Application of SNP molecular marker in pelteobagrus fulvidraco roughage utilization character detection or breeding and method

Abstract

The invention belongs to the technical field of molecular marker assisted breeding, and particularly relates to application and a method of an SNP molecular marker in pelteobagrus fulvidraco coarse feed utilization character detection or breeding. The SNP molecular marker is located at the 228bp position of a nucleotide sequence shown as SEQ ID NO.4 and has TT, TG and GG genotypes, and the SNP molecular marker is located at the 228bp position of the nucleotide sequence shown as SEQ ID NO.3. The roughage utilization character of the Pelteobagrus fulvidraco individual of the GG genotype is obviously superior to that of the Pelteobagrus fulvidraco individual of the TT genotype and the By detecting the genotype of the molecular marker, rapid, accurate and high-throughput identification or detection of the utilization character of the pelteobagrus fulvidraco roughage on the molecular level can be realized, and the seed selection period of a pelteobagrus fulvidraco strain with high roughage utilization rate and excellent roughage tolerance is greatly shortened; the cultivation of the pelteobagrus fulvidraco group which can efficiently utilize the coarse feed and has the rapid growth character under the feeding of the coarse feed can be obviously accelerated.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular marker-assisted breeding, and in particular to an application and method of SNP molecular markers in roughage utilization trait detection or breeding of yellow catfish. Background Art

[0002] Yellow catfish (Pelteobagrus fulvidraco), commonly known as yellow catfish, yellow bone fish, and yellow catfish, belongs to the order Siluriformes, family Catfish, and genus Pelteobagrus. It is widely distributed in my country's freshwater bodies. Because of its tender meat, delicious taste, rich nutrition, and lack of intramuscular spines, it is favored by consumers and has gradually become an important economic fish and farmed fish in my country.

[0003] Feed costs account for the largest portion of yellow catfish aquaculture costs, and the key to reducing them is improving feed conversion efficiency. Yellow catfish is an omnivorous fish that can utilize both animal and plant proteins. High-protein, high-fishmeal feeds are commonly used in its aquaculture, with protein levels exceeding 42% and fishmeal levels exceeding 20%. The rising prices of key protein raw materials such as fishmeal and soybean meal have led to a continuous increase in yellow catfish aquaculture costs. Replacing yellow catfish's high-protein, high-fishmeal feed with affordable roughage—low-nutrient feeds (typically low in protein, fishmeal, or protein substitutes, or no fishmeal), such as marsh weeds, rice straw, rice husks, corn stalks, rice bran, and distiller's grains—would significantly reduce yellow catfish aquaculture costs and contribute to the healthy and sustainable development of the yellow catfish aquaculture industry. However, current yellow catfish strains are largely incapable of effectively utilizing these roughages. Therefore, breeding yellow catfish strains with improved roughage tolerance and roughage utilization efficiency is a key area of ​​genetic improvement.

[0004] Molecular markers refer to specific DNA fragments that can reflect certain differences in the genomes of biological individuals or populations. They are not easily affected by the external environment and have the advantages of high polymorphism and genetic stability, large quantity, high consistency and easy detection. Single nucleotide polymorphism (SNP) refers to DNA sequence polymorphism caused by changes such as replacement, transversion, deletion or insertion of a single nucleotide at the genomic level. As the third-generation molecular marker technology, it uses the differences in single nucleotides in the genome sequence of an organism to identify the differences between different individuals of the same species. The use of SNP molecular markers can more easily locate the genotype or allele associated with the dominant trait, thereby achieving the selection of the dominant genotype of the target trait. It has been widely used in the fields of animal and plant selective breeding, germplasm resource protection, etc.

[0005] At present, there are relatively few studies on SNP molecular markers in the genetic breeding of Pelteobagrus fulvidraco. There are few reports on SNP molecular markers associated with the roughage utilization traits of Pelteobagrus fulvidraco that have clear functions and can be directly used for breeding detection. Therefore, discovering new SNP molecular markers associated with the roughage utilization traits of Pelteobagrus fulvidraco and applying them is of great significance to reducing the breeding cost of Pelteobagrus fulvidraco and the genetic improvement of excellent traits. Summary of the Invention

[0006] To address the problems of the prior art, the present invention provides a SNP molecular marker associated with the roughage utilization trait of yellow catfish. Yellow catfish individuals with the G allele are able to efficiently utilize roughage. Therefore, by detecting the genotype of this molecular marker, rapid, accurate, and high-throughput identification or detection of the roughage utilization trait of yellow catfish at the molecular level can be achieved, greatly shortening the selection cycle of yellow catfish strains with high roughage utilization and excellent roughage tolerance, and significantly accelerating the breeding of yellow catfish populations that can efficiently utilize roughage and obtain rapid growth traits when fed with roughage. Therefore, the present invention provides the use of this SNP molecular marker, its detection primers or kit in the detection or breeding of the roughage utilization trait of yellow catfish, and related methods.

