A wheat leaf rust resistance linkage SNP site, a dCAPS molecular marker, a primer, a kit and an application thereof

Abstract

The application discloses a wheat leaf rust resistance linkage SNP site, a dCAPS molecular marker, a primer, a kit and application, and belongs to the technical field of wheat disease resistance breeding and molecular biology. The application provides a wheat leaf rust resistance linkage SNP site, wherein the SNP site is located at the 134261400th base on the 4D chromosome of a Chinese spring reference sequence with the version number of IWGSC_v1.1, and the polymorphism site is T / G. With the aid of 277 wheat materials introduced from Turkey with genotype data, and in combination with the Chinese spring reference sequence, a dCAPS molecular marker of the SNP site linked to the wheat adult stage leaf rust resistance genetic locus is developed, different wheat can be accurately and rapidly detected, early molecular assisted selection of the adult stage leaf rust resistance germplasm material is realized, and the efficiency of wheat disease resistance breeding is improved.

Description

Technical Field

[0001] This invention belongs to the fields of wheat disease resistance breeding and molecular biology technology, and particularly relates to a wheat leaf rust resistance linkage SNP site, dCAPS molecular marker, primers, kit and application. Background Technology

[0002] Common wheat ( Triticum aestivum Wheat leaf rust is an important food crop globally, and its disease resistance and stable yield are of great significance to world food security and agricultural development. With global warming and the increasing virulence of leaf rust fungi, wheat leaf rust is causing increasingly severe damage. The disease is caused by leaf rust fungi (… Puccinia triticina Wheat leaf rust, caused by [unspecified pathogen], is widespread in wheat-growing regions worldwide. Breeding resistant varieties remains the most economical and environmentally friendly means of mitigating the damage caused by leaf rust. However, due to the complex control of quantitative genetic loci (QTLs), research on the genetics of wheat resistance to leaf rust is still relatively lagging, and resistant germplasm resources urgently need to be explored.

[0003] Molecular markers generally refer to DNA molecular markers, which are differences in DNA sequences between individuals or species that are closely linked to a target gene expressing a certain trait, without affecting the expression of the target gene. Based on detection methods and development history, DNA molecular markers are divided into three categories: first-generation molecular marker technology, centered on molecular hybridization techniques, such as restriction fragment length polymorphism (RFLP); second-generation molecular marker technology, centered on PCR techniques, such as random amplified polymorphic DNA markers (RAPD) and simple repeat sequences (SSR); and third-generation molecular marker technology, centered on DNA sequences, such as single nucleotide polymorphisms (SNP). With the application of second- and third-generation sequencing technologies, research on SSR and SNP molecular markers has gradually occupied a major position in plant research. Molecular marker-assisted selection breeding is one of the most important applications of molecular markers. Selecting phenotypes based on molecular marker genotypes can overcome the time-consuming and labor-intensive drawbacks of traditional breeding methods.

[0004] A simple method for detecting SNPs is the amplified polymorphic sequence (CAPS) marker or the derivatized CAPS marker (dCAPS). Both methods combine PCR amplification with restriction enzyme digestion, using restriction endonucleases to recognize and digest the target SNP site sequence, followed by electrophoretic typing. CAPS markers can be developed for SNP sequences with naturally occurring restriction sites, while dCAPS can be developed by artificially introducing mutant bases for SNPs without naturally occurring restriction sites. CAPS and dCAPS molecular markers are characterized by co-dominance, site specificity, ease of operation, rapid detection, low cost, and independence from sophisticated instruments, making them suitable for rapid plant genotyping, mapping, genetic diversity analysis, and variety identification.

[0005] There are currently few studies and reports on dCAPS molecular markers associated with wheat leaf rust resistance at the adult stage. Therefore, there is an increasing need to develop dCAPS molecular markers associated with wheat leaf rust and use them for accurate and rapid identification of wheat and its hybrid offspring's resistance to wheat leaf rust at the adult stage. Summary of the Invention

[0006] In view of this, the purpose of this invention is to provide a wheat leaf rust resistance linkage SNP locus. This SNP locus can be used to accurately and rapidly detect different wheat varieties, enabling early molecular-assisted selection of leaf rust resistant germplasm materials at the mature stage, thereby improving the efficiency of wheat disease resistance breeding.

[0007] Another object of the present invention is to provide a dCAPS molecular marker for detecting the SNP site.

[0008] Another object of the present invention is to provide a primer set for detecting the dCAPS molecular marker.

[0009] Another object of the present invention is to provide a reagent kit.

