Biomarker for diagnosis or prognosis evaluation of lung adenocarcinoma and application of biomarker

Abstract

The invention discloses application of SnoRD14E as a lung adenocarcinoma treatment target and a prognostic marker, and belongs to the technical field of biological medicine. According to the invention, it is found for the first time that SnoRD14E can be used as a treatment target and a prognosis marker of lung adenocarcinoma, and a new idea is provided for treatment and prognosis of lung adenocarcinoma; researches show that compared with normal tissues, SnoRD14E is highly expressed in tumor tissues of lung adenocarcinoma patients, and the SnoRD14E as a molecular marker has good clinical application value; the research result shows that the silent SnoRD14E can inhibit the proliferation, invasion and migration of lung adenocarcinoma cells, shows that the SnoRD14E plays a role in promoting cancer genes in the development process of lung adenocarcinoma, and is expected to become a new target spot for treating lung adenocarcinoma.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of biological medicine, and particularly relates to a biomarker for diagnosis or prognosis evaluation of lung adenocarcinoma and application thereof. BACKGROUND

[0002] Lung cancer is one of the most common malignant tumors in clinical practice, seriously threatening global human health, and its incidence and mortality rate ranks first among malignant tumors. Due to insufficient early diagnosis and chemotherapy resistance during treatment, the prognosis of lung cancer is poor, 70% of patients are in the advanced stage at the initial diagnosis, and the 5-year survival rate of lung cancer patients is only 21%. The recurrence of lung cancer and the metastasis of lung cancer cells are the main reasons for the failure of treatment. In addition, traditional identifiable clinical and case symptoms have great defects in the targeted treatment of lung adenocarcinoma and the prediction of the prognosis of lung adenocarcinoma, and at the same time, the timely and accurate treatment of lung adenocarcinoma directly affects the prognosis of lung adenocarcinoma patients, so it is urgent to find new high-sensitivity and high-specificity lung adenocarcinoma treatment targets, improve the prognosis of lung adenocarcinoma patients, and improve the quality of life of patients.

[0003] Small nucleolar RNA (SnoRNAs) is a class of non-coding small RNAs with a length of 60-300 nt, which mainly accumulates in the nucleolus or nucleolus Cajal body rich in RNA and RNA-binding protein (RBP). They guide the RNA-dependent modification and maturation of ribosomal RNA (rRNA), small nuclear RNA (SnRNA) and other cellular RNAs by forming small nucleolar ribonucleoprotein (SnoRNP) complexes with RBP and other proteins. SnoRNAs are essential for cell life activities, and the core function is responsible for RNA post-transcriptional modification and maturation, which can methylate and pseudouridylate modify rRNA and tRNA to ensure accurate and efficient protein synthesis. In addition, more and more studies have shown that it is widely involved in individual development, neural development, immune regulation and other processes, and regulates individual lifespan, affects neural cell differentiation, migration and synapse formation, and regulates immune cell function and immune response.

[0004] In recent years, the relationship between SnoRNAs and cancer has become a research hotspot in the field of cancer research, and more and more SnoRNAs have been proved to be abnormally expressed in various cancers of human beings, and it has been found that SnoRNAs are related to tumor cell proliferation, invasion, migration, apoptosis, etc., that is, SnoRNAs play an important role in the biological process of tumors, and gradually become related markers for the treatment and prognosis of tumors. Therefore, exploring SnoRNAs as a treatment target and prognosis marker for lung adenocarcinoma has far-reaching clinical significance. SUMMARY

[0005] The present application proposes a new marker for diagnosis or prognosis evaluation of lung adenocarcinoma in view of the problems existing in the traditional treatment and prognosis of lung adenocarcinoma.

[0006] To achieve the above object, the present application is implemented by using the following technical scheme:

[0007] A diagnostic marker for lung adenocarcinoma, comprising SnoRD14E.

[0008] The deoxyribonucleotide sequence of SnoRD14E is: NR_003125.2

[0009] ATGATGAATGGTCCAAAACATTCGCGGTTTCCACCAGAATTCAAGGT GTTGGCAACTACCTTCCTTGGATGTCTGAGTGA

[0010] In a second aspect, the present application provides the use of the above-mentioned SnoRD14E as a prognostic marker for lung adenocarcinoma.

