2 mutant CRY2-Clust is shown as SEQ ID NO. 5.

[0064] The wild-type CRY2 was replaced by CRY2 mutants E490G (CRY2 Oligo), E490R (CRY2 Plus) and CRY2-Clust (containing an additional 9 amino acids at the C-terminus) Figure 2 A) to construct fusion proteins and transfect HeLa cells. After blue light activation, each CRY2 variant completed dimerization and aggregation within 2 minutes, but the fluorescence reduction rates were different. The CRY2-Clust system could quickly reduce the red fluorescence level under blue light irradiation, with a half-life of 7.01 ± 0.05 minutes; the half-lives of CRY2 Oligo and CRY2 Plus were 28.65 ± 0.82 and 18.92 ± 0.33 minutes, respectively; the half-life of wild-type CRY2-WT was about 50.54 ± 1.39 minutes Figure 2 B, C). Based on the performance advantage, CRY2-Clust was selected as the light-controlled activation switch. Western Blot analysis showed that the Flash-Away-CRY2 PHR Clust protein level was significantly reduced after blue light irradiation, and the light-dependent Flash-Away-CRY2 PHR Clust system degradation was significantly inhibited after treatment with proteasome inhibitor (MG132) Figure 2 D, E).

[0065] In summary, after screening, mCherry-CRY2 PHR Clust-mTRIM21 (1-80) was defined as the Flash-Away system for light-controlled targeted protein degradation.

[0066] Example 4

[0067] Utilize intracellular antibodies Intrabody including: Monobody antibody, Nanobody antibody, Binder small peptide (pDI, LCB3), realize targeted degradation corresponding protein.

[0068] Degradation system includes: (1) Mb33-Flash-Away (targeted degradation MLKL protein, Figure 3 ); (2) Nb-Actin-Flash-Away (targeted degradation Actin protein, Figure 4 A-D); (3)

[0069] Nb-ALFA-Flash-Away (targeted degradation fusion protein with ALFA label, Figure 4 E-F); (4) Flash-Away-pDI (targeted degradation viral MDM2 protein, Figure 5 A-B); (5) LCB3-Flash-Away (targeted degradation viral Spike protein, Figure 5 C-D).

[0070] The construction process of the above intracellular antibody Intrabody mediated light-controlled targeted protein degradation system is as follows:

[0071] Utilize gBlock to synthesize Mb33 (MLKL monobody), Nb-Actin (actin nanobody) Nb-ALFA (ALFA nanobody), pDI (binding MDM2) and LCB3 (binding ACE2 RBD domain) fragments, and utilize NheI enzyme cutting site to insert the above fragments into Flash-away or mCh-CRY2 PHR Vector, establish degradation system: (1) Mb33-Flash-Away (targeted degradation MLKL protein); (2) Nb-Actin-Flash-Away (targeted degradation Actin protein); (3) Nb-ALFA-Flash-Away (targeted degradation fusion protein with ALFA label); (4) Flash-Away-pDI (targeted degradation viral MDM2 protein); (5) LCB3-Flash-Away (targeted degradation viral Spike protein).

[0072] The base sequence of the Mb33 is shown as SEQ ID NO. 6;

[0073] The base sequence of the Nb-Actin is shown as SEQ ID NO. 7;

[0074] The base sequence of the Nb-ALFA is shown as SEQ ID NO. 8;

[0075] The base sequence of the pDI is shown in SEQ ID NO.9;

[0076] The base sequence of the LCB3 is shown in SEQ ID NO.10.

[0077] (1) Using Monobody to Construct a Light-Controlled Protein Targeted Degradation System Mb33-Flash-Away (Targeted Degradation of MLKL Protein)

[0078] Monomeric antibodies are artificially synthesized binding proteins based on the modification of fibronectin III (FN3) type domains. They can target target molecules with high specificity and have broad application potential in biomedical research, diagnosis and targeted therapy.

[0079] MLKL is a key effector protein of programmed necrosis. Its mediated membrane perforation triggers inflammatory responses, is associated with a variety of diseases, and is an important target for drug development. To maintain MLKL homeostasis, this application utilizes the Flash-Away system in combination with the MLKL-specific monomeric antibody Mb33 to construct the Mb33-Flash-Away system ( Figure 3 A).

[0080] The fluorescence signal of MLKL-YFP in the control group Mb33-mCherry-CRY2 was not significantly reduced after oligomerization, while the green fluorescence of the experimental group was significantly weakened after blue light irradiation, and the degradation efficiency of MLKL was improved, with a half-life of about 6.28±0.05 minutes ( Figure 3 B).

