Rhododendron pulchrum heat resistance related gene molecular marker as well as detection and application thereof

By screening SSR markers and designing specific primers through transcriptome sequencing of Rhododendron cloudii, the problem of Rhododendron cloudii's growth being hindered in high temperature environments was solved, and efficient and low-cost heat-resistant breeding was achieved, which is suitable for molecular-assisted breeding of Rhododendron cloudii.

CN120796569APending Publication Date: 2025-10-17SOUTHWEST UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511206662.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-27
Publication Date
2025-10-17

AI Technical Summary

Technical Problem

The growth of Rhododendron yunjinensis is hindered in high temperature environment, the leaves are burned and the flowering rate decreases. The existing methods are costly and difficult to achieve genetic improvement. The traditional breeding cycle is long and inefficient. There is a lack of molecular markers related to heat resistance, which makes it difficult to meet the needs of efficient breeding.

Method used

Through transcriptome sequencing of field samples of Rhododendron cloudii, SSR markers significantly associated with heat tolerance were screened out, and specific primers were designed for PCR amplification and gel electrophoresis typing to determine the heat tolerance genotype, which was applied in breeding methods.

Benefits of technology

It realizes the efficient and low-cost early identification of heat-resistant individuals under conventional growth conditions, shortens the breeding cycle, reduces breeding blindness and costs, and is suitable for large-scale sample typing and molecular-assisted breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120796569A_ABST
    Figure CN120796569A_ABST
Patent Text Reader

Abstract

The invention discloses a gene molecular marker related to heat resistance of rhododendron pulchrum as well as detection and application of the gene molecular marker. Based on Rhododendron pulchrum field sample transcriptome sequencing and annotation, three SSR markers, namely a molecular marker 1, a molecular marker 2 and a molecular marker 3, which are remarkably related to heat resistance are screened out, corresponding specific primers are designed, and heat resistance genotypes are judged through PCR amplification and gel electrophoresis typing. The technology is further applied to breeding of the Rhododendron pulchrum heat-resistant strain. The invention also provides a kit related to breeding. The invention provides a new method for molecular marker-assisted selective breeding of Rhododendron pulchrum, and has important significance in cultivation and research of Rhododendron pulchrum adaptive to low altitude and high temperature.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular markers, and particularly relates to a molecular marker related to heat tolerance of Rhododendron fortunei and application thereof. BACKGROUND

[0002] Rhododendron fortunei is a typical alpine plant of the Ericaceae family, widely distributed in high-altitude mountainous areas of southwest China, and has extremely high ecological and ornamental values. Its flowers are colorful and the plant type is beautiful, which is an important species for landscaping and alpine ecological restoration, and is also an ideal model for studying plant adaptation to extreme environments. However, Rhododendron fortunei has poor adaptability to low-altitude areas, especially in high-temperature environments, its growth is hindered, leaf scorching occurs, and the flowering rate decreases, which seriously limits its application and commercial development in non-native habitats.

[0003] Rhododendron fortunei has long adapted to cold and cool climates at high altitudes, and its optimal growth temperature is usually below 25℃. Exceeding this range can easily trigger heat stress responses, such as accelerated chlorophyll degradation, accumulation of reactive oxygen species, and intensified membrane lipid peroxidation (e.g., increased malondialdehyde content), ultimately leading to plant death. In recent years, with global warming and the increasing demand for introduction to low-altitude areas, heat tolerance has become a core bottleneck restricting the large-scale cultivation and industrialization of Rhododendron fortunei. Although some studies have used exogenous substances (such as 5-aminolevulinic acid and methyl jasmonate) or calcium ion treatment to alleviate heat damage, these methods rely on manual intervention, are costly, and are difficult to achieve long-term stability of genetic improvement.

