Low-immunogenicity iPSC cell based on CIITA gene knockout and tEGFR gene knockin as well as preparation method and application of low-immunogenicity iPSC cell

Abstract

The invention discloses a low-immunogenicity iPSC cell based on CIITA gene knockout and tEGFR gene knockin as well as a preparation method and application of the low-immunogenicity iPSC cell. A double-stranded DNA template for targeted knockin of a tEGFR gene at a CIITA gene knockout site sequentially comprises a CIITA left homologous arm, a CMV enhancer, a chicken beta-actin promoter, a chimeric intron, a Kozak sequence, a CSF2RA signal peptide, a tEGFR gene, a bGH polyadenylic acid signal and a CIITA right homologous arm from upstream to downstream; the left homologous arm and the right homologous arm are used for determining the position of a double-stranded DNA template, the DNA of the left homologous arm is homologous with the 5'end sequence of a DNA incision targeted by gene fixed-point knock-in, the right homologous arm is homologous with the 3 'end sequence of the DNA incision, and the CMV enhancer and the chicken beta-actin promoter form an exogenous promoter (CAG promoter) for driving the expression of the knocked-in tEGFR gene.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of genetic engineering and cell biology technology, in particular to a low immunogenic iPSC cell based on CIITA gene knockout and tEGFR gene knock-in, and a preparation method and application thereof. BACKGROUND

[0002] Cell therapy is an innovative medical approach that uses in vitro cultured normal cells or induced differentiated stem cells to produce a large number of healthy functional cells to repair tissues and organs. Stem cells, with their unique self-renewal and multi-directional differentiation capabilities, have become the focus of regenerative medicine, and they have the potential to transform into cells of various tissues and organs in the human body. Induced pluripotent stem cells (iPSCs) are a type of stem cell obtained by reprogramming mature somatic cells with specific factors, which have similar multi-directional differentiation potential and continuous self-renewal characteristics to embryonic stem cells. The preparation method of iPSCs is relatively simple and stable, and avoids the use of embryonic cells or egg cells, which not only has an advantage in ethics, but also expands the source of stem cells, making more patients have the opportunity to use this technology to obtain the required stem cells. Currently, iPSC cell therapy has shown great potential and growing application value in the treatment of macular degeneration, heart failure, Parkinson's disease, and spinal cord injury, among other diseases.

[0003] Although there have been many advances in the field of iPSC research, the problem of immune rejection has not yet been well solved. Autologous cell therapy can avoid the problem of immune rejection, but it has the problems of high cost and long preparation period, and the treatment effect may be affected by individual differences. Allogeneic cell therapy can reduce the immunogenicity of allogeneic cells through immunosuppressive drugs, HLA matching, and gene editing. However, long-term use of immunosuppressive drugs has side effects. The establishment and maintenance of an iPSC bank with HLA matching is costly and can provide matching for specific populations, but it cannot cover most people.

[0004] The major histocompatibility complex (MHC) of humans, also known as human leukocyte antigen (HLA), is the main cause of immune rejection. The HLA system is composed of multiple genes, divided into class I, class II, and class III genes. Class I MHC genes are expressed on the surface of almost all cells in the body, and if the transplanted cells express different class I MHC molecules from the host, CD8 + T cells will be activated, leading to the elimination of these cells. Class II MHC genes are mainly expressed on antigen-presenting cells, and when CD4 +T cells recognize non-self MHC class II molecules, which can trigger immune rejection. Although class III genes are not directly involved in immune recognition, they play a role in inflammatory responses. In recent years, through gene editing techniques such as knocking out key genes such as B2M and CIITA, the expression of MHC-I and MHC-II on the cell surface or the expression of their genes has been successfully reduced, which helps cells to escape specific recognition by T cells and B cells, thereby enhancing the immune tolerance or immune escape ability of the cells.

[0005] In addition, the safety issues of iPSCs are one of the key factors limiting their wide application. Given that iPSCs can exist for a long time in vivo and have the potential risk of triggering tumors, these issues make it more complicated to apply iPSCs to clinical treatment. Therefore, it is particularly important to install a "safety switch" that can quickly and effectively shut down or eliminate iPSC-derived cells when adverse reactions or unexpected cell behavior occur to protect patients from potential harm. Antibody-dependent safety switches, especially truncated epidermal growth factor receptors (tEGFR), have been tested in preclinical and clinical tests for CAR-T cell elimination, with significant effectiveness. SUMMARY

[0006] In view of the defects in the prior art, the purpose of the present application is to provide a low immunogenic iPSC cell based on CIITA gene knockout and tEGFR gene knock-in, as well as a preparation method and application thereof.

[0007] In a first aspect of the present invention, a double-stranded DNA template for targeted knock-in of a tEGFR gene at a CIITA gene knockout site is provided, wherein the double-stranded DNA template comprises, from upstream to downstream, a CIITA left homology arm, a CMV enhancer, a chicken β-actin promoter, a chimeric intron, a Kozak sequence, a CSF2RA signal peptide, a tEGFR gene, a bGH polyadenylation signal, and a CIITA right homology arm; wherein the sequence of the CIITA left homology arm is SEQ ID NO: 12; the sequence of the CMV enhancer is SEQ ID NO: 13; the sequence of the chicken β-actin promoter is SEQ ID NO: 14; the sequence of the chimeric intron is SEQ ID NO: 15; the Kozak sequence is SEQ ID NO: 16; the sequence of the CSF2RA signal peptide is SEQ ID NO: 17; the sequence of the tEGFR gene is SEQ ID NO: 18; the sequence of the bGH polyadenylation signal is SEQ ID NO: 19; and the sequence of the CIITA right homology arm is SEQ ID NO: 20. NO: 20; the left homology arm and the right homology arm are used to determine the position of the double-stranded DNA template, the left homology arm DNA is homologous to the 5' end sequence of the DNA nick targeted by the gene site-directed knock-in, and the right homology arm is homologous to the 3' end sequence of the DNA nick; the CMV enhancer and the chicken β-actin promoter constitute an exogenous promoter (CAG promoter) to drive the expression of the knock-in tEGFR gene.

[0008] In a second aspect, the present invention provides a method for preparing low-immunogenic iPSC cells based on CIITA gene knockout and tEGFR gene knockin, wherein the preparation method uses CRISPR-Cas9 technology to knock out the CIITA gene and knock in the tEGFR gene in iPSC cells, wherein the double-stranded DNA template used for targeted knock-in of the tEGFR gene is as described above; the sgRNA binds to the exon region 2 and the exon region 3 of the CIITA gene, and the required sgRNA sequence is designed based on the PAM sequence, i.e., the 20 bases in front of NGG.

[0009] Further preferably, the preparation method comprises the following specific steps: S1. Design sgRNA sequence; S2. Prepare an RNP complex, wherein the RNP complex is composed of Cas9 protein and the sgRNA described in step S1; S3. Preparing a plasmid containing the tEGFR gene, wherein the plasmid includes the above-mentioned double-stranded DNA template for targeted knock-in of the tEGFR gene at the CIITA gene knockout site; S4, directly introducing the RNP complex in step S2 and the tEGFR gene-containing plasmid in step S3 into the iPSC cells to knockout the CIITA gene and realize the knockin of the tEGFR gene, to obtain low-immunogenic iPSC cells based on CIITA gene knockout and tEGFR gene knockin; S5, screening the low-immunogenic iPSC cells obtained in step S4 for successfully transfected positive low-immunogenic iPSC cells by a monoclonal cell picking method based on fluorescent antibody labeling, and performing pluripotency identification on the successfully transfected positive low-immunogenic iPSC cells.

[0010] Further preferably, in step S4, the introduction is performed by electroporation.