[0007] The present invention is specifically achieved through the following technical solutions:

[0008] The first aspect of the present invention provides a SNP molecular marker associated with the roughage utilization trait of yellow catfish, and the use of a detection primer or kit thereof in the detection or breeding of the roughage utilization trait of yellow catfish; the SNP molecular marker is located at the 228th bp of the nucleotide sequence shown in SEQ ID NO.4, and K is selected from G or T;

[0009] The SNP molecular marker has TT, TG and GG genotypes, and the roughage utilization trait of the yellow catfish individuals with the GG genotype is significantly better than that of the yellow catfish individuals with the TT genotype and the TG genotype.

[0010] Furthermore, the roughage utilization trait of yellow catfish is roughage utilization rate or roughage tolerance.

[0011] The second aspect of the present invention provides a detection primer for detecting the SNP molecular marker as described above, wherein the SNP molecular marker is located at the 228th bp of the nucleotide sequence shown in SEQ ID NO.4, and K is selected from G or T; the detection primer includes an upstream primer and a downstream primer, and the nucleotide sequences of the upstream primer and the downstream primer are respectively shown in SEQ ID NO.1-2.

[0012] The third aspect of the present invention provides a kit, which includes the detection primers described above.

[0013] Furthermore, the kit also includes a PCR amplification reagent, which includes Taq DNA polymerase, dNTP and a buffer reagent.

[0014] A fourth aspect of the present invention provides a method for detecting roughage utilization traits of yellow catfish, comprising the following steps:

[0015] Extracting genomic DNA from the tested yellow catfish individuals;

[0016] Amplifying the genomic DNA by polymerase chain reaction (PCR) using the detection primers shown in SEQ ID NO. 1-2 to obtain an amplified product;

[0017] Reverse sequencing is performed on the amplified product, and the roughage utilization trait of the yellow catfish individual to be tested is determined according to the genotype of the base at 228 bp of the sequencing sequence;

[0018] Among them, the base at the 228th bp has TT, TG and GG genotypes, and the roughage utilization trait of the tested yellow catfish individuals with the GG genotype is significantly better than that of the tested yellow catfish individuals with the TT genotype and the TG genotype.

[0019] A fifth aspect of the present invention provides a breeding method for roughage utilization traits of Pelteobagrus fulvidraco, comprising the following steps:

[0020] Extracting genomic DNA from the tested yellow catfish individuals;

[0021] Amplifying the genomic DNA by polymerase chain reaction (PCR) using the detection primers shown in SEQ ID NO. 1-2 to obtain an amplified product;

[0022] The amplified product is reverse sequenced, and according to the genotype of the base at the 228th bp of the sequencing sequence, the base at the 228th bp has TT, TG and GG genotypes, and the yellow catfish individuals to be tested with the GG genotype are selected for seed production.

[0023] The advantages and positive effects of the present invention are:

[0024] 1. The SNP molecular markers provided by the present invention are closely associated with the roughage utilization traits of yellow catfish, and can realize the conversion of phenotypic judgment into genotypic identification, and perform rapid, accurate, and high-throughput identification or detection of target traits at the molecular level. It is not restricted by environmental factors and feeding cycles, which is conducive to improving the detection and breeding progress of yellow catfish populations that efficiently utilize roughage, and shortening the selection cycle of yellow catfish strains with high roughage utilization and excellent roughage tolerance.