[0004] Currently, the molecular biology research on Rhododendron fortunei is still in its infancy. Although teams such as the Yunnan Academy of Agricultural Sciences have constructed SSR fingerprint maps and selected polymorphic markers, their applications are mostly focused on genetic diversity analysis and variety identification, and there is still a lack of systematic exploration of functional genes or molecular markers directly related to heat tolerance. Traditional breeding methods (such as high-temperature stress screening) have long cycles, low efficiency, and can easily cause damage to the parents, making it difficult to meet the demand for efficient selection of heat-resistant new varieties. In addition, compared with other crops or aquatic animals (such as wheat and American shad), the genetic mechanism analysis and molecular marker development of heat tolerance traits in Rhododendron fortunei are significantly lagging behind, and there is a lack of technical accumulation of genotype-environment correlation analysis. SUMMARY

[0005] To solve the above technical problems, the present application is based on the transcriptome sequencing and annotation of field samples of Rhododendron fortunei, and screens out SSR markers (molecular marker 1, molecular marker 2, and molecular marker 3) that are significantly related to heat tolerance, and designs corresponding specific primers, which are amplified by PCR and typed by gel electrophoresis to determine the heat tolerance genotype; the technology is further applied to the breeding method of heat-tolerant lines of Rhododendron fortunei.

[0006] Firstly, the present application provides a SSR molecular marker related to heat tolerance of Rhododendron fortunei, at least one of molecular marker 1, molecular marker 2 and molecular marker 3, the sequence of the molecular marker 1 is shown as SEQ ID NO: 1, the sequence of the molecular marker 2 is shown as SEQ ID NO: 2, and the sequence of the molecular marker 3 is shown as SEQ ID NO: 3.

[0007] The present application also provides specific primers for detecting the above-mentioned molecular markers, including primer pair 1 for detecting the molecular marker 1, primer pair 2 for detecting the molecular marker 2 and primer pair 3 for detecting the molecular marker 3, and the sequences of the primers are as follows: Upstream primer MYB-f of primer pair 1: TTGCTTGTCATGGTGAAGGC (SEQ ID NO: 4) Downstream primer MYB-r of primer pair 1: GAAACAAGCACGCCACCTTA (SEQ ID NO: 5) Upstream primer MYB-f of primer pair 2: TTGTTCTACCTCCGCCATGT (SEQ ID NO: 6) Downstream primer MYB-r of primer pair 2: TCGGTCACCATATGCATCGA (SEQ ID NO: 7) Upstream primer HSP-f of primer pair 3: TTTTGTGGCCTGACGTTGAG (SEQ ID NO: 8) Downstream primer HSP-r of primer pair 3: GAACAGGCGCATCACTGAAT (SEQ ID NO: 9) Further, the present application provides the application of the above-mentioned specific primers in the selection of heat-resistant lines of Rhododendron fortunei.

[0008] Specifically, the specific primers are used for genotyping of Rhododendron fortunei samples, and the specific method is as follows: when the primer pair 1 is used for PCR amplification of the DNA of the sample to be tested, only a band with a size of 299 bp is generated, then the genotype of the site of the molecular marker 1 is type A; when the primer pair 2 is used for PCR amplification of the DNA of the sample to be tested, only a band with a size of 271 bp is generated, then the genotype of the site of the molecular marker 2 is type A; when the primer pair 3 is used for PCR amplification of the DNA of the sample to be tested, only a band with a size of 255 bp is generated, then the genotype of the site of the molecular marker 3 is type A. When the genotype of at least one of the sites of the molecular markers in the sample to be tested is type A, it is considered that the sample has certain heat resistance potential. Preferably, the individual with the genotype of the sites of the molecular marker 1, the molecular marker 2 and the molecular marker 3 all being type A is selected as a heat-resistant plant.

[0009] The application also provides a reagent for breeding heat-resistant varieties of Rhododendron mucronatum, wherein the reagent comprises at least one primer pair in the specific primers, and buffers and other components required for completing PCR amplification and gel electrophoresis typing.

[0010] The application provides a breeding method of heat-resistant varieties of Rhododendron mucronatum, comprising the following steps: (a) extracting genomic DNA of a sample of Rhododendron mucronatum to be detected; (b) using the genomic DNA obtained in step (a) as a template, and performing PCR amplification by using the specific primers; (c) determining the genotype of at least one of the loci of the molecular marker 1, the molecular marker 2 and the molecular marker 3 as type A, and identifying the individual as a heat-resistant potential strain for the next breeding.