[0010] Another object of the present invention is to provide an application of the SNP site, the dCAPS molecular marker, the primer set, or the kit in marker-assisted breeding of wheat.

[0011] Another objective of this invention is to provide a method for identifying resistance to wheat leaf rust.

[0012] Another object of the present invention is to provide a method for identifying genetic loci for resistance to leaf rust in mature wheat plants.

[0013] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0014] This invention provides a wheat leaf rust resistance linkage SNP site, which is located at base 134261400 on chromosome 4D of the wheat Chinese Spring reference sequence with version number IWGSC_v1.1, and its polymorphic site is T / G.

[0015] The present invention also provides a dCAPS molecular marker for detecting the SNP site, wherein the nucleotide sequence of the dCAPS molecular marker is shown in any one of SEQ ID NO. 1 to 2.

[0016] Preferably, the 22nd position of SEQ ID NO.1~2 is the SNP site.

[0017] The present invention also provides a primer set for detecting the dCAPS molecular marker, the primer set comprising the primers shown in SEQ ID NO. 3-4.

[0018] The present invention also provides a kit comprising the primer set.

[0019] Preferably, the kit further comprises the restriction endonuclease HphI.

[0020] The present invention also provides an application of the SNP site, the dCAPS molecular marker, the primer set, or the kit in marker-assisted breeding of wheat.

[0021] Preferably, the wheat molecular marker-assisted breeding includes identification of wheat leaf rust resistance genetic loci, identification of wheat leaf rust resistance, or selection of wheat leaf rust resistant germplasm.

[0022] The present invention also provides a method for identifying resistance to wheat leaf rust, the method comprising: detecting the genotype of the SNP locus in the genome of a wheat sample, wherein when the genotype is GG, the wheat sample is a resistant material; and when the genotype is TT, the wheat sample is a susceptible material.

[0023] The present invention also provides a method for identifying genetic loci for resistance to leaf rust in mature wheat plants. The method includes the following steps: using the genomic DNA of the wheat to be tested as a template, performing PCR amplification using the primer set; digesting the PCR amplification product with the restriction endonuclease HphI; when the digestion product contains two bands of 31 bp and 202 bp, the wheat material contains genetic loci for resistance to leaf rust in mature plants; when the digestion product contains a band of 233 bp, the wheat material does not contain genetic loci for resistance to leaf rust in mature plants.

[0024] The beneficial effects of this invention are:

[0025] This invention provides a wheat leaf rust resistance linkage SNP locus. This SNP locus allows for accurate and rapid detection of different wheat varieties, enabling early molecular-assisted selection of germplasm materials resistant to mature-stage leaf rust and improving the efficiency of wheat disease resistance breeding. This invention also develops a dCAPS molecular marker targeting the wheat leaf rust resistance linkage SNP locus. Using this dCAPS molecular marker, wheat leaf rust resistant lines can be detected rapidly and accurately, with results obtained within a few hours, significantly improving detection accuracy and shortening the detection time. This accelerates the wheat leaf rust resistance breeding process and solves the problem of the difficulty in detecting wheat leaf rust resistance genes at the mature stage in existing technologies. Attached Figure Description

[0026] Figure 1 Manhattan plot of genome-wide association analysis of leaf rust resistance genetic loci in 277 Turkish wheat materials in Example 1;

[0027] Figure 2The results of PCR amplification of 7 disease-resistant and 7 disease-susceptible Turkish wheat materials using the dCAPS primer set in Example 2 are shown in the agarose gel electrophoresis results after the PCR products were digested with the corresponding restriction endonucleases. In the figure: M is DL2000 Marker, R1-R7 are disease-resistant materials, S1-S7 are disease-susceptible materials, the lengths of the amplification products of R1-R7 are 31bp and 202bp, and the length of the amplification products of S1-S7 is 233bp.

[0028] Figure 3 The results of PCR amplification of other wheat materials in Example 3, and the agarose gel electrophoresis results of the PCR products digested with the corresponding restriction endonucleases, are shown. In the figures: M is the DL2000 Marker, S1'-S7' are susceptible materials, R1'-R7' are resistant materials, the length of the S1'-S7' amplification product is 233bp, and the lengths of the R1'-R7' amplification products are 31bp and 202bp, respectively. Detailed Implementation

[0029] This invention provides a wheat leaf rust resistance linkage SNP site, which is located at base 134261400 on chromosome 4D of the wheat Chinese Spring reference sequence with version number IWGSC_v1.1, and its polymorphic site is T / G.