[0025] 2. The SNP molecular marker of the present invention has potential value for the genetic improvement of the roughage utilization trait of yellow catfish. By retaining individuals with the GG genotype for seed production during the breeding process or using them as targets for gene mutation, the frequency of the G allele in the offspring can be gradually increased, which is conducive to accelerating the cultivation of yellow catfish populations that can efficiently utilize roughage and obtain rapid growth traits when fed with roughage, significantly improving the roughage utilization rate and tolerance of the yellow catfish population. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0027] Figure 1 This is a Manhattan plot obtained from the genome-wide association analysis of the weight gain rate of yellow catfish fed roughage and SNP variation sites in the embodiment of the present invention;

[0028] Figure 2 A violin plot of the average weight gain rate of yellow catfish individuals with different genotypes of the SNP molecular marker site in the embodiment of the present invention fed with roughage;

[0029] Figure 3 This is a reverse sequencing peak diagram of amplification products containing different genotypes of SNP molecular markers according to an embodiment of the present invention. DETAILED DESCRIPTION

[0030] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below with reference to the embodiments. The embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0031] Given the information contained herein, it will be readily apparent to those skilled in the art that various modifications may be made to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the processes, properties, or components defined herein, as these embodiments and other descriptions are intended only to illustrate specific aspects of the present invention. Indeed, various modifications to the embodiments of the present invention that are apparent to those skilled in the art or related fields are intended to be within the scope of the appended claims.

[0032] For a better understanding of the present invention and not to limit the scope of the present invention, all numerals and other numerical values ​​used in the present invention to express amounts, percentages, etc. should be understood as modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the appended claims are approximate values, which may be changed according to the different ideal properties to be obtained. Each numerical parameter should at least be regarded as obtained based on the reported significant digits and by conventional rounding methods.

[0033] The terms "comprises," "includes," "contains," "having," and similar expressions are non-restrictive, meaning that other steps and other components that do not affect the result may be added. The term "and / or" should be considered as a specific disclosure of each of the two specified features or components with or without the other. For example, "A and / or B" is considered to include the following: (i) A, (ii) B, and (iii) A and B.

[0034] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific embodiments of the present invention are described in detail below.

[0035] The present invention records the weights of 198 yellow catfish of the XX genotype fed a low-protein, fishmeal-free roughage (nutritional level of 38% protein and 0% fishmeal), uses the weight gain rate of feeding the roughage as phenotypic data, and combines SNP typing data obtained from whole-genome DNA sequencing data as genetic variation data to perform genome-wide association analysis (GWAS) to screen out candidate SNPs. Subsequently, the genotypes formed by the candidate SNP polymorphisms are further analyzed with the corresponding weight gain rate phenotypes to screen out SNP molecular markers associated with the roughage utilization trait. The SNP molecular marker of the present invention is located on an intron of the plxnb2b gene (nucleotide sequence see NCBI Gene ID: 113660217), and is physically located at base 7237643 of chromosome 10 (nucleotide sequence see NCBI accession number: NC_062527.1) of the yellow catfish genome HZAU_PFXX_2.0 version (nucleotide sequence see NCBI Genbank assembly number: GCA_022655615.1). Compared with the reference genome, a single nucleotide mutation T>G occurs, resulting in the presence of single nucleotide polymorphisms of T and G, and three alleles: TT, TG and GG. The nucleotide sequences and corresponding genotypes and genetic characteristics formed by them promote differences in roughage utilization traits among yellow catfish individuals.

[0036] In a population of yellow catfish fed roughage, the weight gain phenotypic values ​​corresponding to different genotypes of this SNP molecular marker differed significantly. Individual fish carrying the GG genotype had a significantly higher weight gain rate than those with the TT and TG genotypes, demonstrating faster growth rates when fed roughage, and higher roughage utilization and tolerance. The SNP molecular markers of the present invention can be used in marker-assisted breeding, providing new and reliable molecular markers for selecting individuals of yellow catfish with genetically stable and excellent roughage utilization traits, and enriching the genetic resources for genetic improvement of roughage utilization traits.

[0037] Based on this, one embodiment of the present invention provides a SNP molecular marker associated with the roughage utilization trait of yellow catfish, and its detection primer or kit for use in the detection or breeding of the roughage utilization trait of yellow catfish; the SNP molecular marker is located at the 228th bp of the nucleotide sequence shown in SEQ ID NO.4, and K is selected from G or T;

[0038] The SNP molecular marker has TT, TG and GG genotypes, and the roughage utilization trait of the yellow catfish individuals with the GG genotype is significantly better than that of the yellow catfish individuals with the TT genotype and the TG genotype.

[0039] Optionally, the roughage utilization trait of yellow catfish is roughage utilization rate or roughage tolerance.