[0011] Compared with the prior art, the application has the beneficial effects that the SSR molecular markers significantly related to heat resistance are efficiently screened by using transcriptome data, and a simple PCR-gel electrophoresis detection process is designed; without high-temperature stress experiments, the early identification of heat-resistant individuals can be realized by molecular markers under conventional growth conditions; the detection method is simple, low in cost and good in repeatability, and is suitable for large-scale sample typing and molecular-assisted breeding; the breeding blindness and cost can be significantly reduced, the breeding period of heat-resistant new varieties can be shortened, and the popularization and application of Rhododendron mucronatum in low-altitude or warm areas can be accelerated. BRIEF DESCRIPTION OF DRAWINGS

[0012] Fig. 1 It is an electrophoresis diagram of a verification experiment of the molecular marker 1; Fig. 2 It is an electrophoresis diagram of a verification experiment of the molecular marker 2; Fig. 3 It is an electrophoresis diagram of a verification experiment of the molecular marker 3. DETAILED DESCRIPTION

[0013] The embodiments of the application will be described in detail below with specific examples, which are only used to illustrate the application and should not be regarded as limiting the scope of the application, and it should be understood that the following examples are a more detailed description of certain aspects, characteristics and embodiments of the application. Unless otherwise specified, the instruments, reagents and materials used in the following examples are commercially available.

[0014] Example 1: Heat stress transcriptome analysis of Rhododendron mucronatum The specific experimental steps are as follows: (1) Heat stress experiment of Rhododendron mucronatum at different altitudes The three-year-old Rhododendron fortunei seedlings of the same growth period and similar growth vigor were placed in low altitude for heat stress experiment (altitude < 500 m), and normal watering, fertilization and maintenance were carried out during the experiment. The heat stress experiment was carried out from June to September, and the unburned leaves (air temperature > 40℃) were collected during the highest temperature period, and then numbered and stored in an ultra-low temperature refrigerator for standby, and the survival of Rhododendron fortunei was continuously monitored. The leaves of 3 Rhododendron fortunei seedlings that died first and 3 Rhododendron fortunei seedlings with the best growth after high temperature were selected for transcriptome analysis.

[0015] (2) Transcriptome analysis of Rhododendron fortunei under heat stress The leaves of Rhododendron fortunei were sent to Wuhan Fisagen Information Co., Ltd. for transcriptome sequencing by high-throughput sequencer MGI. After preliminary evaluation and filtration of the sequencing data, high-quality sequencing data were obtained, and transcript assembly and statistical analysis were carried out without reference genome, and a total of 8643 differentially expressed genes were identified. The SSR sites in the differentially expressed gene sequences were screened, and the screening criteria were as follows: the gene annotation was the sequence of the plant heat stress related gene, the sequence length unit was 16-28 bp, the number of 2 base units was more than 9 times, the number of 3-6 base units was 5 times or more than 5 times, single base unit was excluded, and the annealing temperature difference of upstream and downstream primers was not more than 3℃. The Rhododendron fortunei transcriptome that met the conditions was designed for SSR primer, and the primer synthesis was carried out by Beijing Qikong Biological Technology Co., Ltd., a total of 20 pairs of primers were synthesized.

[0016] Example 2: Screening of molecular markers related to heat tolerance traits of Rhododendron fortunei (1) PCR amplification of sample DNA.

[0017] 80 Rhododendron fortunei plant samples naturally distributed at different altitudes were collected, and the distribution longitude, latitude and altitude were recorded when the samples were collected. The leaf DNA of different samples of Rhododendron fortunei was extracted using the plant DNA extraction kit (DP342-01) of Tian Gen Biochemical Technology (Beijing) Co., Ltd., and then the DNA was subjected to PCR amplification: the total volume of PCR amplification reaction was 10 μL, including 2 μL of DNA (50 ng·μL -1 ), 1 μL of PCR Buffer (10×), 0.2 μL of dNTPs, 0.25 μL of each of the upstream and downstream primers, 0.07 μL of Taq DNA Polymerase (5 U·μL -1 ), and 6.23 μL of ddH2O. The amplification reaction was carried out on a PCR instrument, and the amplification program was as follows: 94℃ pre-denaturation for 4 min, followed by 30 cycles, each cycle including 94℃ denaturation for 15 s, 55℃ annealing for 15 s and 72℃ extension for 30 s; after the cycle, extension at 72℃ for 20 min, and finally storage at 12℃.

