Wheat leaf rust resistance linkage SNP site, dCAPS molecular marker, primer, kit and application

Abstract

The invention discloses a wheat leaf rust resistance linkage SNP site, a dCAPS molecular marker, a primer, a kit and application, and belongs to the technical field of wheat disease resistance breeding and molecular biology. The invention provides a wheat leaf rust resistance linked SNP (Single Nucleotide Polymorphism) site, which is positioned at the 134261400th basic group on a wheat Chinese spring reference sequence 4D chromosome with the version number of IWGSCv1.1, and the polymorphic site of the SNP site is T / G. By means of 277 parts of wheat materials which have genotype data and are introduced from Turkey and in combination with a Chinese spring reference sequence, the dCAPS molecular marker of the SNP linked with the leaf rust resistant genetic locus in the wheat adult-plant stage is developed, different wheat can be accurately and rapidly detected, early molecular assisted selection of leaf rust resistant germplasm materials in the adult-plant stage is achieved, and the application prospect is wide. The wheat disease-resistant breeding efficiency is improved.

Description

Technical Field

[0001] The invention belongs to the technical field of wheat disease resistance breeding and molecular biology, and in particular relates to a wheat leaf rust resistance linked SNP site, a dCAPS molecular marker, a primer, a kit and applications. Background Art

[0002] Common wheat ( Triticum aestivum ) is an important food crop worldwide. Its disease resistance and stable yield are of great significance to world food security and agricultural development. With global warming and the toxicity variation of leaf rust fungi, the damage caused by wheat leaf rust is becoming more serious. Puccinia triticina Wheat leaf rust, caused by wheat ( ), is widespread in wheat-growing areas worldwide. Breeding disease-resistant varieties remains the most economical and environmentally friendly way to mitigate the damage caused by leaf rust. However, due to the complex control of quantitative genetic loci (QTLs), research on the genetics of wheat leaf rust resistance is still relatively underdeveloped, and the discovery of disease-resistant germplasm resources is also urgently needed.

[0003] Molecular markers typically refer to DNA markers, which are variations in DNA sequences between individuals or species that are close to or tightly linked to a target gene expressing a trait without affecting its expression. Based on their detection methods and development history, DNA markers are categorized into three types: first-generation molecular marker technology centers around molecular hybridization, such as restriction endonuclease fragment length polymorphism (RFLP); second-generation molecular marker technology centers around PCR, such as randomly amplified polymorphic DNA markers (RAPD) and simple sequence repeats (SSR); and third-generation molecular marker technology centers around DNA sequence, such as single nucleotide polymorphisms (SNP). With the application of second- and third-generation sequencing technologies, research on SSR and SNP molecular markers has gradually taken a leading position in plant research. Marker-assisted selection breeding is one of the most important applications of molecular markers. Selecting phenotypes based on molecular marker genotypes can overcome the time-consuming and labor-intensive nature of traditional breeding.

[0004] Simple methods for detecting SNPs are enzyme-amplified polymorphic sequence (CAPS) markers or derived CAPS markers (dCAPS). Both methods combine PCR amplification with enzyme digestion reactions, using restriction endonucleases to identify and digest the target SNP site sequence, followed by electrophoresis typing and identification. CAPS markers can be developed for SNP sequences with naturally occurring enzyme cleavage sites, while dCAPS markers can be developed for SNPs with non-naturally occurring enzyme cleavage sites by artificially introducing mutant bases. CAPS and dCAPS molecular markers are co-dominant, site-specific, simple to operate, fast to detect, low-cost, and independent of precision instruments and equipment. They can be used for rapid plant genotyping, localization, genetic diversity analysis, and variety identification.

[0005] Currently, there are few studies and reports on dCAPS molecular markers related to wheat leaf rust resistance in the adult stage. Therefore, there is an increasing need to develop dCAPS molecular markers related to wheat leaf rust and use them to accurately and rapidly identify wheat and its hybrid progeny for adult leaf rust resistance. Summary of the Invention

[0006] In view of this, the purpose of the present invention is to provide a wheat leaf rust resistance linked SNP site, which can be used to accurately and quickly detect different wheat varieties, realize early molecular assisted selection of leaf rust resistant germplasm materials in the adult stage, and improve the efficiency of wheat disease resistance breeding.

[0007] Another object of the present invention is to provide a dCAPS molecular marker for detecting the SNP site.