[0011] The expression level of SnoRD14E in lung adenocarcinoma patients is significantly increased, and its high expression is closely related to the poor prognosis of patients, so it can be inferred that SnoRD14E can be used as a prognostic marker for lung adenocarcinoma patients.

[0012] In a third aspect, the present application also provides the use of SnoRD14E in the treatment of lung adenocarcinoma drugs, which can inhibit the proliferation and metastasis of lung adenocarcinoma cells, and can be used as a therapeutic target molecule for lung adenocarcinoma.

[0013] Plate colony formation experiment and EdU experiment show that after knocking down SnoRD14E, the proliferation ability of lung adenocarcinoma cells is significantly inhibited. The results of scratch test and Transwell migration experiment show that after knocking down SnoRD14E, the invasion and migration ability of lung adenocarcinoma cells is significantly reduced.

[0014] Compared with the prior art, the present application has the following advantages and beneficial effects:

[0015] The present application first discovers that SnoRD14E can be used as a diagnostic marker and prognostic marker for lung adenocarcinoma, and can be used as a therapeutic target for lung adenocarcinoma, which provides a new idea for improving the treatment and prognosis of lung adenocarcinoma. Studies have shown that compared with normal tissues, SnoRD14E is significantly up-regulated in tumor tissues of lung adenocarcinoma patients, and SnoRD14E as a diagnostic molecular marker has good clinical significance; knocking down SnoRD14E can inhibit the invasion and migration ability of lung adenocarcinoma cells, indicating that SnoRD14E plays a role in promoting oncogenes in the development of lung adenocarcinoma, which provides a new idea for the clinical treatment of lung adenocarcinoma, and is expected to become a new therapeutic target for lung adenocarcinoma. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 It is the expression level of SnoRD14E in lung adenocarcinoma in Example 1.

[0017] in, Figure 1 a is the screening diagram of prognosis-related SnoRNA in TCGA database;

[0018] Figure 1 bd are differential expression diagrams of SnoRA13, SnoRD9, and SnoRD14E in cancer and adjacent tissues;

[0019] Figure 1 e is the ROC curve, showing that SnoRD14E can be used as an early diagnostic marker for lung adenocarcinoma;

[0020] Figure 2 This is a diagram showing the effect of SnoRD14E on the malignant behavior of lung adenocarcinoma at the cellular level in Example 2;

[0021] in, Figure 2 a is the interference efficiency diagram of SnoRD14E in cell lines;

[0022] Figure 2 bc are plate cloning experiments and Edu experiments showing that silencing SnoRD14E inhibits the proliferation of lung cancer cells;

[0023] Figure 2 de is the results of the wound healing assay and Transwell migration assay, showing that silencing SnoRD14E inhibited the invasion and migration abilities of the lung cancer cell line H1975; sh14E-NC, sh14E-1, and sh14E-2 are SnoRD14E silencing control, silencing target 1, and silencing target 2, respectively;

[0024] Figure 3 To clarify the role of SnoRD14E in lung adenocarcinoma through nude mouse experiments:

[0025] Figure 3 bc are the results of in vivo experiments in nude mice, showing that silencing SnoRD14E inhibited the proliferation ability of tumor cells in vivo. DETAILED DESCRIPTION

[0026] In order to more clearly understand the above-mentioned purpose, features and advantages of the present invention, the present invention is further described below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0027] Example 1 Expression and clinical significance of SnoRD14E in lung adenocarcinoma

[0028] The present embodiment uses bioinformatics technology to analyze the expression level of SnoRD14E in lung adenocarcinoma samples in TCGA database, and finds that 88 SnoRNAs are abnormally expressed in lung adenocarcinoma, of which 3 are closely related to the poor prognosis of patients: SnoRA13, SnoRD14E and SnoRD9 Figure 1 a), wherein SnoRA13 and SnoRD14E are abnormally highly expressed in lung adenocarcinoma, and the expression level of SnoRD14E in lung adenocarcinoma cancer tissue and normal tissue is the largest Figure 1 b-1d); the area under the ROC curve is 0.818, indicating that SnoRD14E can be used as a biomarker for early diagnosis of lung cancer Figure 1 e).

