Peach PpICL1 gene and application thereof in reducing content of citric acid in fruits

Abstract

The invention belongs to the field of plant molecular biology, and discloses a peach PpICL1 gene for coding peach isocitrate lyase and application of the peach PpICL1 gene in reducing the content of citric acid in fruits. The amino acid sequence coded by the gene is as shown in SEQ ID No.2. The peach PpICL1 gene for coding peach isocitrate lyase can be used for reducing the content of citric acid in peach fruits and improving the taste of the peach fruits, and has practical value.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of plant molecular biology, and particularly relates to a peach PpICL1 gene encoding peach isocitrate lyase and application thereof in reducing content of citric acid in fruits. BACKGROUND

[0002] Peach (Prunus persica (L.) Batsch), a member of Rosaceae, is an important fruit crop with high economic value. Fruit quality depends on fruit flavor, which directly affects the commercial value of fruit. Organic acid content is the main factor affecting fruit flavor. In mature peach fruit, organic acids are mainly composed of citric acid and malic acid. However, the molecular regulatory mechanism of citric acid accumulation in peach fruit has not been fully elucidated. According to previous research results, the major gene regulating citric acid content in peach fruit is located at the front end of chromosome 5, which is called D gene (Doux, French, meaning'sweet'). In recent years, although many scientists have extensively mined key genes within the D locus and proposed many candidate genes (Cao K, et al. Genome-wide association study of 12 agronomic traits in peach. Nat Commun. 2016;7:13246; Wang L, et al. A candidate PpRPH gene of the D locus controlling fruit acidity in peach. Plant Mol Biol. 2020; Wang Q, et al. Multi-omics approaches identify a key gene, PpTST1, for organic acid accumulation in peach. Hortic Res. 2022), but there is still no definitive conclusion, and further research is needed.In addition, some enzyme genes in the anabolism pathway of organic acids were also reported to have significant differences in expression levels between high-acid and low-acid peach varieties, such as pyruvate dehydrogenase kinase (PDK), pyruvate kinase (PK), alcohol dehydrogenase (ADH), glutamate decarboxylase (GAD), and other enzymes in the anabolism pathway of citric acid (Famiani F, et al. Phosphoenolpyruvate carboxykinase, pyruvate orthophosphate dikinase and isocitrate lyase in both tomato fruits and leaves, and in the flesh of peach and some other fruits. J Plant Physiol. 2016, 202: 34-44; Zheng B, et al. Assessment of organic acid accumulation and its related genes in peach. Food Chem. 2021, 334: 127567). There is currently no report on the role of isocitrate lyase (ICL) in regulating the content of citric acid in peach fruits.

[0003] ICL is a key enzyme in the glyoxylate cycle, which is responsible for the decomposition of isocitrate into succinate and glyoxylate. The glyoxylate cycle, as a branch of the tricarboxylic acid cycle, connects lipid metabolism and gluconeogenesis pathways and is widely present in plants, bacteria, and fungi. Currently, two types of ICL have been found: one is the glyoxysomal type, and the other is the cytosolic type. A suspected mitochondrial type of ICL has also been found in pea leaves, which may be involved in the synthesis of glycine and serine. There are few reports on ICL, and most of them focus on the glyoxysomal type. Its function is mainly related to the decomposition of lipids in the germination process of oil seeds, fern spores, and pollen grains (Igamberdiev AU, Lea PJ. The role of peroxisomes in the integration of metabolism and evolutionary diversity of photosynthetic organisms. Phytochemistry. 2002, 60: 651–74). In addition, some studies have shown that ICL in cucumber fruits is related to the content of organic acids under certain environmental stress, such as high-concentration CO2 environment (Yang Y, et al. Activation of glyoxylate cycle enzymes in cucumber fruits exposed to CO2. Plant Cell Physiology. 1998; 5: 533–9). A recent study suggests that ICL can also promote the susceptibility of wheat to Puccinia striiformis f. sp. tritici (Ibe CN, Bailey SL, Korolev AV. et al. Isocitrate lyase promotes Puccinia striiformis f. sp. tritici susceptibility in wheat (Triticum aestivum) by suppressing accumulation of glyoxylate cycle intermediates. Plant J. 2024), indicating that ICL has potential value in plant disease resistance.In addition to glyoxylate-type ICL, the functional research of other types of ICL is very limited, and it is speculated that cytoplasmic ICL may be involved in the transformation between organic acids (Eprintsev AT, Fedorin DN, Salnikov AV. et al. Expression and properties of the glyoxysomal and cytosolic forms of isocitrate lyase in Amaranthus caudatus L. J Plant Physiol. 2015;181: 1-8), but there is still a lack of experimental evidence. There is still a lot of space for the functional research of ICL; the utilization of its coding gene is still blank, so the functional analysis and application of peach ICL gene not only have great reference value for peach but also for the functional research of homologous genes of other species. SUMMARY