[0008] Another object of the present invention is to provide a primer set for detecting the dCAPS molecular marker.

[0009] Another object of the present invention is to provide a kit.

[0010] Another object of the present invention is to provide a use of the SNP site or the dCAPS molecular marker or the primer set or the kit in wheat molecular marker-assisted breeding.

[0011] Another object of the present invention is to provide a method for identifying wheat leaf rust resistance.

[0012] Another object of the present invention is to provide a method for identifying genetic loci for resistance to leaf rust in wheat during the adult stage.

[0013] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions: The present invention provides a wheat leaf rust resistance linked SNP site, wherein the SNP site is located at base 134261400 on chromosome 4D of the wheat Chinese Spring reference sequence with version number IWGSC_v1.1, and the polymorphic site is T / G.

[0014] The present invention also provides a dCAPS molecular marker for detecting the SNP site, and the nucleotide sequence of the dCAPS molecular marker is shown in any one of SEQ ID NOs. 1 to 2.

[0015] Preferably, position 22 of the SEQ ID NO. 1~2 is the SNP site.

[0016] The present invention also provides a primer set for detecting the dCAPS molecular marker, wherein the primer set includes primers shown in SEQ ID NOs. 3-4.

[0017] The present invention also provides a kit comprising the primer set.

[0018] Preferably, the kit further comprises restriction endonuclease HphI.

[0019] The present invention also provides an application of the SNP site, the dCAPS molecular marker, the primer set, or the kit in wheat molecular marker-assisted breeding.

[0020] Preferably, the wheat molecular marker-assisted breeding includes identification of wheat leaf rust resistance genetic loci, identification of wheat leaf rust resistance or breeding of wheat leaf rust resistance germplasm.

[0021] The present invention also provides a method for identifying wheat leaf rust resistance, which comprises: detecting the genotype of the SNP site in the genome of the wheat sample; when the genotype is GG, the wheat sample is a disease-resistant material; when the genotype is TT, the wheat sample is a disease-susceptible material.

[0022] The present invention also provides a method for identifying a genetic locus for resistance to leaf rust in wheat at the adult stage, the method comprising the following steps: using the genomic DNA of the wheat to be tested as a template and performing PCR amplification using the primer set; using the restriction endonuclease HphI to enzymatically digest the product obtained by the PCR amplification; when the enzymatic digestion product contains two bands of 31 bp and 202 bp, the wheat material contains the genetic locus for resistance to leaf rust in the adult stage; when the enzymatic digestion product contains a band of 233 bp, the wheat material does not contain the genetic locus for resistance to leaf rust in the adult stage.

[0023] Beneficial effects of the present invention: The present invention provides a wheat leaf rust resistance linked SNP locus. Utilizing this SNP locus, different wheat varieties can be accurately and rapidly detected, enabling early molecular-assisted selection of germplasm materials resistant to leaf rust in the adult plant stage, thereby improving the efficiency of wheat disease resistance breeding. The present invention develops a dCAPS molecular marker for the wheat leaf rust resistance linked SNP locus. Utilizing the dCAPS molecular marker, wheat leaf rust resistance lines can be rapidly and accurately detected. The detection time is short, with results obtained within a few hours. This greatly improves the detection accuracy, shortens the detection time, and can accelerate the disease resistance breeding process for wheat leaf rust resistance. This solves the problem of difficulty in detecting wheat leaf rust resistance genes in the adult plant stage in the prior art. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is the Manhattan plot of the genome-wide association analysis of leaf rust resistance genetic loci in 277 Turkish wheat materials in Example 1; Figure 2PCR amplification of seven resistant and seven susceptible Turkish wheat accessions using the dCAPS primer set in Example 2 was performed, and the agarose gel electrophoresis results of the PCR products after digestion with the corresponding restriction endonucleases were shown. M represents the DL2000 marker, R1-R7 represent resistant accessions, S1-S7 represent susceptible accessions, the R1-R7 amplification products are 31 bp and 202 bp in length, and the S1-S7 amplification product is 233 bp in length. Figure 3 The results of agarose gel electrophoresis of PCR amplification of other wheat materials in Example 3 and digestion of PCR products with corresponding restriction endonucleases are shown, where: M is the DL2000 marker, S1'-S7' are susceptible materials, R1'-R7' are resistant materials, the length of the S1'-S7' amplification product is 233 bp, and the lengths of the R1'-R7' amplification products are 31 bp and 202 bp respectively. DETAILED DESCRIPTION

[0025] The present invention provides a wheat leaf rust resistance linked SNP site, wherein the SNP site is located at base 134261400 on chromosome 4D of the wheat Chinese Spring reference sequence with version number IWGSC_v1.1, and the polymorphic site is T / G.