[0040] The SNP molecular marker provided by the present invention is closely associated with the roughage utilization trait of yellow catfish, and can realize the conversion of phenotypic judgment into genotypic identification, and perform rapid, accurate, high-throughput identification or detection of the target trait at the molecular level. Moreover, by detecting the genotype of the molecular marker to predict or assist in judging the roughage utilization trait of yellow catfish, it is not restricted by environmental factors and the feeding cycle, which is conducive to improving the detection and breeding progress of yellow catfish groups that efficiently utilize roughage, and shortening the seed selection cycle. The SNP molecular marker of the present invention has potential value for the genetic improvement of the roughage utilization trait of yellow catfish. By retaining individuals with the GG genotype, it is conducive to accelerating the cultivation of yellow catfish strains with high roughage utilization and excellent roughage tolerance, thereby effectively reducing the utilization of high-protein, high-fishmeal feed in the breeding process, which is of great significance to reducing yellow catfish breeding costs and improving economic benefits. In addition, using it as a target for genetic engineering breeding, the TT and TG genotypes can be improved into the GG genotype through gene mutation and other methods, so as to increase the frequency of the allele G at this site from generation to generation. This is beneficial to provide a fast and effective improvement method for the yellow catfish with excellent roughage utilization ability, and obtain a yellow catfish population with fast growth traits when fed with roughage.

[0041] In actual testing, when the SNP molecular marker site in the tested yellow catfish individual is detected to be the GG genotype, it can be judged as having excellent roughage utilization ability, which is manifested in that when fed with roughage, its growth rate is faster and its weight gain rate is higher, which is significantly higher than that of yellow catfish individuals with TT and TG genotypes.

[0042] The detection of the SNP molecular marker genotype of the present invention can adopt the methods commonly used in the prior art, such as gene chip technology, competitive allele-specific PCR (KASP) technology, Taqman probe technology, high-resolution melting curve (HRM) method, allele-specific PCR (AS-PCR) technology, direct sequencing and matrix-assisted laser desorption ionization time-of-flight mass spectrometry technology.

[0043] The present invention preferably adopts a direct sequencing method, which includes the steps of extracting genomic DNA of the yellow catfish individual to be tested, PCR amplifying the fragment to be tested, and sequencing the fragment to be tested. According to the peak diagram of sequencing, the SNP molecular marker genotype appears as a single peak when it is homozygous, and as overlapping peaks when it is heterozygous, which makes it easy to distinguish different genotypes.

[0044] Another embodiment of the present invention provides a detection primer for detecting the SNP molecular marker as described above, wherein the detection primer comprises an upstream primer and a downstream primer, and the nucleotide sequences of the upstream primer (F) and the downstream primer (R) are shown in SEQ ID NO.1-2, respectively.

[0045] The present invention uses the genomic DNA of the yellow catfish individual to be tested as a template, utilizes the above-mentioned detection primers to perform PCR amplification, and can obtain accurate base information of the SNP molecular marker site through sequencing and other means. The primers have high specificity and good genotyping effect, which is conducive to the rapid and accurate identification of the genotype of the molecular marker.

[0046] Another embodiment of the present invention provides a kit for detecting the SNP molecular marker described above, wherein the kit includes the detection primer described above.

[0047] The advantages of the kit over the prior art are the same as those of the detection primers described above, and will not be repeated here.

[0048] Optionally, the kit further comprises a PCR amplification reagent. The present invention has no particular limitation on the source of the PCR amplification reagent, and conventional commercial products in the art may be used.

[0049] In a typical embodiment, the PCR amplification reagents include Taq DNA polymerase, dNTPs and a buffer reagent. The present invention has no particular limitation on the total amount of PCR amplification reagents and the amount of detection primers in the kit, and they can be set according to the conventional requirements of the kit.

[0050] Based on the same inventive concept as above, another embodiment of the present invention provides a method for detecting roughage utilization traits of yellow catfish, comprising the following steps:

[0051] Extracting genomic DNA from the tested yellow catfish individuals;

[0052] Amplifying the genomic DNA by polymerase chain reaction (PCR) using the detection primers shown in SEQ ID NO. 1-2 to obtain an amplified product;

[0053] Reverse sequencing is performed on the amplified product, and the roughage utilization trait of the yellow catfish individual to be tested is determined according to the genotype of the base at 228 bp of the sequencing sequence;

[0054] Among them, the base at the 228th bp has TT, TG and GG genotypes, and the roughage utilization trait of the tested yellow catfish individuals with the GG genotype is significantly better than that of the tested yellow catfish individuals with the TT genotype and the TG genotype.