[0004] The present application is completed by finding that the expression abundance of a peach PpICL1 gene encoding peach isocitrate lyase changes with the development of fruits, and ultimately confirming that it plays an important role in the degradation of citric acid during the fruit ripening period.

[0005] The present application provides a peach PpICL1 gene encoding peach isocitrate lyase, characterized in that the amino acid sequence encoded by the gene is shown in SEQ ID No. 2.

[0006] Specifically, the nucleotide sequence thereof is shown in SEQ ID No. 1, or a nucleotide sequence that is substituted, deleted and / or increased by one or more nucleotides and expresses the same functional protein; or a nucleotide sequence that has more than 90%, or more than 95%, or more than 99% homology with the nucleotide sequence shown in sequence 1 and expresses the same functional protein.

[0007] The present application further provides a protein encoded by the peach PpICL1 gene encoding peach isocitrate lyase.

[0008] Specifically, the amino acid sequence thereof is shown in SEQ ID No. 2.

[0009] The present application also provides a recombinant vector containing the peach PpICL1 gene encoding peach isocitrate lyase.

[0010] Specifically, it is a plant transformation vector.

[0011] The present application also provides the application of the peach PpICL1 gene encoding peach isocitrate lyase or the protein encoded thereby in reducing the content of citric acid in peach fruits.

[0012] Specifically, the application is to apply the encoded protein to peach fruit; or to reduce the content of citric acid in peach fruit by transgenic method of instant transformation of the encoding gene in fruit.

[0013] Preferably, the encoded protein is applied or the encoded gene is instantaneously transformed at the fruit ripening stage.

[0014] Further specifically, the encoding gene is overexpressed in peach by transgenic method to obtain transgenic plants with reduced content of citric acid in fruit; optionally, further comprising breeding to obtain transgenic varieties with reduced content of citric acid.

[0015] The peach PpICL1 gene encoding peach isocitrate lyase mined by the present application can be applied to reduce the content of citric acid in peach fruit, improve the taste of peach fruit, and has practical value. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 , expression pattern of PpICL1 in high-acid / low-acid fruit.

[0017] Figure 2 , PpICL1 expression abundance is negatively correlated with the content of citric acid in peach fruit.

[0018] Figure 3 , transient overexpression of PpICL1 gene (B) reduces the content of citric acid in fruit (A).

[0019] Figure 4 , co-localization analysis of PpICL::GFP and AtLACS6::mcherry (A) and PpTST1::mcherry (B). DETAILED DESCRIPTION

[0020] The present application is further described in detail below in conjunction with specific examples.

[0021] Example 1: Mining of PpICL1 gene

[0022] In the early stage, by comparing the transcriptome data of two high-citric acid peach varieties ('Honggang' and 'Tubade') and two low-citric acid peach varieties ('Dubaifeng' and 'Yutian') at four fruit development stages (S1-S4, including 10 sampling time points T1-T10), the results showed that the expression abundance of a peach isocitrate lyase (ICL) encoding gene PpICL1 (GenBank ID: PRUPE_3G219100) increased with fruit development and decreased rapidly when the fruit was fully ripe. In addition, the expression abundance of PpICL1 in high-acid varieties was significantly lower than that in low-acid varieties at the end of S3 (T8) and the beginning of S4 (T9), when the citric acid content of the fruit was rapidly decreasing ( Figure 1 ), we therefore speculate that PpICL1 plays an important role in the degradation of citric acid during fruit ripening.