[0026] This study used 277 Turkish wheat accessions with available genotype data, combined with the Chinese Spring reference sequence (IWGSC_v1.1), to identify a single-nucleotide polymorphism (SNP) tightly linked to the QLr.hebau-4DS locus, which confers adult leaf rust resistance. This SNP allows for accurate and rapid detection of different wheat varieties, enabling early molecular-assisted selection of germplasm resistant to adult leaf rust and improving the efficiency of wheat breeding for disease resistance.

[0027] The present invention also provides a dCAPS molecular marker for detecting the SNP site, and the nucleotide sequence of the dCAPS molecular marker is shown in any one of SEQ ID NOs. 1 to 2.

[0028] In the present invention, position 22 of SEQ ID NO. 1~2 is the SNP site.

[0029] The present invention also provides a primer set for detecting the dCAPS molecular marker, wherein the primer set preferably includes primers shown in SEQ ID NOs. 3-4.

[0030] The present invention also provides a kit, which preferably comprises the primer set.

[0031] In the present invention, the kit preferably further comprises a restriction endonuclease HphI.

[0032] The present invention also provides an application of the SNP site, the dCAPS molecular marker, the primer set, or the kit in wheat molecular marker-assisted breeding.

[0033] In the present invention, the wheat molecular marker-assisted breeding preferably includes identification of wheat leaf rust resistance genetic loci, identification of wheat leaf rust resistance or breeding of wheat leaf rust resistance germplasm.

[0034] In the present invention, the leaf rust resistance genetic locus preferably includes QLr.hebau-4DS.

[0035] In the present invention, the wheat leaf rust-resistant germplasm is preferably wheat leaf rust-resistant germplasm at the adult stage.

[0036] The present invention also provides a method for identifying wheat leaf rust resistance, which comprises: detecting the genotype of the SNP site in the genome of the wheat sample; when the genotype is GG, the wheat sample is a disease-resistant material; when the genotype is TT, the wheat sample is a disease-susceptible material.

[0037] In the present invention, the method for detecting the genotype of the SNP site is not particularly limited and can be conventionally selected according to actual needs. In some embodiments, the detection method preferably includes: using the genomic DNA of the wheat sample as a template, performing PCR amplification using the primer set; using the restriction endonuclease HphI to enzymatically digest the product obtained by the PCR amplification; when the enzymatic digestion product contains two bands of 31 bp and 202 bp, the genotype of the SNP site in the genome of the wheat sample is GG; when the enzymatic digestion product contains a single band of 233 bp, the genotype of the SNP site in the genome of the wheat sample is TT.

[0038] The present invention also provides a method for identifying a genetic locus for resistance to leaf rust in wheat at the adult stage, the method preferably comprising the following steps: using the genomic DNA of the wheat to be tested as a template, performing PCR amplification using the primer set; performing enzyme digestion on the product obtained by the PCR amplification using the restriction endonuclease HphI; when the enzyme digestion product contains two bands of 31 bp and 202 bp, the wheat material contains the genetic locus for resistance to leaf rust in the adult stage; when the enzyme digestion product contains a band of 233 bp, the wheat material does not contain the genetic locus for resistance to leaf rust in the adult stage.

[0039] In the present invention, the leaf rust resistance genetic locus preferably includes QLr.hebau-4DS.

[0040] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0041] In the following examples, unless otherwise specified, all methods are conventional.

[0042] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0043] Example 1 Obtaining SNPs Linked to Wheat Leaf Rust Resistance Leaf rust ( Puccinia triticina ) was the pathogen, and the method of inoculating leaf rust in the late stage of field planting was adopted. In late October, 277 Turkish wheat materials were identified for disease resistance at the third factory of Hebei Agricultural University. Each material was sown in one row with a row length of 2m and a row spacing of 25cm. One row of the control variety Xiaoyan 22 was sown every 10 rows. Around mid-April of the following year, the test materials were inoculated with the fungus by the dusting method after jointing. The specific method was: leaf rust spore powder and talcum powder were evenly mixed in a ratio of 1:1000. In the evening, the test materials were evenly sprayed with 0.03% Tween 20 aqueous solution, and then the leaf rust spore powder was sprayed on the leaves of the test materials with a duster. The ground film was covered to keep it moist for 3 days and then uncovered. The disease was fully developed after about 30 days for investigation. In this study, the grading of leaf rust in the adult stage was based on a severity grading standard of 0-100%. 277 global wheat germplasm resources introduced from Turkey (most of these wheat materials were breeding materials with only germplasm pedigrees) were evaluated for resistance to leaf rust in the adult stage. It was found that approximately 53% of the wheat materials showed a high level of resistance to leaf rust.