[0030] This invention utilizes 277 Turkish wheat accessions with available genotype data, combined with the Chinese spring reference sequence (IWGSC_v1.1), to develop a SNP locus closely linked to the wheat mature-stage leaf rust resistance genetic locus QLr.hebau-4DS. This SNP locus allows for accurate and rapid detection of different wheat varieties, enabling early molecular-assisted selection of germplasm materials resistant to mature-stage leaf rust and improving the efficiency of wheat disease resistance breeding.

[0031] The present invention also provides a dCAPS molecular marker for detecting the SNP site, wherein the nucleotide sequence of the dCAPS molecular marker is shown in any one of SEQ ID NO. 1 to 2.

[0032] In this invention, the 22nd position of SEQ ID NO.1~2 is the SNP site.

[0033] The present invention also provides a primer set for detecting the dCAPS molecular marker, wherein the primer set preferably includes the primers shown in SEQ ID NO. 3-4.

[0034] The present invention also provides a kit, wherein the kit preferably comprises the primer set.

[0035] In this invention, the kit preferably further comprises the restriction endonuclease HphI.

[0036] The present invention also provides an application of the SNP site, the dCAPS molecular marker, the primer set, or the kit in marker-assisted breeding of wheat.

[0037] In this invention, the preferred methods of wheat molecular marker-assisted breeding include identification of wheat leaf rust resistance genetic loci, identification of wheat leaf rust resistance, or selection of wheat leaf rust resistant germplasm.

[0038] In this invention, the genetic locus for resistance to leaf rust preferably includes QLr.hebau-4DS.

[0039] In this invention, the preferred wheat germplasm resistant to leaf rust is wheat germplasm resistant to leaf rust at the mature stage.

[0040] The present invention also provides a method for identifying resistance to wheat leaf rust, the method comprising: detecting the genotype of the SNP locus in the genome of a wheat sample, wherein when the genotype is GG, the wheat sample is a resistant material; and when the genotype is TT, the wheat sample is a susceptible material.

[0041] In this invention, the method for detecting the genotype of the SNP site is not particularly limited and can be conventionally selected according to actual needs. In some embodiments, the detection method preferably includes: using the genomic DNA of a wheat sample as a template, performing PCR amplification using the primer set; digesting the PCR amplification product with the restriction endonuclease HphI; when the digestion product contains two bands of 31 bp and 202 bp, the genotype of the SNP site in the genome of the wheat sample is GG; when the digestion product contains a 233 bp band, the genotype of the SNP site in the genome of the wheat sample is TT.

[0042] This invention also provides a method for identifying genetic loci for resistance to leaf rust in mature wheat plants. The method preferably includes the following steps: using the genomic DNA of the wheat to be tested as a template, performing PCR amplification using the primer set; digesting the PCR amplification product with the restriction endonuclease HphI; when the digestion product contains two bands of 31 bp and 202 bp, the wheat material contains a genetic locus for resistance to leaf rust in mature plants; when the digestion product contains a single band of 233 bp, the wheat material does not contain a genetic locus for resistance to leaf rust in mature plants.

[0043] In this invention, the genetic locus for resistance to leaf rust preferably includes QLr.hebau-4DS.

[0044] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0045] Unless otherwise specified, the following embodiments are all conventional methods.

[0046] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0047] Example 1: Obtaining linked SNP sites for wheat leaf rust resistance

[0048] Leaf rust fungi ( Puccinia triticina The pathogen was identified as *Zanthoxylum rust*. In late October, 277 Turkish wheat samples were inoculated with *Zanthoxylum rust* during the late stage of field planting. The resistance of each sample was assessed at the Third Branch of Hebei Agricultural University. Each sample was sown in one row, 2 meters long, with a row spacing of 25 cm. One row of the control variety, Xiaoyan 22, was sown every 10 rows. Around mid-April of the following year, after the experimental materials had reached the jointing stage, inoculation was performed using a dusting method. Specifically, *Zanthoxylum rust* spore powder and talc powder were mixed evenly at a ratio of 1:1000. In the evening, a 0.03% Tween 20 aqueous solution was first sprayed evenly onto the experimental materials. Then, the *Zanthoxylum rust* spore powder was sprayed onto the leaves of the experimental materials using a duster. The materials were covered with mulch to retain moisture for 3 days before being uncovered. After approximately 30 days, the wheat fully developed and the disease was investigated. The grading of leaf rust identification at the adult stage in this study adopted the 0-100% severity grading standard. The resistance of 277 global wheat germplasm resources introduced from Turkey (most of these wheat materials are breeding materials with only germplasm pedigrees) to leaf rust at the adult stage was evaluated. It was found that about 53% of the wheat materials showed a high level of resistance to leaf rust.