[0018] (2) The PCR amplified product is separated by 8% polyacrylamide gel electrophoresis.

[0019] The specific steps are as follows: 1.2 μL of the amplified product containing bromophenol blue indicator is taken using a pipette, spotted on a polyacrylamide gel plate, and 1 μL of 100-2000 bp DNA Marker is added to each end of the gel. Electrophoresis is carried out under constant voltage of 240 V, and the electrophoresis is terminated in time according to the migration of bromophenol blue. After electrophoresis, the gel is washed with ddH2O twice, placed in fixing solution for 10 min, then taken out and washed with ultrapure water for 2-3 times, 2 min each time. After washing, the gel is stained with silver staining solution, shaken for 7 min, then washed with distilled water for 2-3 times, 2 min each time. Then the gel is transferred to the developing solution and shaken until clear bands appear on the gel; finally, the bands are read and photographed after washing with ddH2O for 2 times.

[0020] (3) Screening of molecular markers After the amplified product bands are summarized, the amplified product bands are identified according to the expected size of the amplified fragments of each pair of primers, and in the band data summary table, the bands with the same size as the expected size of the amplified fragments of the corresponding primers are marked as 1, otherwise marked as 0. Then, the polymorphic band data are subjected to random forest correlation analysis with altitude and temperature data extracted from latitude and longitude, and the phenotype interpretation rate threshold random forest R 2 =10% (p<0.001), and the three genes with the strongest correlation with temperature and altitude and their corresponding molecular markers 1, molecular marker 2 and molecular marker 3 are screened out.

[0021] As shown in Table 1, the three molecular markers are significantly correlated with altitude and temperature (p<0.001), and the phenotype interpretation rate is greater than 10%, indicating that the three molecular markers have high correlation with heat tolerance.

[0022] Table 1 Correlation and p value of three genes of Rhododendron fortunei most related to temperature and altitude

[0023] After transcriptome annotation, the gene corresponding to molecular marker 1 is MYBP gene of MYB gene family, which mainly regulates plant growth and development or response to stress, with length of 1394 bp and sequence of SEQ ID NO: 10. The primer pair 1 corresponding to molecular marker 1 is SEQ ID NO: 4 and SEQ ID NO: 5, and the size of the PCR amplified product is 299 bp. The gene corresponding to molecular marker 2 is also a MYBP gene of the MYB gene family, and the main gene function is to regulate the growth and development of plants or the response to stress, and the length is 2124 bp, and the sequence is SEQ ID NO: 11; the primer pair 2 corresponding to the molecular marker 2 is SEQ ID NO: 6, SEQ ID NO: 7, and the fragment size of the PCR amplification product is 271 bp; The gene corresponding to the molecular marker 3 is a HSPA1s gene of the HSP gene family, and the main gene function is to respond to high temperature stress, and the length is 689 bp, and the sequence is SEQ ID NO: 12; the primer pair 3 corresponding to the molecular marker 3 is SEQ ID NO: 8, SEQ ID NO: 9, and the fragment size of the PCR amplification product is 255 bp.

[0024] When the amplification product produces a band with the same size as the molecular marker, it is judged that the genotype of the gene at the site corresponding to the molecular marker is type A.

[0025] Example 3: Verification of heat tolerance molecular markers of Rhododendron mucronatum The first 8 Rhododendron mucronatum plants to die (1-8 in the table) and the last 8 Rhododendron mucronatum plants to survive (9-16 in the table) collected in step (1) of Example 1 were used to perform molecular marker experiments using the primers corresponding to the three molecular markers in the same way as in Example 2, and three electrophoretograms of molecular markers were obtained (Figures 2-4). Figs. 1-3 According to the expected amplification fragment size specific to each pair of primers, the amplification product bands were identified, and the identification results were summarized in Table 2. The markers with the corresponding genes of molecular marker 1, molecular marker 2 and molecular marker 3 are marked as √, otherwise as ×. Figs. 1-3

[0026] Table 2, analysis of whether the corresponding molecular marker genes are present in the dead and surviving individuals of Rhododendron mucronatum

[0027] Result analysis: Fig. 1 The amplification product bands corresponding to molecular marker 1 are shown. It can be seen that the surviving individuals (Nos. 9-16) all show obvious corresponding amplification product bands, while the dead individuals (Nos. 1-8) do not have corresponding bands, which indicates that when molecular marker 1 is used alone for identification, it can effectively screen out heat-resistant plants and exclude non-heat-resistant plants, i.e. high sensitivity and high specificity.