[0011] Further preferably, the electroporation parameters are: iPSC cells 1×10 4 -3×10 4 , Cas9 protein 30-50 pmol, sgRNA 50-100 pmol, tEGFR gene-containing plasmid 1-3 ug.

[0012] Further preferably, in step S5, when picking the fluorescently labeled monoclonal cells under a fluorescence microscope for pluripotency identification, PBS is added to disperse the cells.

[0013] In a third aspect, the present application provides low-immunogenic iPSC cells based on CIITA gene knockout and tEGFR gene knockin, which are prepared according to the above-mentioned method for preparing low-immunogenic iPSC cells based on CIITA gene knockout and tEGFR gene knockin.

[0014] In a fourth aspect, the present application provides the use of low-immunogenic iPSC cells based on CIITA gene knockout and tEGFR gene knockin in the preparation of low-immunogenic universal cells, and in the preparation of immune rejection suppression products.

[0015] Compared with the prior art, the present application has the following beneficial effects: 1. The method for preparing low-immunogenic iPSC cells based on CIITA gene knockout provided by the present application realizes both the knockout of the CIITA gene and the site-directed knockin of the tEGFR gene, and a double-stranded DNA template for targeted knockin of the tEGFR gene uses a CMV enhancer and a chicken beta-actin promoter to form an exogenous promoter (CAG promoter) to drive the expression of the knocked-in tEGFR gene. The RNP-mediated gene editing technology reduces the steps of gene editing, improves the efficiency of gene editing, and reduces the risk of silencing, and constructs a universal iPSC cell line that is highly efficient, low-immunogenic, and has a safety switch.

[0016] 2、The application utilizes the immunofluorescence staining technology combined with the living cell culture technology to specifically recognize the knocked-in target gene. The method is based on the principle of antigen-antibody reaction, and realizes the accurate screening of the monoclonal cells by directly combining the target antigen with the fluorescently labeled antibody. The monoclonal cell picking method provided by the application does not need to introduce an exogenous gene, avoids the gene expression interference and cell function change caused by the exogenous gene, and improves the screening accuracy and efficiency, and is more direct for the monoclonal screening of the target gene.

[0017] 3、The sgRNA for targeting knockout of the CIITA gene provided by the application is combined with the exon region 2 and the exon region 3 of the CIITA gene, and the required sgRNA sequence is designed based on the PAM sequence, i.e. 20 bases in front of NGG. The sgRNA for targeting knockout of the CIITA gene provided by the application can efficiently knockout the CIITA gene, thereby efficiently preparing the iPSC cells with low immunogenicity. BRIEF DESCRIPTION OF DRAWINGS

[0018] Other features, objects and advantages of the application will become more apparent from the following detailed description of non-limiting embodiments, made with reference to the following drawings: Figure 1 A plasmid structure containing a tEGFR gene provided by an embodiment of the application; Figure 2 A knockout efficiency result graph of sgRNA (SEQ ID NO: 1) in hiPSC cells after electrotransformation provided by an embodiment of the application; Figure 3 CIITA KO tEGFR KI A morphology display graph of hiPSC monoclonal cells (KO: is the abbreviation of Knock-Out, meaning knockout; KI: is the abbreviation of Knock-In, meaning knock-in); Figure 4 CIITA KO tEGFR KI A result schematic diagram of base editing of hiPSC cell monoclonal CL44-18 provided by an embodiment of the application (KO: is the abbreviation of Knock-Out, meaning knockout; KI: is the abbreviation of Knock-In, meaning knock-in); Figure 5 CIITA KO tEGFR KIFigure showing the results of flow cytometry detection of tEGFR gene expression in hiPSC cells (KO: is the abbreviation of Knock-Out, meaning knock-out; KI: is the abbreviation of Knock-In, meaning knock-in); Figure 6 Figure showing the comparison results of cloning growth rate and positive clone rate between the limited dilution method provided by the comparative example of the present application and the fluorescent antibody labeling method provided by the example of the present application; Figure 7 CIITA provided by the first experimental example of the present application KO tEGFR KI Figure showing the results of AP staining of hiPSC cells (KO: is the abbreviation of Knock-Out, meaning knock-out; KI: is the abbreviation of Knock-In, meaning knock-in); Figure 8 CIITA provided by the second experimental example of the present application KO tEGFR KI Figure showing the results of RT-PCR of pluripotent gene expression in hiPSC cells (KO: is the abbreviation of Knock-Out, meaning knock-out; KI: is the abbreviation of Knock-In, meaning knock-in); Figure 9 CIITA provided by the third experimental example of the present application KO tEGFR KI Figure showing the results of immunofluorescence staining of pluripotent maker protein expression in hiPSC cells (KO: is the abbreviation of Knock-Out, meaning knock-out; KI: is the abbreviation of Knock-In, meaning knock-in); Figure 10 CIITA provided by the fourth experimental example of the present application under the treatment of cetuximab KO tEGFR KI Figure showing the results of ADCC of hiPSC cells (KO: is the abbreviation of Knock-Out, meaning knock-out; KI: is the abbreviation of Knock-In, meaning knock-in). DETAILED DESCRIPTION

[0019] The following examples will help those skilled in the art to further understand the present application, but do not limit the present application in any form. It should be noted that those skilled in the art can make several changes and improvements without departing from the concept of the present application. These are within the scope of protection of the present application.

[0020] In addition, the technical features involved in different embodiments of the present application described below can be combined with each other as long as they do not conflict with each other.

[0021] The following examples and experimental examples use the apparatus and equipment that are conventional in the art. The experimental methods, unless otherwise specified, are usually carried out according to the conventional conditions, or according to the conditions recommended by the manufacturer. The various raw materials used, unless otherwise specified, are conventional commercially available products, and their specifications are conventional in the art. The sequencing services involved in the present application are completed by Beijing Genewiz Co., Ltd.

[0022] The present application will be described in detail below with reference to specific examples.

[0023] Examples The present embodiment provides a low immunogenic iPSC cell based on CIITA gene knockout and tEGFR gene knock-in and a preparation method thereof. The iPSC cell type in the present embodiment is preferably a hiPSC cell, and the Cas9 protein type is preferably a SpCas9 protein. The specific operation steps of the preparation method are as follows: I. Design sgRNA (1) Find the target gene information, select the editing region, obtain the gene information on NCBI, input "species" - Homo, "gene name" - CIITA on the Gene interface of NCBI homepage, click Genebank, download the sequence, and select exons 2 and 3.

[0024] (2) Find the PAM sequence, i.e. 20 bases in front of NGG, which is the required sgRNA sequence (3) Design 10 sgRNAs, and select one sgRNA sequence (SEQ ID NO: 11) reported in a literature (Feng L, Chao J, Ye P, Luong Q, Sun G, Liu W, Cui Q, Flores S, Jackson N, Shayento ANH, Sun G, Liu Z, Hu W, Shi Y. Developing Hypoimmunogenic Human iPSC-Derived Oligodendrocyte Progenitor Cells as an Off-The-Shelf Cell Therapy for Myelin Disorders. Adv Sci (Weinh). 2023 Aug;10(23):e2206910.) as a control group.