[0023] Example 2: PpICL1 gene is negatively correlated with citric acid content in peach fruit

[0024] Thirty-seven peach mesocarp tissue samples were collected at the S3 stage. Total RNA was extracted using the RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (DP441) from Tiangen Biochemical Technology (Beijing) Co., Ltd. RNA quality was assessed by gel electrophoresis and quantified using a DeNovix DS-11+ ultramicro-spectrophotometer. 1 μg of total RNA was reverse transcribed into cDNA using the Evo M-MLV Reverse Transcription Kit (AG11705) from Aikerui Biotechnology Co., Ltd. A primer pair for qRT-PCR detection (upstream primer: 5'ATGGAAGAAGAAGGAAGGTTTGA 3'; downstream primer: 5'CATTTGAGCCATAGC TTTGTCTA 3') was designed based on the coding region sequence and intron location of the PpICL1 gene. The Actin (PRUPE_6G163400) gene was used as the internal reference gene. A primer pair (upstream primer: 5'GTTATTCTTCATCGGCGTCTTCG 3'; downstream primer: 5'CTTCACCATTCCAGTTCCATTGTC 3'); qRT-PCR reaction was performed using the SYBR Green dye method, and the product used was the SYBR Green ProTaq HS premixed qPCR kit (AG11701) from Acryl Biotechnology Co., Ltd. The PCR reaction was performed according to the product instructions, and the amplification results were analyzed by 2 -ΔΔCt The relative expression level of PpI CL1 in each sample was calculated.

[0025] High-performance liquid chromatography (HPLC) was used to determine the citric acid content in the pulp (mesocarp) of the 37 peaches. 0.3–0.4 g of ground peach tissue samples were weighed and soaked overnight in anhydrous ethanol at a 3:7 (m:v) ratio to fully dissolve the organic acids in the pulp. The mixture was then centrifuged to remove the pulp residue, and the supernatant was filtered and used for later analysis. An HPLC system (LC-20A, Shimadzu) was used for analysis of the organic acid components. A C18 column (250 mm × 4.6 mm, GL Sciences Inc.) was used for sample separation, and a photodiode array detector (SPD-M20A) was used for citric acid detection.

[0026] The Pearson method was used to analyze the correlation between PpICL1 gene expression and citric acid content ( Figure 2 The results showed that the expression abundance of PpICL1 was significantly negatively correlated with the citric acid content in peach fruit (P=0.0007945), indicating that PpICL1 may be involved in the negative regulation of citric acid accumulation in peach fruit.

[0027] Example 3: PpICL1 gene cloning and sequence analysis

[0028] Using the mesocarp tissue of 'Longhua Shuimi' peach as the experimental material, total RNA was extracted and reverse transcribed into cDNA (the method was the same as in "Example 2"); specific primers were designed to amplify the full-length PpICL1 coding region (upstream primer: 5'ATGGCTGCATCTTACTCAGTGC3'; downstream primer: 5'TTACATTCTTGCCTTGGCAATC 3'); the PCR reaction system was as follows: 2×Phanta Max MasterMix (Vazyme P525) 25 μL, 2 μL of upstream and downstream primers (10 μM), and 2 μL of template cDNA (50 ng / μL). PCR amplification procedure: initial denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 58°C for 15 s, and extension at 72°C for 2 min, for 35 cycles; and complete extension at 72°C for 5 min. PCR products were recovered and ligated into T-vectors and transformed into DH5α competent cells. Positive clones were selected and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing, resulting in a 1728-bp PpICL1 coding sequence (SEQ ID No. 1):