[0028] Fig. 3 The amplification product bands corresponding to molecular marker 3 are shown. The results are consistent with those of molecular marker 1, indicating that when molecular marker 3 is used alone for identification, it has high sensitivity and high specificity.

[0029] Fig. 2 ​The corresponding amplified product bands of the displayed molecular marker 2 are detected in all the survival individuals, but a few of the dead individuals (No. 1-2) also have the corresponding bands, which indicates that the use of the molecular marker 2 alone for the identification of heat-resistant plants has high sensitivity, but relatively low specificity. However, the corresponding amplified products of the molecular marker 1, the molecular marker 2 and the molecular marker 3 are detected in all the survival individuals (see Table 2), but not in the dead individuals, which indicates that the combined use of the three can significantly improve the specificity and sensitivity of the screening, thereby more effectively screening the individuals of Rhododendron mucronatum with better heat resistance. Figs. 1-3 As shown in Table 2), which indicates that the combined use of the three can significantly improve the specificity and sensitivity of the screening, thereby more effectively screening the individuals of Rhododendron mucronatum with better heat resistance.

[0030] Therefore, the three molecular markers can be used alone or in combination for the auxiliary screening of Rhododendron mucronatum with heat resistance.

[0031] The above only describes the preferred embodiments of the present application and is not used to limit the present application, and any modification, equivalent replacement and improvement made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. An SSR molecular marker related to the heat tolerance trait of Rhododendron cloudii, characterized in that: The SSR molecular marker is at least one of molecular marker 1, molecular marker 2 and molecular marker 3, the sequence of molecular marker 1 is shown as SEQ ID NO: 1, the sequence of molecular marker 2 is shown as SEQ ID NO: 2, and the sequence of molecular marker 3 is shown as SEQ ID NO:

3.

2. A specific primer for detecting the SSR molecular marker according to claim 1, characterized in that: The upstream and downstream primer sequences of primer pair 1 for detecting molecular marker 1 are SEQ ID NO: 4 and SEQ ID NO: 5, respectively; the upstream and downstream primer sequences of primer pair 2 for detecting molecular marker 2 are SEQ ID NO: 6 and SEQ ID NO: 7, respectively; the upstream and downstream primer sequences of primer pair 3 for detecting molecular marker 3 are SEQ ID NO: 8 and SEQ ID NO: 9, respectively.

3. Use of the specific primer as claimed in claim 2 in breeding heat-resistant varieties of Rhododendron yunjinensis.

4. The use according to claim 3, characterized in that When the primers are used to perform PCR amplification on one pair of Rhododendron cloudii sample DNAs, and the amplified product only produces a band with a size of 299 bp, the genotype of the site where the molecular marker 1 is located is judged to be type A; when the primers are used to perform PCR amplification on two pairs of sample DNAs, and the amplified product only produces a band with a size of 271 bp, the genotype of the site where the molecular marker 2 is located is type A; when the primers are used to perform PCR amplification on three pairs of sample DNAs, and the amplified product only produces a band with a size of 255 bp, the genotype of the site where the molecular marker 3 is located is type A; when the genotype of the site where at least one molecular marker in the sample to be tested is type A, it is considered that the individual has a certain heat resistance potential.

5. The use according to claim 4, characterized in that Individuals whose genotypes at the sites where molecular markers 1, 2 and 3 are located are all type A are selected as heat-resistant plants.

6. A reagent for detecting the SSR molecular marker according to claim 1, characterized in that The method comprises at least one primer pair among the specific primers described in claim 2.

7. A method for breeding a heat-resistant strain of Rhododendron yunjinensis, comprising the following steps: (a) extracting genomic DNA of a Rhododendron fortunei sample to be tested; (b) using the genomic DNA obtained in step (a) as a template and performing PCR amplification using the specific primers described in claim 2; (c) Individuals whose genotype at at least one of the sites of molecular marker 1, molecular marker 2, and molecular marker 3 is determined to be type A are identified as heat-resistant potential strains and used for the next step of breeding.