[0025] (4) The design results of sgRNA are as follows: SEQ ID NO. 1: CAGCTCACAGTGTGCCACCA; SEQ ID NO. 2: ATGGAGTTGGGGCCCCTAGA; SEQ ID NO. 3: GCCCCTAGAAGGTGGCTACC; SEQ ID NO. 4: CTTCTATGACCAGATGGACC; SEQ ID NO. 5: AGGCTGTTGTGTGACATGGA; SEQ ID NO. 6: AGGTGATGAAGAGACCAGGG; SEQ ID NO. 7: TAGGGGCCCCAACTCCATGG; SEQ ID NO. 8: CATAGAAGTGGTAGAGGCAC; SEQ ID NO. 9: GGTCCATCTGGTCATAGAAG; SEQ ID NO. 10: CTTCTCCAGCCAGGTCCATC; SEQ ID NO. 11 (control group): GATATTGGCATAAGCCTCCC; II. Synthesis of sgRNA in step one, then connect sgRNA with Cas9 protein plasmid vector (with mCherry marker) (plasmid vector purchased from Fenghui Biology) The operation steps are as follows: (1) Synthesis of sgRNA: The primers are synthesized by solid-phase phosphoramidite triester method. The synthesized primers are purified by PAGE, specifically: the synthesized primers are denatured at 95°C, then the primer samples are loaded into a polyacrylamide gel containing 7M urea, and denatured polyacrylamide gel electrophoresis (PAGE) is performed at 600V for 2 hours; after electrophoresis, the target primer band is cut from the gel, and the purified primer is recovered by elution. sgRNA annealing, operation as follows: a) Instant primer, configure 100uM stock solution with DEPC water.

[0026] b) Configure working solution (10uM): take 10ul stock solution and 90ul DEPC water.

[0027] c) Reaction system (20ul), see Table 1.

[0028] Table 1. sgRNAs annealing reaction system d) 95°C water bath for 5min, turn off the switch and let the water bath cool naturally. When connecting, take 2ul from 20ul for connection.

[0029] (2) Cas9 protein plasmid transformation a) Take a tube of 100 μl DH5a competent cells with the desired plasmid on ice.

[0030] b) Take 0.5 μl of the desired plasmid in 30 μl of competent cell suspension (completed in a clean bench), ice bath for 30 min.

[0031] c) After heating in a 42°C water bath for 90 s, quickly ice bath for 3 min.

[0032] d) Add 500 μl of 37°C preheated LB medium (without antibiotics) in a clean bench, then fix to the shaking bed at 37°C, 250 rpm shaking culture for 1 h.

[0033] e) Divide the transformed bacterial solution into 4 tubes of 15 ml Amp+LB medium (amoxicillin concentration of 100 μg / ml) in 50 ml centrifuge tubes, and shake overnight culture for 12 hours.

[0034] f) After the completion of overnight culture, observe the turbidity of the bacterial solution and proceed with medium extraction.

[0035] (3) Cas9 protein plasmid medium extraction (use plasmid medium extraction kit (OMEGA non-endotoxin plasmid medium) for plasmid extraction) a) Transfer 30 ml of overnight culture to a 50 ml centrifuge tube.

[0036] b) Centrifuge at 4000 xg for 10 min at room temperature.

[0037] c) Remove the supernatant culture solution. (The liquid on the tube wall is removed with a clean paper towel) d) Add 2.5 mL Solution I / RNase A vortex or pipette up and down to completely resuspend the cells, shake vigorously, and there should be no lumps. (Note: RNase A must be added to Solution I before use) e) Add 2.5 ml Solution II, invert and gently rotate the test tube 10 times to obtain a clear lysate. Incubation at room temperature for 3 minutes may be required, occasionally mixed. (Note: Avoid vigorous mixing, as this will shear chromosomal DNA and reduce plasmid purity. Do not allow the lysis reaction to proceed for more than 5 minutes. Solution II is tightly capped when not in use to avoid acidification by CO2 in the air) f) Add 1.25 ml of pre-chilled N3 Buffer, gently invert the tube several times until a white flocculent precipitate forms. Incubate at room temperature for 2 min. (The solution must be mixed thoroughly. If the mixture is still thick and brownish, continue mixing until the solution is completely clear. Complete neutralization of the solution is critical to obtaining high yields) g) Prepare a filter syringe by pulling the plunger out of the syringe, and place the syringe upright on a suitable test tube rack. Place a centrifuge tube under the outlet of the syringe with the opening of the syringe facing upwards. Immediately pour the lysate into the filter syringe. The cell lysate will stay in the syringe for 2 min. At this time, the white flocculent precipitate will float on the surface of the lysate. The cell lysate can flow out of the filter syringe. Collect the lysate in a new 15 mL tube. Carefully insert the plunger of the syringe into the syringe, and slowly push the plunger to allow the lysate to flow into the centrifuge tube. (Alternatively, the precipitate can be removed by centrifugation at 4°C, 15,000 x g for 10 min instead of filtering the precipitate with the filter syringe) h) Add 0.1 volume of ETR Solution to the filtered lysate, mix by inverting the tube 10 times, and then incubate on ice for 10 min. (Note: The lysate can appear turbid after the addition of the ETR Solution, but will clear upon ice incubation) i) Incubate the lysate at 42°C for 5 min. The lysate will again appear turbid. At this time, centrifuge the lysate at 25°C, 4,000 x g for 5 min, and the ETR Solution will form a blue color at the bottom of the tube.

[0038] g) Transfer the supernatant to a new 15 mL tube, add 0.5 volume of absolute ethanol, mix by inverting the tube 6 times, and incubate at room temperature for 1 min.

[0039] k) Place the HiBind® DNA Midi Binding Column into a 15 mL collection tube, transfer 3.5 mL of the mixture from step 10 to the HiBind® DNA Midi Binding Column, centrifuge at 4,000 x g for 3 min at room temperature, and discard the flow-through.

[0040] l) Repeat steps g) through k) until all of the mixture from steps g) through k) is bound to the HiBind® DNA Midi Binding Column.

[0041] m) Place the HiBind® DNA Midi Binding Column into the same collection tube, add 3 mL of HBC Buffer to the HiBind® DNA Midi Binding Column, centrifuge at 4,000 x g for 3 min at room temperature, and discard the flow-through. (Note: The HBC Buffer must be diluted with isopropanol as described in the instructions before use) n) Fit the HiBind® DNA Midi Binding Column into the same collection tube, add 3.5 mL DNA Wash Buffer (diluted with absolute ethanol), centrifuge at 4,000 x g for 3 min at room temperature, and discard the flow-through. o) Repeat step n) by fitting the HiBind® DNA Midi Binding Column into the same collection tube, add 3.5 mL DNA Wash Buffer (diluted with absolute ethanol), centrifuge at 4,000 x g for 3 min at room temperature, and discard the flow-through.

[0042] p) Fit the HiBind® DNA Midi Binding Column into the same collection tube, centrifuge at 4,000 x g for 10 min at room temperature to dry the binding column matrix. Further dry the binding column: leave the binding column open at room temperature for 5 min to dry the ethanol.

[0043] q) Fit the HiBind® DNA Midi Binding Column into a clean 15 mL centrifuge tube, add 0.5 mL RNase-free sterile H2O to the binding column matrix (the amount added depends on the expected final product concentration), and let stand at room temperature for 3 min.

[0044] s) The eluted liquid is added to the column again for column re-passing, and step 18 is repeated once.

[0045] t) After elution is complete, the DNA concentration is detected. The DNA product is stored at -20 °C. (Note: Steps q) - t) require sterile operation to prevent contamination) (4) Plasmid enzyme digestion after medium volume extraction of Cas9 protein plasmid a) Set up the reaction system (20 ul / system) to cut 2 reactions, two tubes, see Table 2.

[0046] Table 2. Medium volume plasmid enzyme digestion reaction system b) Mix well, and centrifuge at 12,000 rpm for 5 min.

[0047] c) 37 °C water bath for 3 h.

[0048] (5) Electrophoresis identification of Cas9 protein plasmid to verify whether the position of the Cas9 protein plasmid enzyme digestion in step (4) is correct a) Perform nucleic acid gel (1% agarose gel 50 ml) configuration.

[0049] b) Take 0.5g of agarose, add 1xTAE 50ml c) Microwave heat high for 2min, add nucleic acid dye, 5ul (nucleic acid dye:agarose gel is 1:10000).