[0029] ATGGCTGCATCTTACTCAGTGCCTTCAATGATAATGGAAGAAGAAGGAAGGTTTGAAGCC

[0030] GAGGTAGCAGATGTGCAGGCATGGTGGGGCTCAGAGAGGTTCAAGCTAACAAAACGTCCA

[0031] TACGCAGCTAAAGATGTTGTGGCACTAAGAGGGACCCTTAGACAAAGCTATGGCTCAAAT

[0032] GAAATGGCCAAAAAGCTGTGGAGAACTCTCAAAACTCATCAAGCCAACGGCACATCCTCA

[0033] AGAACTTTTGGTGCACTAGACCCTGTCCAAGTCACCATGATGGCCAAGCATTTGGACACC

[0034] ATTTATGTCTCCGGTTGGCAATGCTCTTCTACACACACCAGCACCAATGAGCCTGGTCCT

[0035] GACCTTGCTGATTACCCCTATGACACCGTCCCAAACAAGGTGGAGCATTTGTTTTTCGCA

[0036] CAACAATACCATGATCGCAAGCAAAAAGAGGCGCGGATGAGCATGAGCCGGGAAGAGAGG

[0037] GCTAGAACCCCTTATATTGATTACTTGAAGCCAATAATTGCTGATGGTGATACTGGTTTT

[0038] GGTGGCACCACAGCAACTGTTAAGCTTTGCAAGCTTTTTGTGGAGCGTGGCGCTGCTGGT

[0039] GTTCACATTGAGGACCAGTCCTCTGTGACCAAAAAATGTGGTCACATGGCAGGGAAAGTG

[0040] CTTGTTTCTGTTGGTGAACATATTAATAGACTTGTGGCTGCAAGGTTGCAATTTGATGTC

[0041] ATGGGAACTGAGACTGTCTTGGTGGCTAGAACTGATGCAGTTGGCGCTACTTTGATCCAG

[0042] ACCAATGTGGACACCAGAGACCATCAGTTTATATTTGGGGTAACAAACCCGAATCTCAGA

[0043] GGGAAGAGTTTGGCTACCCTTCTAGCTGAAGCCATGGCTGCTGGAAAAACTGGAGCTGAG

[0044] CTGCAAGCCCTTGAGGACAATTGGATTTCAATGGCACAGTTGAAGACATTTTCTGAATGT

[0045] GTCACAGATGCAATTAAGGCCATGAACTTCGTTGAACATGAGAAAAGGAGGAGACTGAAC

[0046] GAATGGATCAACCATTCTAGCCCTGATAAGTGTTTGTCAAATGAGAAAGGCCGCGAGATT

[0047] GCTGAGAGGTTGGGGCTTAAGAACCTCTTCTGGGACTGGGACTTGCCTAGGACCAGAGAA

[0048] GGGTTCTATAGGTTCAAAGGGTCTGTGATGGCAGCTGTTGTGCGTGGCTGGGCTTTTGCT

[0049] GATCATGCTGATATTATTTGGATGGAGACAGCGAGCCCCGACATGGTTGAGTGCACCCAA

[0050] TTTGCTGAGGGGGTGAAGTCTCTGCAGCCTGAGGTCATGTTGGCTTATAATCTATCACCG

[0051] TCTTTCAATTGGGATGCATCTGGAATGACTGATGATCAAATGAAGGACTTCATTCCAAGG

[0052] ATAGCAAAGTTGGGGTACTGCTGGCAGTTTATAACACTGGCTGGTTTCCATGCTGATGCG

[0053] CTTGTGGTCGACACTTTCGCAAAGGACTATGCTAGGAGGGGAATGCTGGCTTATGTTGAG

[0054] AGGATCCAGAGGGAGGAGAGGAACAATGGAGTTGACACACTTGCTCATCAGAAATGGTCT

[0055] GGTGCTAATTTCTATGATAGGTACCTTAAGACTGTCCAGGGAGGCATTTCTTCAACTGCT

[0056] GCTATGGGCAAAGGAGTGACTGAAGAACAATTCAAAGAATCATGGACCAGGTCAGGATCCACAGATCTGAGTGAAGGAAATGTTGTGATTGCCAAGGCAAGAATGTAA.