[0055] Based on the same inventive concept as above, an embodiment of the present invention further provides a breeding method for roughage utilization traits of yellow catfish, comprising the following steps:

[0056] Extracting genomic DNA from the tested yellow catfish individuals;

[0057] Amplifying the genomic DNA by polymerase chain reaction (PCR) using the detection primers shown in SEQ ID NO. 1-2 to obtain an amplified product;

[0058] The amplified product is reverse sequenced, and according to the genotype of the base at the 228th bp of the sequencing sequence, the base at the 228th bp has TT, TG and GG genotypes, and the yellow catfish individuals to be tested with the GG genotype are selected for seed production.

[0059] In the present invention, individuals of the superior genotype GG of the yellow catfish are selected for breeding according to the genotype of the SNP molecular marker, and individuals with the genotypes of TG and TT at the site are eliminated. This can increase the frequency of the GG allele at the site from generation to generation, thereby significantly improving the roughage utilization and tolerance of the yellow catfish population, and accelerating the cultivation of yellow catfish that can efficiently utilize roughage and grow fast.

[0060] The present invention does not specifically limit the method for extracting genomic DNA from the yellow catfish individual to be tested. The commonly used genomic DNA extraction methods or genomic DNA extraction kits in the art can be used, such as the commonly used phenol-chloroform crude extraction method or CTAB extraction method, or extraction using conventional commercially available kits.

[0061] The present invention will be further described below with reference to specific examples. Experimental methods in the following examples where specific conditions are not specified were generally performed under conventional conditions, such as those described in the Molecular Cloning Laboratory Manual (4th Edition) published by Cold Spring Harbor Laboratory, or under conditions recommended by the manufacturer.

[0062] 1. Establishment of a selection population for roughage utilization traits of Pelteobagrus fulvidraco

[0063] At the breeding base of Hubei Huangyouyuan Fishery Development Co., Ltd., artificial breeding was carried out between the XX pseudo-male fish induced by the team in the early stage and the normally selected XX high-quality female fish to obtain XX genetic type all-female yellow catfish, which were placed in ponds for cultivation. When they were 4 months old, extremely large and small individuals were removed through sieves and manual methods, and individuals weighing between 12-20 grams were selected as the basic breeding group, and subsequently switched to roughage for feeding.

[0064] Each screened yellow catfish individual was injected with a radio frequency identification (RFID) tag, and the RFID tag number was read at the same time. The weight of each fish was measured as the initial weight, and the fin rays of each individual were collected and preserved in 95% ethanol as a DNA sample. The RFID tag number, initial weight, and fin ray number were matched one by one.

[0065] 2. Determination of phenotypic data on roughage utilization traits of yellow catfish populations

[0066] Based on the nutritional requirements of yellow catfish, a special puffed feed for yellow catfish was produced with a target of 38% protein and 0% fish meal. The finished feed had a nutritional level of 0% fish meal, 38.1% crude protein, 10.7% crude fat, and 8.1% crude ash, which is the roughage described in the present invention. Individually labeled yellow catfish were raised using an apparent satiation feeding strategy with a feeding duration of 30-50 minutes. After four months of roughage feeding, the final weight of each fish was collected. After the initial and final weights of the individuals were mapped one-to-one using RFID tags, the weight gain rate (GR) of each individual was calculated according to the following formula.

[0067] GR = 100% × (final body weight - initial body weight) / initial body weight.

[0068] Under the same feeding conditions, the higher the weight gain rate, the higher the individual's utilization rate of roughage and the better its ability to tolerate roughage feeding, which means it grows faster when eating roughage and thus has a greater weight gain rate.

[0069] 3. Genome-wide association study (GWAS) of roughage utilization traits in yellow catfish populations

[0070] Fin ray DNA samples were extracted using a DNA extraction kit (purchased from Yisheng Biotechnology, catalog number 19106ES50) to extract whole-genome DNA. After quality control, the DNA sequence was fragmented into random fragments using ultrasound. The fragmented DNA was then end-repaired, 3′-end amplified, and ligated with sequencing adapters. Fragments of approximately 350 bp in length were then enriched using magnetic beads and amplified by PCR to create a sequencing library. The constructed library was quality-controlled, and qualified libraries were sequenced using the Illumina NovaSeq X Plus™ platform using the Illumina NovaSeq X Plus PE150 sequencing strategy, with a total read length of 300 bp. Sequencing and analysis were performed by Shanghai Meiji Biopharmaceutical Technology Co., Ltd.