[0050] d) Put the comb, pour the agarose gel into the gel slot, avoid bubbles.

[0051] e) After the agarose gel solidifies, place it at room temperature for 20min, carefully pull out the comb, keep the sample well.

[0052] f) Put the gel and inner slot into the electrophoresis slot, add 1xTAE electrophoresis liquid to cover the gel 2mm g) Loading: add the product in step (4) into the hole, the loading order is: marker:5ul, uncut 12ul, cut sample 20ul (interval a hole loading); 110v; 30min.

[0053] h) When the DNA fragments are completely separated, transfer the gel to the ultraviolet lamp, cut the required DNA fragments as quickly as possible. (When cutting the gel, pay attention to cut off the excess gel, and the DNA is exposed to the ultraviolet lamp for no more than 30s) i) Put it in a 1.5ml EP tube, store at 4°C. The next day, do gel recovery.

[0054] (6) Gel recovery a) Use 1% agarose gel electrophoresis to separate DNA fragments, any type or grade of agarose can be used. We strongly recommend that you use fresh TAE buffer as the electrophoresis buffer. Do not reuse the electrophoresis buffer, as it will reduce the yield due to the increase in pH. Fresh TBE buffer can also be used, but only a lower yield can be obtained.

[0055] b) When the required DNA fragments are completely separated, transfer the gel to the ultraviolet lamp, cut the required DNA fragments as quickly as possible.

[0056] c) Transfer the gel piece with the desired fragment to a 1.5mL centrifuge tube (the centrifuge tube has been weighed). Weigh the weight of the gel piece. Approximately determine its volume. Assuming its density is 1g / mL (the density of almost all DNA gels can be approximated as 1g / mL), then the volume of the gel piece can be obtained as follows: the weight of the gel piece is 0.2g, then its volume is 0.2mL. Add an equal volume of XP2 Binding Buffer, warm in a 50-60°C water bath for 7min or until the gel is completely melted, mix the mixture every 2-3min or vortex.

[0057] d) Take one HiBind® DNA Mini Binding Column and place it in a 2 mL collection tube (ready).

[0058] e) Transfer the entire DNA / gel melt solution from step 3 into the HiBind® DNA Mini Binding Column. Centrifuge at 10,000 x g for 1 min at room temperature. Discard the filtrate in the collection tube and place the column back into the 2 mL collection tube.

[0059] f) If the volume of the DNA / gel melt solution exceeds 700 μl, transfer only 700 μl into the HiBind® DNA Mini Binding Column at a time and continue repeating step 5 until all the solution has passed through the HiBind® DNA Mini Binding Column. Each HiBind® DNA Mini Binding Column has a maximum binding capacity of 25 μg of DNA. If a large yield is expected, divide the sample into an appropriate number of HiBind® DNA Mini Binding Columns.

[0060] g) Discard the filtrate in the collection tube and place the HiBind® DNA Mini Binding Column back into the 2 mL collection tube. Transfer 300 μl of XP2 Binding Buffer into the column and centrifuge at maximum speed (13,000 x g) for 1 min at room temperature. Discard the filtrate. h) Place the HiBind® DNA Mini Binding Column back into the 2 mL collection tube. Transfer 700 μl of SPW Buffer (diluted with absolute ethanol) into the HiBind® DNA Mini Binding Column. Centrifuge at 10,000 x g for 1 min at room temperature. Discard the filtrate. i) Repeat step 8 by placing the HiBind® DNA Mini Binding Column back into the 2 mL collection tube. Transfer 700 μl of SPW Buffer (diluted with absolute ethanol) into the HiBind® DNA Mini Binding Column. Centrifuge at 10,000 x g for 1 min at room temperature. Discard the filtrate.

[0061] j) Place the HiBind® DNA Mini Binding Column back into the 2 mL collection tube. Centrifuge at 13,000 x g for 2 min at room temperature to spin off any residual liquid from the HiBind® DNA Mini Binding Column matrix.

[0062] k) Place the HiBind® DNA Mini Binding Column in a clean 1.5 mL microfuge tube, add 30 μl (depending on the expected final product concentration) of H2O (pre-warm the H2O to 50-60 °C) to the matrix of the HiBind® DNA Mini Binding Column, let stand at room temperature for 5 min, centrifuge at 13,000 x g for 1 min to elute the DNA. The first elution can wash out 80% of the bound DNA. The recovered liquid is transferred to the column for a second pass. If a second elution is performed, the residual DNA can be eluted, but at a lower concentration.

[0063] (7) sgRNA and Cas9 protein plasmid vector connection a) Connection system construction (operation on ice), see Table 3.

[0064] Table 3. sgRNA and Cas9 protein plasmid vector connection reaction system b) After mixing, control the temperature of the PCR instrument, 16 °C for overnight connection to form a plasmid vector. The plasmid structure contains different sgRNA sequences, Cas9 protein sequences, mCherry fluorescent protein sequences, puromycin resistance sequences and ampicillin resistance sequences. Different sgRNA sequences: used to guide the specific recognition and cutting of Cas9 protein to target DNA sequences. Cas9 protein sequence: encodes Cas9 nuclease for gene editing. mCherry fluorescent protein sequence: used to label and screen successfully transfected cells. Puromycin resistance sequence: used to screen cells expressing mCherry fluorescent protein. Ampicillin resistance sequence: used to screen colonies containing the plasmid in E. coli.

[0065] III. Transfect Hek 293A cells with sgRNA and Cas9 protein containing plasmids in step two (1) Inoculate cells Inoculate cells one day before transfection. The initial inoculation density of 293A cells in each well of a 6-well plate is 6 x 10 5 , and the confluence reaches 80% for transfection.

[0066] (2) Prepare DNA-PEI nucleic acid-transfection reagent complex a) For each well of cells, dilute 1 μg of target DNA with 100 μL of serum-free medium (Opti-MEM with a volume-to-mass ratio of 100:1) to prepare a DNA diluent. The serum-free diluent is recommended to use Opti-MEM b) Immediately add 3 μL of PEI 40000 transfection reagent (transfection reagent volume to plasmid mass ratio 3:1) to 100 μL of DNA dilution solution, and mix gently.

[0067] c) Incubate at room temperature for 15 min to form DNA-PEI cationic nucleic acid transfection reagent complexes.

[0068] (3) Transfect cells Without changing the solution, without blowing again, directly add the DNA-PEI nucleic acid-PE1 complex drop by drop to the cells, shake the culture plate, mix gently, culture at 37°C in a 5% CO2 incubator, change the solution after 6 hours, and observe fluorescence after 48 hours. The red fluorescence of the cells transfected after 48 hours is obvious.

[0069] Four, screen out mCherry-positive Hek 293A cells in step three by flow sorting technology After 48 hours of transfection, sort 10,000 positive cells, then extract DNA, and analyze gene editing efficiency by sequencing.

[0070] Flow sorting operation: After cell digestion and centrifugation, resuspend with 200 μL of sterile PSB, sieve 200 μL of cell suspension through a 40 μm cell sieve into a 1.5 mL EP tube or flow tube, mix gently, and then load onto the machine. The receiving liquid is 500 μL of fresh culture medium.

[0071] Five, PCR and Sanger sequencing to detect the knockout efficiency of different sgRNAs in Hek 293A cells in step four (1) Extract DNA from positive expression cells a) According to the required sample quantity, prepare an appropriate amount of 1x lysis buffer, and prepare the lysis buffer at a ratio of Proteinase K:1x Mouse tissue Lysis Buffer of 1:50.

[0072] b) Take 20 μL of 1x lysis buffer and add it to the cells, vortex, and then incubate in a 55°C water bath for 20 min.

[0073] c) After incubation, place the sample in a 95°C or boiling water bath for 5 min to inactivate Proteinase K.