[0044] Combined with the existing chip data of the above materials, a genome-wide association study (GWAS) was conducted on the genetic loci of wheat resistance to adult leaf rust ( Figure 1 ), three highly confident linked SNPs were identified. Haplotype analysis was performed on three closely linked SNPs associated with wheat leaf rust resistance within the QLr.hebau-4DS region of chromosome 4DS. Combining the resistant and susceptible phenotypes, two major haplotypes, QLr(4DS) and QLr(-), were identified. Significant linkage between these two haplotypes was observed. The genotype of SNP AX-110950982 (located at base 134261400 on chromosome 4D of the wheat Chinese Spring reference sequence (IWGSC_v1.1), with a T / G polymorphism, generally reflects the haplotype of QLr.hebau-4DS.

[0045] Example 2 Development of tightly linked dCAPS molecular markers for wheat leaf rust resistance 1. Design of dCAPS primers Based on the SNP site (AX-110950982) provided in Example 1, adjacent sequences were extracted from the Chinese Spring genome, and dCAPS primer pairs were designed using dCAPS Finder 2.0 (http: / / helix.wustl.edu / dcaps / ): dCAPS molecular markers: SEQ ID NO. 1: CCACATCACCAACCTCACGGATAATATGAGACTATAATACGAC; SEQ ID NO. 2: CCACATCACCAACCTCACGGAGAATATGAGACTATAATACGAC.

[0046] 4DS-AX-110950982 (dCAPS): Forward primer: CCACATCACCAACCTCACGGT (SEQ ID NO. 3); Reverse primer: TTTATTAATCTCGTGCCGAGAAACA (SEQ ID NO. 4).

[0047] The PCR amplification product using this primer pair is 233 bp, and its sequence is shown in SEQ ID NO. 5 or SEQ ID NO. 6. Position 22 in the sequence is T / G, a polymorphic site. Resequencing data analysis revealed that wheat germplasm has two genotypes at this site: TT and GG. The GG genotype is digested by the enzyme, while the TT genotype is not.

[0048] 2. Extraction and PCR amplification of sample genomic DNA All wheat materials used in this study were breeding materials introduced from abroad. Material information can be found on the USDA-GRIN website (https: / / www.ars-grin.gov / ). Seven disease-resistant materials (AXE / / TOSUNBEY (R1), PFAU / SERI.1B / / AMAD / 3 / KRONSTAD F2004 / 4 / SHARK-6 / 5 / SHARK-6 (R2), BONITO-36 / 6 / PEHLIVAN / 5 / JUP / 4 / CLLF / 3 / II14.53 / ODIN / / CI13431 / WA00477 / 7 / RSH2* / 10120 / / ZAGROS (R3), NACIBEY (R4), Fengkang 2 (R5), Zhoumai 19 (R6), Zaoyangmai (R7)) and seven disease-susceptible materials (AXE / / TOSUNBEY (S1), CHAMRAN / MV17 (S2), Honghuomai ZM1934 (S3), Gaolemai ZM1885 (S4), Weimai Genomic DNA was extracted from young leaves of wheat from strains 20 (S5), Baituxiaomai ZM1754 (S6), and Jimai 26 (S7) for subsequent dCAPS molecular marker development experiments; DNA extraction method: (1) Samples were collected in the greenhouse. One wheat leaf was cut into small pieces and placed in a 2 mL centrifuge tube (if not extracted immediately, stored at -80°C); (2) Add a grinding bead to each centrifuge tube, cool it in liquid nitrogen, and then place it in a freeze grinder (pay attention to balancing). Set the freeze grinder temperature to -50°C, set the frequency to 70Hz, the working time to 70s, the interval time to 8s, and the number of cycles to 3. After grinding, take it out, check whether it is completely ground, and mark it; (3) Add 600 μL of DNA extraction buffer to each tube (to fully expose the DNA of the ground tissue), shake thoroughly, and place in a 65°C water bath for 30 min; (4) Place the tube on ice for 15 minutes, cool it to room temperature, add 300 μL of 6 mol / L ammonium acetate, mix well, and place it in a 4°C refrigerator for 15 minutes; (5) Centrifuge at 12000 rpm for 5 min and collect 600 μL of supernatant; (6) Add 360 μL of isopropanol to a new 1.5 mL centrifuge tube, take 600 μL of the supernatant from the previous step and mix well, let the DNA precipitate, and place in a 4°C refrigerator for 5 min; (7) Centrifuge at 12000 rpm for 15 min to precipitate the DNA and aspirate the supernatant (this step should not take too long to prevent DNA loss); (8) Add 500 μL of 75% alcohol to clean the DNA, and bounce the DNA from the bottom of the tube to clean it; (9) Centrifuge at 12000 rpm for 1 min and discard the supernatant; (10) Repeat steps 8 and 9 once; (11) Aspirate the supernatant, place the 1.5 mL centrifuge tube in a clean bench, open the lid, blow dry; (12) Use 100 μL of sterile water to dissolve the DNA. Leave it at room temperature for half a day until the DNA at the bottom dissolves at room temperature.