[0029] Example 2 Effect of SnoRD14E on the malignant behavior of lung adenocarcinoma

[0030] The cells used in the following examples are lung cancer H1975 cells.

[0031] 1. Cell transfection experiment: well-grown lung adenocarcinoma cells NCI-H1975 (H1975) were inoculated in a 6-well plate and cultured in RPMI-1640 medium containing 10% fetal bovine serum for 24 h. The culture conditions were 37°C and 5% CO2 constant temperature culture. When the cell confluence reached 70%-90%, transfection was performed. Transfection was performed using serum-free, double-antibody-free RPMI-1640 medium to dissolve transfection reagents Lip3000, P3000 and SnoRD14E silencing plasmid lung adenocarcinoma cells (the silencing plasmid was from the company).

[0032] Add 5 μL of Lip3000 to an EP tube containing 100 μL of medium, vortex, and incubate for 5 min to obtain a Lip3000 solution. Add 3 μg of plasmid to an EP tube containing 100 μL of medium, mix well, then add 10 μL of P3000, vortex, and incubate for 5 min to obtain a plasmid solution. Mix the Lip3000 solution with the plasmid solution, vortex, and incubate for 15 min. Discard the original culture medium in the six-well plate, wash with PBS, and replace with new culture medium. Add the incubated mixture to the six-well plate at 200 microliters per well, and place it in a 37°C, 5% carbon dioxide cell incubator (hereinafter referred to as "incubator" and "incubation" conditions are 37°C, 5% carbon dioxide).

[0033] 2. EdU detection of proliferation rate: collect the lung adenocarcinoma cells after transfection of SnoRD14E plasmid, wash with PBS once, digest with 0.25% trypsin, terminate digestion with RPMI-1640 medium containing 10% fetal bovine serum, wash with PBS once, count the cells, and inoculate 1×10 5Cells were seeded into 96-well plates at a ratio of 1000:1 per well according to the instructions of the EdU detection kit. The next day, 50 μM EdU culture medium was prepared by diluting the EdU solution (reagent A) with complete cell culture medium at a ratio of 1000:1. 100 μL of 50 μM EdU culture medium was added to each well and incubated for 2 hours, then the culture medium was discarded. Washed once with PBS. Fix with PBS containing 4% paraformaldehyde at room temperature for 30 minutes, discard the fixative, and wash with PBS. 100 μl of permeabilization solution (0.5% TritonX-100 in PBS) was added to each well and incubated at room temperature for 10 to 15 minutes. 100 μL of 1X Incubate the staining reaction solution at room temperature in the dark for 30 minutes, then discard the staining solution and wash once with PBS. Dilute the Hoechst 33342 reaction solution to 1× with deionized water. After removing the PBS wash solution, add 100 μl of 1× Hoechst 33342 to each well and stain for 10 minutes at room temperature in the dark. Observe EdU-labeled and unlabeled cells under a fluorescence microscope, photograph, and count. Experiments should be repeated three times, with at least three replicate wells for each group. Statistical software was used for data analysis.

[0034] 3. Plate cloning assay: Lung adenocarcinoma cells transfected with the SnoRD14E plasmid were harvested, washed once with PBS, digested with 0.25% trypsin, and resuspended in RPMI-1640 medium supplemented with 10% fetal bovine serum. Count the cells and plate 800 cells per well in a six-well plate. Incubate the plates for 12 days. Change the medium every three days and observe the cells. Terminate the culture, discard the medium, wash the cells with PBS, fix them with 1 mL of 4% paraformaldehyde for 45 minutes, wash them once with PBS, stain them with 1 mL of 0.5% crystal violet solution for 1.5 hours, wash them with PBS, photograph them, and count the number of colonies formed in each well. Three replicates were performed for each well.

[0035] 4. Scratch test: Use a marker pen to draw parallel lines evenly on the back of a 6-well plate (the lines should be straight), with a spacing of 0.5-1 cm between each horizontal line. After digesting the cells in the logarithmic growth phase with 0.25% trypsin, resuspend them in RPMI-1640 medium containing 10% fetal bovine serum to form a cell suspension and count them. 5 The number of cells was added to a six-well plate and placed in an incubator. After the cells were fully spread, a 20-ul pipette tip was used to make cell scratches perpendicular to the well plate and the line. The cells were rinsed with PBS three times, the scratched cells were removed, and serum-free RPMI-1640 culture medium was added. Pictures were taken at 0 h, 24 h, 48 h, and 72 h, and the healing of the scar area was analyzed by Image J.