[0074] d) After vortexing the lysis product thoroughly, centrifuge at 12,000 rpm for 5 min, and take the supernatant for PCR reaction. The supernatant can also be transferred to another sterile EP tube and stored at -20°C for at least 3 months.

[0075] (2) PCR a) After the 2x Taq Plus Master Mix (Dye Plus) is completely thawed, mix well by inverting the tube. Prepare the following reaction system on ice, see Table 4.

[0076] Table 4. PCR premix reaction system b) Recommended PCR reaction condition settings, see Table 5.

[0077] Table 5. PCR reaction conditions c) The amplified product is directly subjected to agarose gel electrophoresis detection without adding DNA Loading Buffer.

[0078] d) The target band of electrophoresis is detected by Sanger to knock out efficiency, and Synthego is used for analysis. The knockout efficiency of different sequences in Hek293A cells is obtained, and sgRNA sequences with high editing efficiency are screened. Different sequences of sgRNA have different knockout efficiencies of CIITA gene, and the detailed results are shown in Table 6. When the sequence of sgRNA is SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, the average value of the knockout efficiency of two times is higher, wherein the average value of the knockout efficiency of two times of SEQ ID NO: 1 is the highest, and SEQ ID NO: 1 is more suitable for the position required for tEGFR gene insertion, therefore, SEQ ID NO: 1 is preferred in the subsequent experimental study in this embodiment.

[0079] The sgRNA of CIITA-sgRNA (SEQ ID NO: 1) is subjected to off-target analysis, and the easy off-target point in the top 10 off-target sites of CIITA-sgRNA (SEQ ID NO: 1) is 3 or 4 mismatch off-target, and there is no exon off-target site. It is proved that the CIITA-sgRNA (SEQ ID NO: 1) provided in this embodiment not only has high editing efficiency, but also has low off-target risk (no exon off-target site).

[0080] Table 6. Knockout efficiency of different sgRNAs in Hek293A cells Six, the sgRNA (SEQ ID NO. 1) and SpCas9 protein in step five are prepared into an RNP complex, and in this embodiment, the Cas9 protein is 30-50 pmol, the sgRNA is 50-100 pmol, and the preferred SpCas9 protein is 40 pmol, and the sgRNA is 70 pmol for subsequent preparation process. The steps are as follows: First, mix SpCas9 protein (40 pmol), CIITA-sgRNA (70 pmol), and P3 buffer (2.94 μl) (Lonza P3 primary cell transfection kit) uniformly, incubate at 37°C for 10 min, and obtain RNP complex.

[0081] Seven, knock in the RNP complex in step six and the plasmid containing tEGFR gene into the tEGFR gene site of the hiPSC cell by electroporation, and obtain low immunogenic iPSC cell based on CIITA gene knockout and tEGFR gene knockin.

[0082] In this embodiment, the iPSC cell is 1×10 4 -3×10 4 , the plasmid containing tEGFR gene is 1-3 ug, and preferably the iPSC cell is 2×10 4 , the plasmid containing tEGFR gene is 1 ug, and the subsequent preparation process is carried out.

[0083] In this embodiment, the plasmid containing tEGFR gene is synthesized by General Biosystems, and the plasmid map is as shown in Figure 1 The plasmid contains a double-stranded DNA template for targeted knockin of tEGFR gene, and the double-stranded DNA template includes, from upstream to downstream, CIITA left homologous arm, CMV enhancer, chicken beta-actin promoter, chimeric intron, Kozak sequence, CSF2RA signal peptide, tEGFR, bGH polyadenylation signal, and CIITA right homologous arm; the left and right homologous arms are used for the determination of the position of the double-stranded DNA template, the left homologous arm DNA is homologous to the 5' end sequence of the DNA cut targeted by the gene site knockin, and the right homologous arm is homologous to the 3' end sequence of the DNA cut; the CMV enhancer and the chicken beta-actin promoter constitute an exogenous promoter (CAG promoter) for driving the expression of the knockin tEGFR gene.

[0084] Preferably, SEQ ID NO: 12 is the sequence of the CIITA left homology arm, SEQ ID NO: 12 is as follows: CATATTTATGGGGTATATGTGAATATTTATTACATGCATAGAAGGTATAATGATCATGTCAGGATATTTGAGGTATCCACATTTGGGATTGTTTAAAGATTAAATGAAATAGTGTTAAAAGTATTTAATATGCCCTTCAACAAATGATGAGGAAATCTTAGAATCTGCTCAGACTCCTTCAGTTTACATATTAGGAAACTGAGGCACAGAAAGGAGCAGAGACTTGCTCAAGTCCACCCAAAGCAGTAGAGCATTGTGGTTAAATGCAGGACTTCAGTCAGACTGTCTGGGTTCAAATCCTGGTTCCACTTGGACATGGGTTTCCTTACATAAATCACTTCACCTCTCTGAGCCTCAGTTTTCTCATATGCAAAGTGAGGATAATAATAATACCTTCCTTACATGGTTACTGATATGAGTATTAAATGTGCCAGCTCATGTGCCTGGCGTATAGGAGGTGCTTTATAAACCTTAGCTGTTACCACTCATGGCATTGCCAAATGTGGGACGGGTCTCCTGACTCTCTGGTGTGAGATTGATGGAATCCACACTTTCCAGTTCCCTTTTCTACCTCCTGGGTATCTTCTCATATGGTTGTAAGTTCCTTGGAGGAAGGGAATGTGGCTTGCTCTCTCCACCACGCTGAGCATATAAGAGGTGCTGAATGAGCGCTTTTATTCACTCCTCTCATCCCCAGCCCTCACCAGCTGGGAGTTGTTGTAGGTGTCAATTTTCTGCCTCTTTCCAACACCCTGTGAGGTGACTGAGCATTGTCTTCCCTCCCAGGCAGCTCACAGTGTGCCA; Preferably, SEQ ID NO: 13 is the sequence of the CMV enhancer, SEQ ID NO: 13 is as follows: gacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatg; Preferably, SEQ ID NO: 14 is the sequence of the chicken beta-actin promoter, SEQ ID NO: 14 is as follows: gtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttatttttaattattttgtgcagcgatgggggcggggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcg; Preferably, SEQ ID NO: 16 is a Kozak sequence, SEQ ID NO: 16 is as follows: gccacc; Preferably, SEQ ID NO: 17 is a sequence of a CSF2RA signal peptide, SEQ ID NO: 17 is as follows: ATGCTGCTGCTCGTGACCTCTTTACTGTTATGTGAGCTGCCCCACCCCGCTTTTTTACTGATCCCT; Preferably, SEQ ID NO: 19 is the sequence of the bGH polyadenylation signal, SEQ ID NO: 19 is as follows: TGAtgaccgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatggactagtattaattaaatctagaagtcgacagtactaagctt; Preferably, SEQ ID NO: 20 is the sequence of the CIITA right homology arm, which is as follows: CCATGGAGTTGGGGCCCCTAGAAGGTGGCTACCTGGAGCTTCTTAACAGCGATGCTGACCCCCTGTGCCTCTACCACTTCTATGACCAGATGGACCTGGCTGGAGAAGAAGAGATTGAGCTCTACTCAGGTGGGCCCTCCTCCCTCTGGTCTCTTCCGGTATCCCCCACCCCTCAGCTTGCTGTAGAGACGGCAATCAGGGGAAATTCTGGTCCCTGCCCTCCCGTCAGCACCACGGACAGCTCCCACGTCTGTGGGACGCTCTCTGCAGATGGGGATGATCTCCCAGCCCTGCCCCGCCTCTCCCTCGTTCCCCACCAGCCCTCTTTCCAGAAATTTCCTTCTTCATCCAAGGGACTTTTCCTCCCAGAACCCGACACAGACACCATCAACTGCGACCAGTTCAGCAGGCTGTTGTGTGACATGGAAGGTGATGAAGAGACCAGGGAGGCTTATGCCAATATCGGTGAGGAAGCACCTGAGCCCAGAAAAGGACAATCAAGGGCAAGAGTTCTTTGCTGCCACTTGTCAATATCACCCATTCATCATGAGCCACGTCAGTCCCCTCCCACAGAAATCATTGCAAGGGGGATGCGGAGCAATGGCTGGAGGAACGGAGACTCCAGGGAAGAGAGGGGAGATGGAGGCCAGTGGGGGAAATAGGCCCCTTCACTAATGACCACCAAGAAAACAAAATCTCATGTTTACATCCTCCACCTCCATTTCTATACGCATTTCTGCTTCTTGCTCTTCTGTCCATCCTTTCTACAAAGCCCATACCATACACCCCTTTCCCTTTTCCTCC.