[0049] Based on the existing microarray data in the above materials, a genome-wide association study (GWAS) was performed on the genetic loci of wheat resistance to adult leaf rust. Figure 1 Three high-confidence linked SNP loci were obtained. Haplotype analysis was performed on three closely linked wheat leaf rust resistance phenotype-related SNP loci AX-109676199, AX-110950982, and AX-110077470 within the QLr.hebau-4DS region on chromosome 4DS. Combining wheat resistance and susceptibility phenotypes, two main haplotypes, QLr(4DS) and QLr(-), were identified, and a relatively clear linkage phenomenon between the SNPs was observed between the two haplotypes. The genotype of SNP locus AX-110950982 (located at base 134261400 on chromosome 4D of the wheat Chinese Spring reference sequence (IWGSC_v1.1 version), with a polymorphism of T / G) can basically reflect the haplotype situation of QLr.hebau-4DS.

[0050] Example 2: Development of dCAPS molecular markers tightly linked to wheat leaf rust resistance

[0051] 1. Design of dCAPS primers

[0052] Based on the SNP site (AX-110950982) provided in Example 1, neighboring sequences were extracted from the Chinese spring genome, and dCAPS primer pairs were designed using dCAPS Finder 2.0 (http: / / helix.wustl.edu / dcaps / ):

[0053] dCAPS molecular markers:

[0054] SEQ ID NO. 1:

[0055] CCACATCACCAACCTCACGGATAATATGAGACTATAATACGAC;

[0056] SEQ ID NO. 2:

[0057] CCACATCACCAACCTCACGGAGAATATGAGACTATAATACGAC.

[0058] 4DS-AX-110950982 (dCAPS):

[0059] Forward primer: CCACATCACCAACCTCACGGT (SEQ ID NO.3);

[0060] Reverse primer: TTTATTATCTCGTGCCGAGAAACA (SEQ ID NO.4).

[0061] The PCR amplification product based on this primer pair is 233 bp, and its sequence is shown in SEQ ID NO.5 or SEQ ID NO.6. The 22nd position of the sequence is T / G, which is a polymorphic site. Analysis of the resequencing data revealed that wheat germplasm has two genotypes at this site: TT and GG. The genotype GG can be digested by enzymes, while the genotype TT cannot be digested by enzymes.

[0062] 2. Extraction and PCR amplification of genomic DNA from samples

[0063] All wheat materials used in this study were imported breeding materials, and material information can be found on the USDA-GRIN website (https: / / www.ars-grin.gov / ). Seven disease-resistant materials (AXE / / TOSUNBEY (R1), PFAU / SERI.1B / / AMAD / 3 / KRONSTAD F2004 / 4 / SHARK-6 / 5 / SHARK-6 (R2), BONITO-36 / 6 / PEHLIVAN / 5 / JUP / 4 / CLLF / 3 / II14.53 / ODIN / / CI13431 / WA00477 / 7 / RSH2* / 10120 / / ZAGROS (R3), NACIBEY (R4), Fengkang 2 (R5), Zhoumai 19 (R6), Zaoyangmai (R7)) and seven disease-susceptible materials (AXE / / TOSUNBEY (S1), CHAMRAN / MV17 (S2), Honghuomai ZM1934 (S3), Gaolemai ZM1885 (S4), Weimai) were selected. Genomic DNA was extracted from young wheat leaves of wheat species 20 (S5), Baituxiaomai ZM1754 (S6), and Jimai 26 (S7) for subsequent dCAPS molecular marker development experiments.

[0064] DNA extraction methods:

[0065] (1) Take samples in the greenhouse. Cut a wheat leaf into small pieces and place them in a 2mL centrifuge tube (if not to be extracted immediately, store at -80℃).

[0066] (2) Add one grinding bead to each centrifuge tube, cool it in liquid nitrogen, and then place it in a cryogenic grinder (make sure it is balanced). Set the cryogenic grinder temperature to -50℃, the frequency to 70Hz, the working time to 70S, the interval time to 8S, and the number of cycles to 3. After grinding, remove the tubes, check whether they are completely ground, and mark them.