[0057] The peach PpICL1 gene encodes a protein consisting of 575 amino acids, and the amino acid sequence (SEQ ID No. 2) is: MAASYSVPSMIMEEEGRFEAEVADVQAWWGSERFKLTKRPYAAKDVVALRGTLRQSYGSNEMAKKLWRTLKTHQANGTSSRTFGALDPVQVTMMAKHLDTIYVSGWQCSSTHTSTNEPGPDLADYPYDTVPNKVEHLFFAQQYHDRKQKEARMSMSREERARTPYIDYLKPIIADGDTGFGGTTATVKLCKLFVERGAAGVHIEDQSSVTKKCGHMAGKVLVSVGEHINRLVAARLQFDVMGTETVLVARTDAVGATLIQTNVDTRDHQFIFGVTNPNLRGKSLATLLAEAMAAGKTGAELQALEDNWISMAQLKTFSECVTDAIKAMNFVEHEKRRRLNEWINHSSPDKCLSNEKGREIAERLGLKNLFWDWDLPRTREGFYRFKGSVMAAVVRGWAFADHADIIWMETASPDMVECTQFAEGVKSLQPEVMLAYNLSPSFNWDASGMTDDQMKDFIPRIAKLGYCWQFITLAGFHADALVVDTFAKDYARRGMLAYVERIQREERNNGVDTLAHQKWSGANFYDRYLKTVQGGISSTAAMGKGVTEEQFKESWTRSGSTDLSEGNVVIAKARM.

[0058] Example Four: Transient transformation of PpICL1 gene reduces the content of citric acid in fruit

[0059] 1. Construction of pGreenII 62-SK-PpICL1 plant transformation vector

[0060] The pGreenII 62-SK vector was purchased from Beijing Huayueyang Biotechnology Co., Ltd.; the PpICL1 full-length coding region amplification primer pair (upstream primer: downstream primer: ), the primer introduced Sac I and Eco R I enzyme cutting sites (underlined) and protection base (bold) at both ends; PCR reaction system was as follows: 2 x Phanta Max Master Mix (Vazyme P525) 25 μL, 2 μL of each of upstream and downstream primers (10 μM), 2 μL of template cDNA (50 ng / μL); PCR amplification procedure: pre-denaturation: 95 °C for 3 min; denaturation 95 °C for 15 s, annealing 58 °C for 15 s, extension 72 °C for 2 min, 35 cycles; complete extension 72 °C for 5 min; the PCR product was digested with Sac I / Eco R I, and then connected with Sac I / Eco R I linearized pGreen II 62-SK vector by using DNA ligation kit (Beijing Aikangke Biological Technology Co., Ltd. AG11801); the ligation product was transformed into DH5α competent cells (Beijing Bomeide Gene Technology Co., Ltd. BC116), and screened on LB (containing 50 mg / mL Kan) medium, and the clones were picked and sent to Beijing Qikexing Biological Technology Co., Ltd. for sequencing identification.

[0061] 2. Transformation of Agrobacterium GV3101

[0062] Agrobacterium GV3101 competent cells were purchased from Beijing Bomeide Gene Technology Co., Ltd. (BC314-01). 1 μg of the correctly sequenced pGreen II 62-SK-PpICL1 recombinant plasmid was used for Agrobacterium transformation, and the transformation method was referred to the product instruction; the transformation product was screened on LB medium containing 50 μg / mL Kan and 50 μg / mL Rif; positive clone test was performed by using colony PCR method, and the PCR reaction system was as follows: 2 x GS Taq PCR Mix (Beijing Jinsha Biological Technology Co., Ltd. ST111) 10 μL, 1 μL of each of upstream and downstream primers (10 μM), 1 μL of bacterial solution, and water was added to 20 μL; the PCR amplification procedure was referred to the product instruction; the PCR product was sent to Beijing Qikexing Biological Technology Co., Ltd. for sequencing detection.