[0049] The extracted sample DNA was diluted to a concentration of 100 ng / μL and used as a template. The above-mentioned dCAPS primer pair (SEQ ID NO. 3-SEQ ID NO. 4) was used as primers. A PCR reaction system (15 μL) was constructed according to the following conditions: 1 μL of genomic template, 1 μL of forward primer at OD = 0.1, 1 μL of reverse primer at OD = 0.1, 7.5 μL of 2× Rapid Taq Master Mix, and 4.5 μL of ddH2O.

[0050] The PCR amplification program for 4DS-AX-110950982 was as follows: pre-denaturation at 94°C for 5 min, cycling parameters of denaturation at 94°C for 30 s, annealing at 62.6°C for 30 s, and extension at 72°C for 15 s for 35 cycles, and full extension at 72°C for 10 min.

[0051] After amplification, the amplified products were stored at 4°C. The amplified products were detected by 1% agarose gel electrophoresis and photographed under a UV gel imaging system.

[0052] 3. Identification of material amplification products The extracted genomic DNA was amplified using TIANGEN's 2×Taq PCR Mix, using the above-mentioned dCAPS primer pair (SEQ ID NO.3-SEQ ID NO.4) as primers. The amplification system (15 μL) was as follows: 2×Taq PCR Mix 7.5 μL, template DNA 1 μL, forward primer with OD = 0.1 1 μL, reverse primer with OD = 0.1 1 μL, ddH2O 4.5 μL. The amplification procedures were consistent with the above-mentioned amplification procedures.

[0053] Some PCR amplification products were sent to the Biotechnology Sequencing Department for sequencing. The results showed that there was a difference in the 4DS-AX-110950982 sequence between the resistant and susceptible materials. The genotype of the resistant material was GG, while the genotype of the susceptible material was TT.

[0054] 4. Enzyme digestion The PCR product of 4D-AX-110950982 obtained in step 2 of this example was digested with the restriction endonuclease HphI from Thermo Fisher Scientific. The digestion system (15 μL) was as follows: 7 μL of PCR product, 1 μL of 10× Tango Buffer, 0.5 μL of HphI, and 6.5 μL of ddH2O. The digestion conditions were: 37°C for 3 hours.

[0055] The above enzyme digestion products were subjected to 3% polyacrylamide gel electrophoresis, with a sample volume of 15 μL and electrophoresis conditions of 65V, 100mA, and 50min. The PCR products of the anti-susceptibility material were digested and electrophoresed respectively. The results are as follows Figure 2 shown.

[0056] The amplified products were detected by 1% agarose gel electrophoresis. It was found that the PCR product (R) of the resistant material and the PCR product (S) of the susceptible material were both 233 bp according to the marker 4DS-AX-110950982. After HphI digestion, the agarose gel electrophoresis results of the susceptible material (S1-S7) had a main band of 233 bp, and the electrophoresis results of the resistant parent (R1-R7) had two bands of 31 bp and 202 bp respectively. Figure 2 The results showed that when the genotype was GG, i.e., the disease-resistant genotype, the PCR product could be digested by HphI, and two bands of 31 bp and 202 bp were present after digestion. When the genotype was TT, i.e., the disease-susceptible genotype, under the same conditions, the amplified product could not be digested by HphI, and a main band of 233 bp was present after digestion.