[0085] Low immunogenic iPSC cells based on CIITA gene knockout and tEGFR gene knock-in are prepared as follows: (1) hiPSC cell digestion, counting, preparation of electroporation sample, steps as follows: a) Take the hiPSC cells (1 well of a 6-well plate) out of the 37°C, 5% CO2 cell incubator, observe the confluence of the cells under a microscope and record it; b) When the confluence of the cells is observed under a microscope to be 85%, first use a pipette to discard the supernatant, then wash once with 3 ml of DPBS and discard; c) Add 0.7 ml of accutase digestion solution (STEMCELL Technologies), then incubate in a 37°C, 5% CO2 cell incubator for 8 min; d) Add 2.3 ml of complete medium containing Y27632 (working concentration 10 μM), gently blow the cells into single cells with a gun head and transfer them all to a 15 ml centrifuge tube, take 20 ul of the cell suspension for counting; e) According to the counting result, take the required amount of cells (2 x 10 4 hiPSC cells) to a new 1.5 ml centrifuge tube, centrifuge at 200g at room temperature for 5 min; f) After centrifugation, try to discard the supernatant, add 15 μl of the prepared P3 buffer, mix well, then add the transfection components (the transfection components are the RNP complex in step six and 1 ug of the plasmid containing the tEGFR gene), gently mix with a gun head, and then add them to the corresponding electroporation cup to avoid air bubbles; (2) Electroporation a) Place the electroporation cup with the sample added in (1) f into the corresponding position of the Nucleofector X Unit electroporator, select the electroporation program CA-137, then click "Start", after the end, transfer the electroporation cup to a biological safety cabinet, add 80 μl of warm electroporation special medium (when the electroporation material contains plasmid, add DNaseI, 20 U / test in advance) to each electroporation cup, mix gently, then incubate in a 37°C, 5% CO2 cell incubator for 10 min; b) Take the 24-well plate coated with LN521 out of the incubator, discard the liquid, add 400 μl of warm electroporation special medium, then transfer the cell suspension after incubation into the well plate, mix crosswise, then put the cells back into a 37°C, 5% CO2 cell incubator for culture, to obtain CIITA gene knockout and tEGFR gene knock-in based low immunogenic iPSC cells (CIITA KO tEGFR KI hiPSC cells); c) After 2 days of culture, extract CIITA KO tEGFR KI-hiPSC cell genomic DNA, the knockout efficiency of sgRNA (SEQ ID NO: 1) in hiPSC cells was detected by Sanger sequencing, and the knockout efficiency result is shown in Figure 2 As shown, the knockout efficiency is 75.7%, indicating that using RNP-mediated gene editing technology, directly introducing RNP complex and plasmid containing tEGFR gene into cells can not only obtain higher editing efficiency, but also significantly reduce off-target effects and reduce potential toxicity to cells.

[0086] Eight, picking the CIITA prepared above KO tEGFR KI hiPSC cells were subjected to monoclonal construction, and then based on the method of picking single clone cells labeled by fluorescent antibody, the positive CIITA KO tEGFR KI hiPSC cells (1) CIITA prepared in step seven KO tEGFR KI hiPSC cells were plated and cultured The cell suspension was accurately taken 1000 cells by cell counting, and uniformly plated in a 6-well plate. 3 ml of TeSR-E8 complete medium containing 1x CloneR was added to each well, and the 6-well plate was placed in the cell incubator for culture. The medium was replaced every 4 days, and the old medium was discarded and replaced with fresh 3 ml of TeSR-E8 complete medium containing 1x CloneR, and the culture was continued.

[0087] (2) Monoclonal picking preparation When the cells were cultured to the 9th day, monoclonal picking (operation under microscope) could be performed, and the monoclonal cell morphology result is shown in Figure 3 , the monoclonal cells formed independent cell clusters, which were irregular round and had clear edges, and their morphological characteristics were consistent with the typical characteristics of monoclonal cells; before picking, 1x CloneR-containing TeSR-E8 complete medium was prepared in advance and added to a 96-well plate, 200 μL of medium was added to each well.

[0088] (3) Cell loosening treatment Before fluorescent antibody staining, the TeSR-E8 medium in the 6-well plate was discarded. 1 ml of PBS was added to each well, and the 6-well plate was gently shaken to evenly cover the cells with PBS, and soaked for 2 minutes to slightly loosen the monoclonal cells for subsequent operation.

[0089] (4) Fluorescent antibody incubation To better stain live cells with fluorescent antibody without affecting cell status, fluorescent antibody was diluted with TeSR-E8 complete medium. The specific operation is as follows: Incubate anti PE EGFR antibody (BioLegend) in advance: take 1.2 ml of TeSR-E8 complete medium at a ratio of 1:500, add 2.4 μL of fluorescently labeled anti PE EGFR straight antibody, mix well, and then add the mixture to the wells of a 6-well plate, and incubate at room temperature for 30 minutes in the dark.

[0090] The fluorescent straight antibody used in this embodiment includes but is not limited to the following types: FITC (fluorescein isothiocyanate), PE (phycoerythrin), PE-Cy5, PE-Cy5.APC (allophycocyanin), Cy5, PE.Cu7Alexa Fluor 647, and other fluorescent labels with similar excitation and emission wavelength characteristics.

[0091] (5) Further loose treatment of cells After incubation, remove the antibody-containing medium. Add 1 ml of PBS to each well again, gently shake the 6-well plate to evenly cover the cells with PBS, soak for 5 minutes, and further loosen the monoclonal cells for subsequent picking operation.

[0092] (6) Picking of monoclonal cells After removing the PBS, add 2 ml of fresh TeSR-E8 complete medium to each well. Under a microscope, use a gun head to quickly and accurately pick the fluorescently expressed monoclonal cells and transfer them to a pre-prepared 96-well plate containing 200 μL of TeSR-E8 complete medium containing 1x CloneR for further culture.

[0093] After 8 days of culture, the picked cells can be extracted for DNA and PCR amplification, and sequencing to detect whether they are monoclonal. Monoclonal CL44-18 (a total of 44 CIITA KO tEGFR KI -hiPSC cells were picked) KO tEGFR KI -hiPSC cells) at the CIITA site base editing result is shown in Figure 4 Monoclonal CL44-18 is base-1 mutated, and the efficiency of base-1 mutation is 100%, indicating that the picked CIITA KO tEGFR KI -hiPSC cells have exactly the same genotype, which can rule out mixed clones, confirming that the clone is monoclonal, and the CIITA gene achieves double knockout (double knockout means that both alleles of a chromosome are knocked out).

[0094] Base-1 mutation: 1 extra base is missing at a specific target site of a DNA sequence, resulting in a frame shift mutation of the base sequence after the position.