[0071] After the sequencing data (Raw Data) was downloaded, quality control was performed on the data, and low-quality data was filtered to obtain high-quality data (Clean Data). The Clean Data was aligned to the reference genome HZAU_PFXX_2.0 (Tachysurus fulvidraco reference genome HZAU_PFXX_2.0, NCBI GenBank assembly number GCA_022655615.1) using BWA-MEME software (Jung and Han 2022) to obtain the positional attribution of the sequence (i.e., BAM file). The BAM file was corrected using the Best Practices pipeline of the Genome Anlysis Toolkit (GATK) software (McKenna A et al. 2010). SNP detection was performed using the Haplotyper method of GATK, with filtering conditions based on GATK recommended parameters. Functional annotation of variants was performed using SNPEff software (Cingolani et al. 2012) and gene prediction information from the reference genome to obtain functional annotation information for SNPs.

[0072] The general linear model (GLM) was used to perform association analysis between the mined SNPs and weight gain rate data. The analysis model is as follows:

[0073] y=Xα+Zβ+e;

[0074] Among them, y is the phenotypic trait, that is, the weight gain rate of yellow catfish after eating roughage, X is the indicator matrix of fixed effects, α is the estimated parameter of fixed effects, Z is the indicator matrix of SNP, β is the effect of SNP, e is the random residual, and it obeys e~(0,δ e 2 )(normal distribution).

[0075] According to the number of SNPs and commonly used standards, -log10(p) was set to 6 as the screening criterion for candidate SNPs for the roughage tolerance trait. Figure 1 The Manhattan plot shown shows the GWAS analysis results of the phenotypic traits of weight gain rate of yellow catfish. The horizontal axis in the figure is the chromosome (chr) number, and the vertical axis is the -log10 (p) value of the significant SNP site. SNPs that are significantly associated with the weight gain rate of feeding roughage are obtained.

[0076] The genotypes and weight gain rate phenotypes formed by each SNP polymorphism were further analyzed and screened in the following manner:

[0077] (1) There are corresponding individuals with no mutation, heterozygous mutation, and homozygous mutation genotypes, and the number of individuals is not 0;

[0078] (2) The weight gain rate data corresponding to the genotypes of no mutation, heterozygous mutation and homozygous mutation were statistically analyzed, that is, the three genotypes of no mutation, heterozygous mutation and homozygous mutation were used as three groups for variance analysis to screen SNPs with significant differences between homozygous mutation and no mutation or heterozygous mutation.

[0079] After further analysis of the obtained significant SNPs, the SNP sites were found to be located in the introns of the gene, and then SNP molecular markers associated with roughage utilization traits were screened.

[0080] The SNP molecular marker of the present invention is located in the intron of the plxnb2b gene (nucleotide sequence see NCBI Gene ID: 113660217) ( Figure 1 The physical location is located at base 7237643 of chromosome 10 (nucleotide sequence see NCBI accession number: NC_062527.1) of the yellow catfish genome HZAU_PFXX_2.0 version (nucleotide sequence see NCBI Genbank assembly number: GCA_022655615.1), and there are single nucleotide polymorphisms of T and G, which results in three alleles at this site: TT, TG and GG.

[0081] 4. Association analysis between different genotypes of SNP molecular markers and roughage utilization traits of yellow catfish populations

[0082] The yellow catfish population was grouped according to the genotype (TT, TG and GG) of the 7237643th SNP site on chromosome 10. The individual body weight gain rate (%) data were used as the phenotypic value, and group t-tests were performed on different genotypes. The p-value indicated the correlation between SNP variation and phenotype after the t-test. A value less than 0.05 was significant (indicated by the symbol *), and a value less than 0.01 was extremely significant (indicated by the symbol **).

[0083] like Figure 2 As shown, when the 7237643 position of chromosome 10 NC_062527.1 of the HZAU_PFXX_2.0 version of the yellow catfish genome was TT and TG genotypes, the weight gain rates of yellow catfish individuals fed with roughage were 37.2% and 41.5%, respectively, and the corresponding numbers of individuals were 25 and 96, respectively; when the 7237643 position of chromosome 10 NC_062527.1 of the HZAU_PFXX_2.0 version of the yellow catfish genome was GG genotype, the average weight gain rate of yellow catfish individuals fed with roughage was 55.5%, and the corresponding number of individuals was 77, which was extremely significantly different from the corresponding weight gain rates of the previous two genotypes.