[0057] The above results show that the 4D-AX-110950982 locus genotypes of the resistant and susceptible materials are consistent with the genome and resequencing data. Amplification using the dCAPS primers of the present invention, combined with the HphI enzyme digestion results, can accurately distinguish the different genotypes of the resistant and susceptible materials.

[0058] Example 3 Verification Experiment Fourteen wheat materials other than the research materials were selected, including disease-resistant materials (WATAN-7 / SEKHRAH-2 (R1'), ATTILA 50Y / / ATTILA / BCN / 3 / KAPSW / SHUHA-17 (R2'), HUBARA-5 / ANGI-1 (R3'), Yangmai 17 (R4'), Wannian 2 (R5'), Heng 136 (R6'), Xinchun 8 (R7')) and susceptible materials (Yumai 48 (S1'), Xiaoyan 22 (S2'), Hengguan 35 (S3'), Qingfeng 1 (S4'), Yangmai 18 (S5'), Xinyang 12 (S6'), ROANE (S7')), and the dCAPS molecular marker was verified. The method was consistent with parts 2-4 of Example 2. The enzyme digestion results are shown in Figure 2. Figure 3 As shown, it can be seen that after enzyme digestion, the disease-resistant material (R1'-R7') has two bands of 31bp and 202bp, while the disease-susceptible material (S1'-S7') has only one main band of 233bp after enzyme digestion. The experimental results are consistent with the conclusion.

[0059] In summary, the dCAPS molecular marker designed for this SNP site in the present invention can be effectively used for the molecular identification of wheat varieties with leaf rust resistance at different adult stages. The development of this dCAPS marker can significantly shorten the breeding period and reduce the cost of breeding work. It is of great significance in the use of wheat germplasm resources to cultivate wheat varieties with leaf rust resistance at the adult stage.

[0060] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A wheat leaf rust resistance linked SNP locus, characterized in that: The SNP site is located at base 134261400 on chromosome 4D of the wheat Chinese Spring reference sequence with version number IWGSC_v1.1, and its polymorphic site is T / G.

2. A dCAPS molecular marker for detecting the SNP site according to claim 1, characterized in that: The nucleotide sequence of the dCAPS molecular marker is shown in any one of SEQ ID NOs. 1 to 2.

3. The dCAPS molecular marker according to claim 2, characterized in that Position 22 of the SEQ ID NO. 1~2 is the SNP site.

4. A primer set for detecting the dCAPS molecular marker according to any one of claims 2 to 3, characterized in that: The primer set includes primers shown in SEQ ID NO.3~4.

5. A kit, characterized in that The kit comprises the primer set according to claim 4.

6. The kit according to claim 5, characterized in that The kit also contains the restriction endonuclease HphI.

7. Use of the SNP site according to claim 1, the dCAPS molecular marker according to any one of claims 2 to 3, the primer set according to claim 4, or the kit according to any one of claims 5 to 6 in wheat molecular marker-assisted breeding.

8. The use according to claim 7, characterized in that The wheat molecular marker-assisted breeding includes identification of wheat leaf rust resistance genetic loci, identification of wheat leaf rust resistance or breeding of wheat leaf rust resistance germplasm.

9. A method for identifying wheat leaf rust resistance, characterized in that: The identification method comprises: detecting the genotype of the SNP site of claim 1 in the genome of the wheat sample; when the genotype is GG, the wheat sample is a disease-resistant material; when the genotype is TT, the wheat sample is a disease-susceptible material.

10. A method for identifying genetic loci for resistance to leaf rust in wheat during the adult stage, characterized in that: The method comprises the following steps: using the genomic DNA of the wheat to be tested as a template and performing PCR amplification using the primer set according to claim 4; using the restriction endonuclease HphI to enzymatically digest the product obtained by the PCR amplification; when the enzymatic digestion product contains two bands of 31 bp and 202 bp, the wheat material contains a genetic locus for resistance to leaf rust in the adult plant stage; and when the enzymatic digestion product contains a band of 233 bp, the wheat material does not contain a genetic locus for resistance to leaf rust in the adult plant stage.

Images