[0095] The prepared CIITA KO tEGFR KI Flow cytometry was performed after the expansion of the hiPSC cells to detect the expression of CIITA KO tEGFR KI The expression of EGFR molecules of the hiPSC cells was performed as follows: The prepared CIITA KO tEGFR KI The hiPSC cells were digested into a single cell suspension, and the cell concentration was adjusted to 1x10 6 cells / ml. Then, the single cell suspension was stained using a straight antibody anti PE-EGFR antibody (1:200) at 4°C for 30 minutes. The stained cell sample was analyzed by flow cytometry to detect the expression of CIITA KO tEGFR KI The expression of EGFR molecules of the hiPSC cells was performed as follows: KO tEGFR KI The results of the expression of EGFR molecules of the hiPSC cells are shown in Figure 5 The expression of EGFR molecules of the hiPSC cells was performed as follows: KO tEGFR KI The positive rate of the expression of EGFR molecules of the hiPSC cells was 99.3%, indicating that the CIITA KO tEGFR KI The hiPSC cells have high expression and stability in terms of tEGF expression.

[0096] This experiment proves that the CIITA KO tEGFR KI The hiPSC cells can express EGFR molecules, and tEGFR is a part of the EGFR molecules, so if EGFR can be detected, tEGFR can also be detected. This experiment proves the successful insertion and expression of the tEGFR gene.

[0097] Comparative Example The preparation method of the low immunogenic iPSC cells (CIITA KO tEGFR KI hiPSC cells) based on the CIITA gene knockout and tEGFR gene knock-in provided in the reference example was used, and step eight, the single cell monoclonal cell picking method based on fluorescent antibody labeling was used to screen successfully transfected positive CIITA KO tEGFR KIhiPSC cells are replaced by limited dilution method, and the operation steps of limited dilution method are as follows: (1) The cells in the 6-well plate are taken out from the 37°C, 5% CO2 incubator, and the cell state is observed under a microscope to ensure that the cells grow well; (2) First, the supernatant is removed with a pipette, and then 2 mL of DPBS is used to wash once and discarded; (3) Add 0.7 mL accutase digestion solution to each well, then put it into a 37°C, 5% CO2 cell incubator for incubation for 10 min; (4) Add 2 mL of TeSR-E8 complete medium to each well to terminate the reaction, add 15 mL to a centrifuge tube, centrifuge at 300g for 5 min, discard the supernatant, and resuspend the cells with 3 mL of TeSR-E8 complete medium, then filter them through a 40um filter, and take 20uL for counting.

[0098] (5) The cell number of the cell suspension is accurately counted by AOPI counting method, and 300 cells are taken and added to a 50ml centrifuge tube.

[0099] (6) Add 37.5ml of TeSR-E8 complete medium containing 1xCloneR2, and dilute to 8 cells / mL.

[0100] (7) Discard LN521 in the 96-well plate, and add 100ul of cell suspension to each well. A total of 2 96-well plates are plated.

[0101] (8) Place in a 37°C, 5% CO2 incubator, and replace fresh TeSR-E8 complete medium after 4 days.

[0102] (9) On the 7th day, add 100ul of complete medium to the wells containing the cloned cells.

[0103] (10) On the 10th day after plating, transfer half of the single clone cells to a 24-well plate, and extract DNA from the remaining half of the cells, perform PCR amplification for the inserted gene, and identify it by gel electrophoresis.

[0104] CIITA screened in step eight of the comparative example KO tEGFR KI CIITA screened from hiPSC cells and the comparative example KO tEGFR KI The cloning growth rate and positive clone rate of hiPSC cells, and the results are as follows Figure 6As shown, the cells screened by the limited dilution method were cultured and plated in 192 wells of 2 96-well plates, and finally only monoclone cell growth was observed in 44 wells, with a clone growth rate of 23% (44 / 192 x 100%). After the expansion culture of these monoclone cells, genomic DNA was extracted and PCR identification was performed, and the results showed that only 3 clone cells (3 / 44) detected positive bands of inserted genes, with a positive clone success rate of 6.8% (3 / 44 x 100%); 33 monoclone cells were picked out by fluorescence microscopy and transferred to 96-well plates for culture. The results showed that the 33 monoclone cells all successfully grew into monoclones, with a clone growth rate of 100%. PCR identification of these monoclone cells found that 31 clone cells (31 / 33) detected positive bands of inserted genes, with a positive clone success rate of 93.9% (31 / 33 x 100%). The results proved that the monoclone cell picking method based on the fluorescence antibody labeling method showed significant advantages in clone growth rate and positive clone success rate, and could effectively improve the screening efficiency and success rate of monoclone cells.

[0105] Experimental Examples The CIITA KO tEGFR KI -hiPSC cells provided in the embodiments were verified for function.

[0106] First Experimental Example AP staining (alkaline phosphatase staining) was used to detect the pluripotency of the CIITA KO tEGFR KI -hiPSC cells provided in the embodiments.

[0107] (1) The CIITA KO tEGFR KI -hiPSC cells were cultured to a cell confluence of 60%, and then the culture medium was discarded and the cells were washed twice with PBS for 5 seconds each time; (2) Cell fixation was performed using 4% neutral formaldehyde fixing solution, and fixed at room temperature for 15 minutes; (3) After fixation, PBS buffer was used for rinsing 3 times, 5 minutes each time; (4) Staining was performed using AP staining reagent, and the AP staining results are shown in Figure 7 As shown, the CIITA KO tEGFR KI -hiPSC cells showed obvious blue-purple color after staining, which indicated that there was high AP enzyme activity in the cells. Because AP activity is an important marker of pluripotent stem cells, this result indicates that the CIITA KO tEGFR KIThe hiPSC cells have good pluripotency.

[0108] The experiment proves that CIITA KO tEGFR KI The hiPSC cells can express high levels of alkaline phosphatase, indicating that they are in an undifferentiated state and have the characteristics of pluripotent stem cells.

[0109] Second experimental example RT-PCR (reverse transcription polymerase chain reaction) detects CIITA KO tEGFR KI The pluripotency gene expression of the hiPSC cells.

[0110] (1) CIITA KO tEGFR KI The total RNA of the hiPSC cells is extracted by the TRIzol method. (2) The extracted RNA is reverse transcribed into cDNA. (3) PCR amplification is performed, and SOX2, OCT4, NANOG, LIN28A primers and ACTB are used as internal references.

[0111] (4) The PCR products are analyzed by agarose gel electrophoresis, and CIITA KO tEGFR KI The RT-PCR results of the pluripotency gene expression of the CIITA Figure 8 hiPSC cell line are shown in KO tEGFR KI The clear bands of SOX2, OCT4, NANOG and LIN28A pluripotency genes in the CIITA

[0112] The experiment proves that CIITA KO tEGFR KI The hiPSC cells can express pluripotency markers SOX2, OCT4, NANOG and LIN28A at the transcriptional level, indicating that they are in an undifferentiated state and have the characteristics of pluripotent stem cells.

[0113] Third experimental example Immunofluorescence detects CIITA KO tEGFR KI The pluripotency protein expression of the hiPSC cells: (1) First, CIITA KO tEGFR KI-hiPSC cells were cultured to 60% confluence, the culture medium was discarded, and the cells were washed twice with PBS; (2) Cell fixation was performed using 4% neutral formaldehyde fixative for 15 minutes at room temperature; (3) After fixation, the cells were rinsed with PBS buffer for 3 times, 5 minutes each time; (4) Permeabilization was performed using Triton™ X-100 for 15 minutes at room temperature; (5) Blocking was performed using 5% goat serum for 30 minutes at room temperature; (6) Incubation was performed with primary antibodies specific for pluripotency markers, namely anti-SOX2, anti-OCT4 and anti-NANOG antibodies, overnight at 4°C; (7) Incubation was performed with fluorescently labeled secondary antibodies, followed by nuclear staining using DAPI; (8) Finally, the slides were mounted using anti-fade mounting medium, and observed and photographed under a fluorescence microscope. KO tEGFR KI The immunofluorescence results of the pluripotency proteins of the hiPSC cells are shown in Figure 9 As shown, the fluorescent signals of SOX2, OCT4 and NANOG proteins can be clearly observed in the cells, which are mainly concentrated in the nuclear region and highly coincide with the positions of the DAPI-stained nuclei, indicating that these pluripotency proteins have a high expression level in the nuclei. This further confirms that the KO tEGFR KI The hiPSC cells have good pluripotency, indicating that the KO tEGFR KI The hiPSC cells also maintain the pluripotency state at the protein expression level.