[0084] Therefore, by detecting the genotype of this SNP molecular marker, yellow catfish individuals with excellent roughage tolerance and utilization rate can be screened out, which provides an effective detection means for early selection and breeding of yellow catfish and improving breeding efficiency. It also provides a reliable targeting site for the genetic improvement of yellow catfish roughage utilization traits. By selecting yellow catfish individuals with the GG genotype, the group's utilization efficiency of roughage can be gradually improved, thereby enhancing the economic benefits of the yellow catfish farming industry.

[0085] 4. Detection of SNP molecular markers

[0086] Based on the upstream and downstream sequences of position 7237643 of chromosome 10 NC_062527.1 of the yellow catfish genome HZAU_PFXX_2.0 version, specific primers were designed. The primer sequences are as follows:

[0087] plxnb2b-F: GCAGGGCAAGCCTAACTACA (see SEQ ID NO. 1);

[0088] plxnb2b-R: CCACAGTGAGCGACAGTTCT (see SEQ ID NO. 2).

[0089] Using the DNA molecule shown in SEQ ID NO.1 and the DNA molecule shown in SEQ ID NO.2 as a primer pair, PCR amplification is performed on the target sequence or genomic DNA containing the single nucleotide mutation site to obtain the reverse sequence of the amplification product shown in SEQ ID NO.3. The nucleotide polymorphism is located at the 216 bp (M base) of SEQ ID NO.3. Reverse sequencing is performed on the PCR amplification product, and the sequencing sequence is shown in SEQ ID NO.4. The molecular marker is located at the 228 bp (K base). The genotype of the single nucleotide mutation site is determined, and the roughage tolerance trait and roughage utilization rate of the yellow catfish individual are further determined.

[0090] 5’-GCAGGGCAAGCCTAACTACAGATTAGCAAGTTCTCTGTTGTAGCATTGCTAATTC TTTAACTTGCAGATGTTATAATAAACATTGTCCCCTTTATTAGGAACACATGTACACCTGCTTATTAATGCTGAAAACTGGAAAAAGACCGGTGATGTCTTTTTCTAATCTTTAGCTGGGTGAGACTGTGACCATGATGGGCTCAGATTATTGTTCTTGG M TTACAGGAGAGGAATCTGATGTGATTTTCCAGTTGATATTCACACAACTCAAGGTTTGATGTGATACGTGTGTGTGTGCTGAGATGCTTTTCCACTCAACTCTGATAATGAGCGATTATTTGAGGTACCAAAGGCAGTTCCGGGCTGCTCTAACCAGTCTGGCCATTTTCTTTAGATATCTCTAGATAACATGTGGTTTCCGCCCACAGAACTGTCGCTCACTGTGG-3’(see SEQ ID NO.3), M = A or C.

[0091] 5’-CCACAGTGAGCGACAGTTCTGTGGGCGGAAACCACATGTTATCTAGAGATATCT AAAGAAAATGGCCAGACTGGTTAGAGCAGCCCGGAACTGCCTTTGGTACCTCAAATAATCGCTCATTATCAGAGTTGAGTGGAAAAGCATCTCAGCACACACACACGTATCACATCAAACCTTGAGTTGTGTGAATATCAACTGGAAAATCACATCAGATTCCTCTCCTGTAA K CCAAGAACAATAATCTGAGCCCATCATGGTCACAGTCTCACCCAGCTAAAGATTAGAAAAAGACATCACCGGTCTTTTTCCAGTTTTCAGCATTAATAAGCAGGTGTACATGTGTTCCTAATAAAGGGGACAATGTTTATTATAACATCTGCAAGTTAAAGAATTAGCAATGCTACAACAGAGAACTTGCTAATCTGTAGTTAGGCTTGCCCTGC-3’(see SEQ ID NO.4), K = G or T.

[0092] According to the whole genome DNA sequencing results, the genomic DNA of individuals with SNP sites of TT, TG and GG genotypes were selected as templates to verify the specificity and detection effect of the primers and the authenticity of the molecular marker sites. Figure 3 The arrows in the figure indicate the three genotypes, TT, TG, and GG, respectively. It can be seen that the detection results of the primer amplification products are consistent with their actual genotypes, indicating that the primers have good specificity.