[0081] (2) Using nanoantibodies to construct light-controlled protein targeted degradation systems Nb-Actin-Flash-Away (targeted degradation of Actin protein); Nb-ALFA-Flash-Away (targeted degradation of fusion proteins with ALFA tags);

[0082] Nanobodies are small antibody molecules extracted from camelids. They are composed only of the variable region of the heavy chain of traditional antibodies, so their molecular weight is smaller. They have higher thermal and chemical stability and relatively low immunogenicity. In this study, nanobodies were used to establish the Nb-Actin-Flash-Away and Nb-ALFA-Flash-Away systems, targeting Actin ( Figure 4 AD) and ALFA-tagged fusion proteins for light-controlled degradation ( Figure 4 EF). In addition, inducing actin degradation using Nb-Actin-Flash-Away significantly inhibited cell migration function ( Figure 4 D).

[0083] (3) Binder peptide was used to construct Flash-Away-pDI (targeting degradation of MDM2 protein) and LCB3-Flash-Away (targeting degradation of viral Spike protein).

[0084] Binder peptide is a kind of short peptide chain that can specifically recognize and bind to target molecules. It has the characteristics of small molecular weight, strong penetration, easy modification, and is widely used in drug development, molecular detection and targeted delivery. In this study, Binder peptide was used to construct Flash-Away-pDI and LCB3-Flash-Away systems to target MDM2 protein (A-B) and viral Spike (C-D) for light-controlled degradation. Figure 5 A-B) and viral Spike (C-D) for light-controlled degradation. Figure 5 C-D) for light-controlled degradation.

Claims

1. An optogenetic tool for light-induced protein degradation, characterized in that Including truncated mTRIM21 1-80 , CRY2's fusion system; mTRIM21 1-80 The base sequence is shown in SEQ ID NO.1; The base sequence of CRY2 is shown in SEQ ID NO.

2.

2. The optogenetic tool according to claim 1, wherein The CRY2 includes CRY2 mutant E490G, CRY2 mutant E490R, and CRY2 mutant CRY2-Clust; The base sequence of the CRY2 mutant E490G is shown in SEQ ID NO.3; The base sequence of the CRY2 mutant E490R is shown in SEQ ID NO.4; The base sequence of the CRY2 mutant CRY2-Clust is shown in SEQ ID NO.

5.

3. The optogenetic tool according to claim 1, wherein The CRY2 is a CRY2 mutant CRY2-Clust.

4. The optogenetic tool according to any one of claims 1 to 3, wherein The proteins degraded by the optogenetic tool include: MLKL, Actin, a fusion protein with an ALFA tag, MDM2 and one of the Spike proteins.

5. The method for constructing an optogenetic tool according to any one of claims 1 to 4, characterized in that: The following steps are involved: (1)mTRIM21 1-80 Construct a fusion system with the light-sensitive protein CRY2; (2) Use intracellular antibodies Intrabody to construct a targeted protein degradation system.

6. The construction method according to claim 5, characterized in that: The process of step (1) includes: A1 uses homologous recombination to transfer CRY2 PHR Insert mCherry2-C1 to construct vector mCherry-CRY2 PHR ; Use pGEMHE-mCherry-mTRIM21 as a template to amplify mTRIM21 1-80 , and introduced NheI restriction site, and mTRIM21 was transformed into 1-80 Insertion of mCherry-CRY2 PHR vector to generate mTRIM21 1-80 -mCherry-CRY2 PHR ; A2 uses pGEMHE-mCherry-mTRIM21 as a template to amplify mTRIM21 1-80 , and introduced BspEI and BglII restriction sites, and used BspEI and BamHI (BglII and BamHI are homozygous enzymes) to encode mCherry-CRY2 PHR The vector was digested and mTRIM21 1-80 Insertion into mCherry-CRY2 PHR Generate mCherryCRY2 PHR -mTRIM21 1-80 .

7. The construction method according to claim 5, characterized in that The process of step (2) includes: Use gBlock to synthesize the corresponding intracellular antibody Intrabody to specifically recognize the protein to be degraded, and use the NheI restriction site to insert the above fragment into the fusion system of step (1) or mCh-CRY2 PHR A targeted degradation system is established in the carrier.

8. Use of the optogenetic tool according to any one of claims 1 to 4 or the optogenetic tool constructed by the method according to any one of claims 5 to 7 for specifically targeting protein degradation.

9. The use according to claim 8, characterized in that Use intracellular antibodies (Intrabody) to target and degrade corresponding proteins; Preferably, the intrabody comprises one or more of a Monobody antibody, a Nanobody antibody, and a Binder peptide.

10. The use according to claim 8 or 9, characterized in that: Confocal time-lapse photography and Western Blot were used to detect the degradation of the corresponding proteins.

Images