[0063] 3. Transient overexpression of PpICL1 reduces the content of citric acid in peach pulp

[0064] The test materials were collected from “National Fruit Tree Germplasm Beijing Peach and Strawberry Garden Resource Garden” (Beijing). The peach fruits without diseases and pests, mechanical damage, and entering the mature stage were selected for Agrobacterium infection.

[0065] Agrobacterium containing pGreen 62-SK-PpICLl recombinant plasmid and pGreen 62-SK empty vector were activated on LB solid medium (50 μg / mL Kan, 50 μg / mL Rif); single colony was picked and cultured in LB liquid medium (50 μg / mL Kan, 50 μg / mL Rif, 10 mM MES, 40 mM AS) to OD 600 = 0.8 - 1.0; bacterial cells were collected by centrifugation, resuspended with infiltration solution (10 mM MES, 10 mM MgCl2, 150 mM AS, 0.04% Silwet L-77, pH 5.6), and adjusted to OD 600 = 0.4 - 0.5, and incubated at room temperature for 2 h.

[0066] The test material was washed clean, and the fruit surface was disinfected with 75% alcohol and sodium hypochlorite solution (effective chlorine content 75 - 100 mg / L), rinsed with sterile water 3 times, and dried on a clean bench; two faces perpendicular to the fruit suture were selected, and each was cut into a fruit pulp slice with a thickness of about 0.5 cm, and the outer pericarp was carefully removed; each fruit pulp slice was then divided into two small slices, and placed on two MS solid media, respectively, for infection with Agrobacterium containing PpICLl overexpression vector and control vector, and 4 - 5 slices were placed on each medium as a group; 25°C dark incubation for 24 h (pre-culture).

[0067] The pre-cultured fruit pulp slices were immersed in Agrobacterium infection solution with the corresponding vector in a clean bench, vacuum (-70 kP) filtration for 15 min, so that Agrobacterium was immersed into the fruit pulp tissue; then rinsed with sterile water 6 - 8 times to remove as much Agrobacterium attached to the surface as possible; the fruit pulp slices were placed on sterile filter paper, dried thoroughly, and then transferred to new MS solid medium for incubation for 48 h.

[0068] 0.3 - 0.4 g of treated fruit pulp tissue was taken along the outside, and the corresponding volume of absolute ethanol was added at a ratio of 3:7 (m / v) for organic acid content detection; the rest of the tissue was rapidly frozen in liquid nitrogen and stored in a -80°C refrigerator for gene expression detection. qRT-PCR and citric acid detection methods are the same as in "Example Two".

[0069] The results showed that the fruit citric acid content in the peach fruit peel tissue transiently overexpressing PpICLl was significantly lower than that in the control (fruit peel tissue transformed with empty vector) Figure 3 , indicating that PpICLl negatively regulates the accumulation of peach fruit citric acid.

[0070] Example Five: PpICLl is located in the cytoplasm

[0071] To identify whether PpICL1 is peroxisomal or cytosolic, we constructed PpICL1 ::GFP fusion protein (green light) for subcellular localization analysis. To accurately determine the subcellular localization position, we cloned a known peroxisomal-localized gene AtLACS6 (AT3G05970) (Fulda M, et al. Two long-chain acyl-CoA synthetases from Arabidopsis thaliana involved in peroxisomal fatty acid beta-oxidation. Plant J. 2002, 32:93-103) as a peroxisomal-localized marker, and constructed AtLACS6 ::mcherry fusion protein (red light). Since more than 90% of the volume of mature leaf cells is occupied by vacuoles, all cytoplasm and organelles are squeezed into the area between the cell membrane and the vacuole membrane, and the subcellular structure is difficult to distinguish, we also constructed a vacuole membrane-localized marker to determine whether PpICL1 ::GFP is cytosolic. We selected a known peach vacuole membrane-localized gene PpTST1 (Prupe.5G00630) (Wang Q, et al. Multi-omics approaches identify a key gene, PpTST1, for organic acid accumulation in peach. Hortic Res. 2022, 9:uhac26.) as a vacuole membrane-localized marker, and constructed PpTST1 ::mcherry fusion protein (red light).