[0114] This experiment proves that the KO tEGFR KI The hiPSC cells can express the pluripotency markers SOX2, OCT4 and NANOG at the protein level, indicating that they are in an undifferentiated state and have the characteristics of pluripotent stem cells.

[0115] Fourth Experimental Example This experimental example is used to detect the CIITA KO tEGFR KI Killing effect of the CIITA KO tEGFR KI -hiPSC cells (tKI) under the action of cetuximab The cultured WT-hiPSC cells (WT) and CIITA KO tEGFR KI -hiPSC cells (tKI) were respectively added to the culture medium at a concentration of 2×104 Cell density was plated into 96-well plates. After 48h of culture, 10ug / ml cetuximab was added and incubated at 37℃ for 1h. Then PBNK cells were added with effector to target ratios of 1:1 / 3:1 / 5:1. Supernatants were collected after 12h for LDH activity detection and calculation of cell death rate. The results showed that when the effector to target ratio was 3:1 and 5:1, CIITA KO tEGFR KI -hiPSC group had higher cell death rate, indicating that after the addition of cetuximab, cetuximab combined with CIITA KO tEGFR KI -tEGFR on the surface of hiPSC cells recruited natural killer cells (NK cells) through antibody-dependent cellular cytotoxicity (ADCC) mechanism, and CIITA KO tEGFR KI -hiPSC cells were specifically eliminated, representing that when there were abnormalities in cell therapy, this method could serve as a safety switch. The results are shown in Figure 10 .

[0116] The function of tEGFR gene in CIITA KO tEGFR KI -hiPSC cells as a safety switch was successfully verified. Through experimental observation, it was found that CIITA KO tEGFR KI -hiPSC cells could effectively respond to the stimulation of cetuximab (Cetuximab) and achieve specific elimination through antibody-dependent cellular cytotoxicity (ADCC) mechanism. This result showed that the tEGFR safety switch played the expected regulatory role in the cell line, which could serve as a reliable safety mechanism for precise control of cell activity and reduction of potential treatment risks, providing strong support for subsequent clinical applications.

[0117] WT: refers to the WT-hiPSC cell control group, which is a hiPSC cell without gene editing; tKI: refers to CIITA KO tEGFR KI -hiPSC cells, which are cells with CIITA gene knockout and tEGFR gene knock-in of hiPSC cells.

[0118] The specific embodiments of the present application are described above. It should be understood that the present application is not limited to the above specific embodiments, and those skilled in the art can make various changes or modifications within the scope of the claims, which does not affect the essential content of the present application. In the case of no conflict, the embodiments of the present application and the features in the embodiments can be arbitrarily combined with each other.

Claims

1. A double-stranded DNA template for targeted knock-in of a tEGFR gene at a CIITA gene knockout site, characterized in that: The double-stranded DNA template comprises, from upstream to downstream, a CIITA left homology arm, a CMV enhancer, a chicken β-actin promoter, a chimeric intron, a Kozak sequence, a CSF2RA signal peptide, a tEGFR gene, a bGH polyadenylation signal, and a CIITA right homology arm; wherein the sequence of the CIITA left homology arm is SEQ ID NO: 12; the sequence of the CMV enhancer is SEQ ID NO: 13; the sequence of the chicken β-actin promoter is SEQ ID NO: 14; the sequence of the chimeric intron is SEQ ID NO: 15; the Kozak sequence is SEQ ID NO: 16; the sequence of the CSF2RA signal peptide is SEQ ID NO: 17; the sequence of the tEGFR gene is SEQ ID NO: 18; the sequence of the bGH polyadenylation signal is SEQ ID NO: 19; and the sequence of the CIITA right homology arm is SEQ ID NO: 20; the left homology arm and the right homology arm are used to determine the position of the double-stranded DNA template, the left homology arm DNA is homologous to the 5' end sequence of the DNA nick targeted by the gene site-directed knock-in, and the right homology arm is homologous to the 3' end sequence of the DNA nick; the CMV enhancer and the chicken β-actin promoter constitute an exogenous promoter (CAG promoter) to drive the expression of the knocked-in tEGFR gene.

2. A method for preparing low-immunogenic iPSC cells based on CIITA gene knockout and tEGFR gene knockin, characterized in that: The preparation method uses CRISPR-Cas9 technology to knock out the CIITA gene in iPSC cells and simultaneously knock in the tEGFR gene, wherein the double-stranded DNA template used for targeted knock-in of the tEGFR gene is as described in claim 1; the sgRNA binds to the exon region 2 and exon region 3 of the CIITA gene, and the required sgRNA sequence is designed based on the PAM sequence, i.e., the 20 bases in front of NGG.

3. The method for preparing low-immunogenic iPSC cells based on CIITA gene knockout and tEGFR gene knockin according to claim 2, characterized in that: The specific steps of the preparation method are as follows: S1. Design sgRNA sequence; S2. Prepare an RNP complex, wherein the RNP complex is composed of Cas9 protein and the sgRNA described in step S1; S3. Preparing a plasmid containing the tEGFR gene, wherein the plasmid comprises the double-stranded DNA template for targeted knock-in of the tEGFR gene at the CIITA gene knockout site according to claim 1; S4. Directly introducing the RNP complex from step S2 and the tEGFR plasmid from step S3 into iPSC cells to knock out the CIITA gene and simultaneously knock in the tEGFR gene, thereby obtaining low immunogenic iPSC cells based on CIITA gene knockout and tEGFR gene knock-in; S5. The low immunogenicity iPSC cells prepared in step S4 are screened for successfully transfected positive low immunogenicity iPSC cells using a monoclonal cell picking method based on fluorescent antibody labeling, and the successfully transfected positive low immunogenicity iPSC cells are identified for pluripotency.

4. The method for preparing low-immunogenic iPSC cells based on CIITA gene knockout and tEGFR gene knockin according to claim 3, characterized in that: In step S4, electrotransfection is performed using an electroporator.

5. The method for preparing low-immunogenic iPSC cells based on CIITA gene knockout and tEGFR gene knockin according to claim 4, characterized in that: The electroporation parameters are as follows: iPSC cells 1×10 4 -3×10 4 , Cas9 protein 30-50 pmol, sgRNA 50-100 pmol, and plasmid containing tEGFR gene 1-3 ug.

6. The method for preparing low-immunogenic iPSC cells based on CIITA gene knockout and tEGFR gene knockin according to claim 3, characterized in that: In step S5, when fluorescently labeled monoclonal cells are directly picked under a fluorescence microscope for pluripotency identification, PBS is added to disperse the cells.

7. A low immunogenic iPSC cell based on CIITA gene knockout and tEGFR gene knockin, characterized in that: The low-immunogenicity iPSC cell is prepared according to the method for preparing low-immunogenicity iPSC cells based on CIITA gene knockout and tEGFR gene knockin as described in any one of claims 2 to 6.

8. The low immunogenic iPSC cells based on CIITA gene knockout and tEGFR gene knock-in according to claim 7 have at least the following applications: a. Application in the preparation of universal cells with low immunogenicity; b. Application in the preparation of products for suppressing immune rejection reactions.

Images