[0093] The SNP molecular markers provided by the present invention and the PCR detection primers developed based on the molecular markers can be used for the detection or breeding of yellow catfish strains with excellent roughage utilization traits, and can realize the conversion of phenotypic judgment into genotypic identification, thereby quickly identifying or screening individual fish with higher roughage tolerance and utilization rate at the molecular level.

[0094] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A SNP molecular marker associated with the roughage utilization trait of Pelteobagrus fulvidraco, and its detection primer or kit for use in the detection or breeding of the roughage utilization trait of Pelteobagrus fulvidraco, characterized in that: The SNP molecular marker is located at the 228th bp of the nucleotide sequence shown in SEQ ID NO. 4, and K is selected from G or T; The SNP molecular marker has TT, TG and GG genotypes, and the roughage utilization trait of the yellow catfish individuals with the GG genotype is significantly better than that of the yellow catfish individuals with the TT genotype and the TG genotype.

2. The use of the SNP molecular marker associated with the roughage utilization trait of Pelteobagrus fulvidraco, its detection primer or kit in the detection or breeding of the roughage utilization trait of Pelteobagrus fulvidraco according to claim 1, characterized in that: The roughage utilization trait of yellow catfish is roughage utilization rate or roughage tolerance.

3. The use of the SNP molecular marker associated with the roughage utilization trait of Pelteobagrus fulvidraco, its detection primer or kit in the detection or breeding of the roughage utilization trait of Pelteobagrus fulvidraco according to claim 1 or 2, characterized in that: The detection primers include an upstream primer and a downstream primer, and the nucleotide sequences of the upstream primer and the downstream primer are shown as SEQ ID NO. 1-2 respectively.

4. The use of the SNP molecular marker associated with the roughage utilization trait of Pelteobagrus fulvidraco, its detection primer or kit in the detection or breeding of the roughage utilization trait of Pelteobagrus fulvidraco according to claim 1 or 2, characterized in that: The kit includes the detection primers, which include an upstream primer and a downstream primer. The nucleotide sequences of the upstream primer and the downstream primer are shown in SEQ ID NO. 1-2, respectively.

5. The use of the SNP molecular marker associated with the roughage utilization trait of Pelteobagrus fulvidraco, its detection primer or kit in the detection or breeding of the roughage utilization trait of Pelteobagrus fulvidraco according to claim 4, characterized in that: The kit further comprises a PCR amplification reagent, which comprises Taq DNA polymerase, dNTP and a buffer reagent.

6. A detection primer for detecting a SNP molecular marker associated with the roughage utilization trait of yellow catfish, characterized in that: The SNP molecular marker is located at the 228th bp of the nucleotide sequence shown in SEQ ID NO. 4, and K is selected from G or T; The detection primers include an upstream primer and a downstream primer, and the nucleotide sequences of the upstream primer and the downstream primer are shown as SEQ ID NO. 1-2 respectively.

7. A kit for detecting SNP molecular markers associated with roughage utilization traits of yellow catfish, characterized in that: Comprising the detection primer as described in claim 6.

8. The kit for detecting SNP molecular markers associated with roughage utilization traits of Pelteobagrus fulvidraco according to claim 7, characterized in that: The kit further comprises a PCR amplification reagent, which comprises Taq DNA polymerase, dNTP and a buffer reagent.

9. A method for detecting roughage utilization properties of yellow catfish, characterized in that: The following steps are involved: Extracting genomic DNA from the tested yellow catfish individuals; Amplifying the genomic DNA by PCR using the detection primers shown in SEQ ID NO. 1-2 to obtain an amplified product; Reverse sequencing is performed on the amplified product, and the roughage utilization trait of the yellow catfish individual to be tested is determined according to the genotype of the base at 228 bp of the sequencing sequence; Among them, the base at the 228th bp has TT, TG and GG genotypes, and the roughage utilization trait of the tested yellow catfish individuals with the GG genotype is significantly better than that of the tested yellow catfish individuals with the TT genotype and the TG genotype.

10. A method for breeding yellow catfish for roughage utilization traits, characterized in that: The following steps are involved: Extracting genomic DNA from the tested yellow catfish individuals; Amplifying the genomic DNA by PCR using the detection primers shown in SEQ ID NO. 1-2 to obtain an amplified product; The amplified product is reverse sequenced, and according to the genotype of the base at the 228th bp of the sequencing sequence, the base at the 228th bp has TT, TG and GG genotypes, and the yellow catfish individuals to be tested with the GG genotype are selected for seed production.

Images