[0072] 1. Construction of PpICL1 ::GFP fusion expression vector

[0073] The vector plasmid pGeenII0029-GFP was kindly provided by Wang Hongzhi Laboratory of Beijing Academy of Agriculture and Forestry Sciences. The specific amplification primer pair of the full-length PpICL1 coding region was designed, the stop codon was removed, and the corresponding vector sequence (underlined part) was added at the 5' end according to the multiple cloning site on the pGeenII0029-GFP vector. The primer pair was synthesized by Beijing Qikexing Biotechnology Co., Ltd. (upstream primer: ATTTGGAGAGGACAGCCCAAGCTT ATGGCTGCATCTTACTCAGTGC; downstream primer: CCTGGATCCTCTA GAGTCGAAGCTTCATTCTTGCCTTGGCAATC); PCR system and reaction parameters are the same as "Example Three"; pGreenll029-GFP is digested with Hind III, purified to obtain linearized vector plasmid; PCR product and linearized vector fragment are connected using seamless cloning technology to construct recombinant plasmid, and the connection method refers to the Uniclone one step seamless cloning Kit reagent box (SC612) instruction manual of Beijing Jinsha Biotechnology Co., Ltd.

[0074] 2, Construction of AtLACS6::mcherry and PpTST1::mcherry fusion expression vectors

[0075] Fresh Arabidopsis thaliana leaf total RNA is extracted using RNAprep Pure Plant Total RNA Extraction Kit (DP432) of Tiangen Biosciences Beijing Co., Ltd., and 1 μg of total RNA is reverse transcribed into cDNA (method same as "Example Two") as a PCR amplification template. According to the coding region sequence of Arabidopsis thaliana LACS6 gene and PpTST1 gene, amplification primers (LACS6 upstream primer: downstream primer: PpTST1 upstream primer: downstream primer: ) are designed, the stop codon is removed, and the target gene product is fused and expressed with mcherry fluorescent protein gene, and Pac I and Asc I restriction enzyme sites (underlined) and their protection bases (bold) are introduced at both ends of the sequence; PCR reaction is as follows: 2x Phanta Max Master Mix (Vazyme P525) 25 μL, 2 μL of each of upstream and downstream primers (10 μM), 100 ng of template cDNA, and water to 50 μL; PCR amplification program: pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 15 s, annealing at 58 °C for 15 s, extension at 72 °C for 2 min, 35 cycles; complete extension at 72 °C for 5 min; PCR product and vector plasmid pMDC85-mcherry are digested with Pac I and Asc I, purified, and then connected by DNA ligation kit (Beijing Aikangrui Biological Technology Co., Ltd. AG11801); the ligation product is transformed into E. coli DH5a competent cells, screened on LB medium containing 50 mg / mL Kan, single colonies are picked for colony PCR identification, and positive clones containing the target fragment are sent to Beijing Qinkai Biological Engineering Co., Ltd. for sequencing identification.

[0076] The sequencing correct plasmids pGeen II 0029-PpICLl-GFP, pMDC85-AtLACS6-mcherry and pMDC85-PpTSTl-mcherry were transformed into Agrobacterium GV3101 (pSoup) (Beijing Biomed Gene Technology Co., Ltd., BC314-01) and the transformation method and positive colony identification were the same as "Example 4".