[0036] 5、Transwell cell migration experiment: collect the lung adenocarcinoma cells transfected with the above SnoRD14E plasmid, wash once with PBS, digest with 0.25% trypsin, then culture the cells in serum-free RPMI-1640 medium for 12h. Collect the cells, centrifuge to collect the cell precipitate, wash with PBS, and then resuspend in serum-free RPMI-1640 medium, count.

[0037] 600 μl of RPMI-1640 medium containing 20% fetal bovine serum was added to the lower chamber of the Transwell chamber, 100 μl of the above cell suspension in serum-free RPMI-1640 medium (containing 20,000 cells) was added to the upper chamber, and then placed in an incubator for 36h. Take out the culture plate with the lower chamber, and aspirate the medium in the upper chamber and the chamber of the Transwell chamber. Add 200 μl and 1 ml of PBS to the upper and lower chambers of the chamber respectively, shake, rinse, and repeat the PBS rinse 3 times. Wash the cells with 4% paraformaldehyde for about 30 minutes, then wash with PBS. Add 600 μl of 0.5% crystal violet solution to the lower chamber, and stain the cells for about 30 minutes. Wash the chamber with PBS 3 times, wipe off the cells in the upper chamber of the Transwell chamber with a cotton ball, and air dry. Take out the chamber, and take a photograph of the cells that have migrated into the lower chamber under a microscope. Randomly select 5 fields of view to take photographs and count the number of cells that have migrated into the lower chamber using Image J software.

[0038] Transfection of SnoRD14E knockdown plasmid in lung adenocarcinoma H1975 cells Figure 2 a), plate cloning experiment showed that after knocking down SnoRD14E, the silencing points at two different positions of shRNA-1 and shRNA-2 gave consistent phenotypes. It is shown that knocking down SnoRD14E can inhibit the proliferation ability of lung cancer cells Figure 2 b); EdU labeling experiment, compared with the control group, knocking down SnoRD4E significantly reduces the signal, i.e. DNA replication decreases, cell cycle prolongs, further confirming that knocking down SnoRD14E reduces the cell proliferation rate Figure 2 c). To evaluate the effect of SnoRD14E on the invasion and migration ability of lung cancer cells, the effect of SnoRD14E silencing on the invasion and migration ability of lung cancer cells was detected by scratch test and Transwell migration test after silencing SnoRD14E in lung cancer cell line H1975, the results showed that silencing SnoRD14E inhibited the invasion and migration ability of lung cancer cell line H1975 Figure 2 d-2e), indicating that SnoRD14E promotes the deterioration of lung cancer.

[0039] Example 3: The role of SnoRD14E in lung adenocarcinoma was determined by a nude mouse experiment

[0040] The nude mice were randomly divided into 3 groups (sh14E-NC, sh14E-1 and sh14E-2), 5 nude mice in each group;

[0041] Lung adenocarcinoma cells H1975 in the logarithmic growth phase with good cell state were selected, transfected with SnoRD14E knockdown plasmid, and the cells were collected by digestion and centrifugation, washed with PBS twice, resuspended in serum-free and double-antibody-free RPMI-1640 medium, then counted and injected into the right axillary of nude mice at 100 μl (10000000 cells) per mouse. The long diameter (a) and short diameter (b) of the tumor were measured once a week, and the volume of the tumor was calculated according to the formula V = 0.5 × a × b 2 The volume of the transplanted tumor was calculated. The tumor-bearing mice were sacrificed by cervical dislocation. After the tumor was peeled off, the size of the tumor was measured Figure 3 b-3c). The results of the nude mouse in vivo experiment showed that, compared with the control, silencing SnoRD14E, the tumor became smaller, indicating that the proliferation ability of tumor cells in the nude mouse decreased Figure 3 b-3c).

Claims

1. Application of SnoRD14E as a diagnostic marker for lung adenocarcinoma.

2. Application of SnoRD14E as a prognostic marker for lung adenocarcinoma.

3. Application of SnoRD14E in the treatment of lung adenocarcinoma.

Images