[0077] 3. Agrobacterium infection of tobacco leaves

[0078] The Agrobacterium containing the plasmids pGeen II 0029-PpICLl-GFP, pMDC85-AtLACS6-mcherry and pMDC85-PpTSTl-mcherry was inoculated into 100 mL of LB liquid medium (containing 50 μg / mL Kan, 50 μg / mL Rif) and cultured overnight at 28°C to OD 600 = 0.8-1.0; the bacterial cells were collected by centrifugation at 5000 rpm for 5 min; 100 mL of infection solution (10 mM MES pH=5.7, MgCl2 1 mM, acetosyringone 0.2 mM) was added to resuspend the bacterial cells, which were collected by centrifugation at 5000 rpm for 5 min; 5 mL of infection solution was added to resuspend the bacterial cells, which were adjusted to OD 600 = 0.3-0.5; the PpICLl-GFP and AtLACS6-mcherry infection solutions and the PpICLl-GFP and PpTSTl-mcherry infection solutions were mixed in equal proportions and allowed to stand at room temperature for 3 h; 6-week-old Nicotiana benthamiana plants in good growth condition were selected and 2 mL of the treated infection solution was taken up with a sterile syringe, the needle was gently inserted into the back of the leaf and the syringe was pushed slowly to allow the infection solution to spread throughout the leaf; the infected leaf was cultured in the dark overnight and then transferred to a light incubator for further culture for one day; the epidermal cells on the back of the leaf were taken to prepare temporary slides, which were observed under a laser confocal fluorescence microscope.

[0079] 4. Laser confocal microscope observation of PpICLl::GFP subcellular localization

[0080] Observation was performed using Nikon A1 confocal microscope system. The excitation wavelengths for GFP and mCherry were 488 nm and 561 nm, respectively. In the co-expression experiment of PpICL1 ::GFP and AtLACS6::mcherry, the observation results showed that the two were obviously not located on the same cell structure, i.e. the green fluorescence of the former was distributed in the cell cortex region, while the red fluorescence of the latter was distributed on the organelle of glyoxylate cycle in the form of dots; in the co-expression experiment of PpICL1 ::GFP and PpTST1 ::mcherry, the observation results showed that the signals of the two partially overlapped, but in the region indicated by the arrow, PpTST1 ::mcherry was obviously distributed on the membrane structure, while PpICL1 ::GFP was dispersed in the cytoplasmic structure, indicating that PpICL1 was a cytoplasmic ICL. Figure 4

[0081] In summary, PpICL1 encodes a cytoplasmic isocitrate lyase, which negatively regulates the accumulation of fruit citric acid during the ripening period of peach fruit.​

Claims

1. A peach encoding peach isocitrate lyase PpICL1 A gene characterized by The amino acid sequence encoded by it is shown in SEQ ID No.

2.

2. The peach encoding peach isocitrate lyase according to claim 1 PpICL1 A gene characterized by The nucleotide sequence is as shown in SEQ ID No. 1, or a nucleotide sequence thereof in which one or more nucleotides are substituted, deleted and / or added and which expresses a protein with the same function; or a nucleotide sequence that is more than 90%, more than 95%, or more than 99% homologous to the nucleotide sequence shown in SEQ ID No. 1 and expresses a protein with the same function.

3. The peach encoding peach isocitrate lyase according to claim 1 or 2 PpICL1 Protein encoded by a gene.

4. The protein according to claim 3, characterized in that Its amino acid sequence is shown in SEQ ID No.

2.

5. A peach protein comprising the encoding peach isocitrate lyase according to claim 1 or 2 PpICL1 Recombinant gene vector.

6. The recombinant vector according to claim 5, characterized in that It is a plant transformation vector.

7. The peach encoding peach isocitrate lyase according to claim 1 or 2 PpICL1 Application of a gene, or its encoded protein, in reducing the citric acid content in peach fruit.

8. The method according to claim 7, characterized in that The application is to apply the coding protein to peach fruit; or to transform the coding gene into the fruit transiently through a transgenic method to reduce the citric acid content in the peach fruit.

9. The method according to claim 7, characterized in that: The encoding protein is applied or the encoding gene is transiently transformed during the fruit ripening stage.

10. The method according to claim 5, characterized in that The encoding gene is overexpressed in peaches by a transgenic method to obtain transgenic plants with reduced citric acid content in the fruit; optionally, the method further includes breeding transgenic varieties with reduced citric acid content.

Images