[0067] (3) Add 600 μL of DNA extraction buffer to each tube (to fully expose the DNA of the ground tissue), shake thoroughly, and place in a 65°C water bath for 30 min;

[0068] (4) Remove and place on ice for 15 minutes to cool to room temperature. Add 300 μL of 6 mol / L ammonium acetate and mix well. Place in a 4°C refrigerator for 15 minutes.

[0069] (5) Centrifuge at 12000 rpm for 5 min and take 600 μL of the supernatant;

[0070] (6) Add 360 μL of isopropanol to a new 1.5 mL centrifuge tube, add 600 μL of the supernatant from the previous step, mix well, allow the DNA to precipitate, and place in a 4°C refrigerator for 5 min.

[0071] (7) Centrifuge at 12000 rpm for 15 min to precipitate DNA and aspirate the supernatant (this step should not take too long to prevent DNA loss).

[0072] (8) Add 500 μL of 75% alcohol to wash the DNA, and flick the DNA from the bottom of the tube to clean it.

[0073] (9) Centrifuge at 12000 rpm for 1 min and discard the supernatant;

[0074] (10) Repeat steps 8 and 9 once;

[0075] (11) Aspirate the supernatant, place the 1.5 mL centrifuge tube into the clean bench, open the lid, blow air to dry;

[0076] (12) Redissolve the DNA in 100 μL of sterile water and let it stand at room temperature for half a day. Check the DNA at the bottom to see if it has dissolved at room temperature.

[0077] The extracted sample DNA was diluted to a concentration of 100 ng / μL as a template. The above-mentioned dCAPS primer pair (SEQ ID NO.3-SEQ ID NO.4) was used as primers to construct a PCR reaction system (15 μL) under the following conditions: 1 μL genomic template, 1 μL forward primer with OD=0.1, 1 μL reverse primer with OD=0.1, 7.5 μL 2×Rapid Taq Master Mix, and 4.5 μL ddH2O.

[0078] The PCR amplification program for 4DS-AX-110950982 was as follows: pre-denaturation at 94℃ for 5 min, cycling parameters were 94℃ denaturation for 30 s, 62.6℃ annealing for 30 s, 72℃ extension for 15 s, for 35 cycles, followed by a full extension at 72℃ for 10 min.

[0079] After amplification, the amplification products were stored at 4°C. The amplification products were then analyzed by 1% agarose gel electrophoresis and photographed using a UV gel imaging system.

[0080] 3. Identification of amplified products

[0081] The extracted genomic DNA was amplified using TIANGEN's 2×Taq PCR Mix, with the above-mentioned dCAPS primer pair (SEQ ID NO.3-SEQ ID NO.4) as primers. The amplification system (15 μL) consisted of: 7.5 μL of 2×Taq PCR Mix, 1 μL of template DNA, 1 μL of forward primer with OD=0.1, 1 μL of reverse primer with OD=0.1, and 4.5 μL of ddH2O. The amplification program was consistent with the amplification program described above.

[0082] A portion of the PCR amplification products were sent to the Biotech Sequencing Department for sequencing. The results showed that the 4DS-AX-110950982 sequence of the resistant and susceptible materials differed, with the genotype of the resistant material being GG and the genotype of the susceptible material being TT.

[0083] 4. Enzyme digestion

[0084] The PCR product 4D-AX-110950982 obtained in step 2 of this embodiment was digested with the restriction endonuclease HphI from Thermo Fisher Scientific. The digestion system (15 μL) was as follows: 7 μL PCR product, 1 μL 10×Tango Buffer, 0.5 μL HphI, and 6.5 μL ddH2O. The digestion conditions were: 37℃ for 3 h.

[0085] The enzyme digestion products were subjected to 3% polyacrylamide gel electrophoresis (15 μL sample volume, 65 V, 100 mA, 50 min). The PCR products of the resistant material were also digested with enzymes and then subjected to electrophoresis; the results are as follows: Figure 2 As shown.

[0086] Detection of the amplification products by 1% agarose gel electrophoresis revealed that the PCR product (R) of the resistant material and the PCR product (S) of the susceptible material, both labeled 4DS-AX-110950982, were 233 bp. After HphI digestion, the agarose gel electrophoresis results of the susceptible material (S1-S7) showed one main band of 233 bp, while the electrophoresis results of the resistant parent (R1-R7) showed two bands of 31 bp and 202 bp, respectively. Figure 2 The results showed that when the genotype was GG, i.e., the disease-resistant genotype, HphI could digest its PCR product, and two bands of 31bp and 202bp were present after digestion; when the genotype was TT, i.e. the disease-susceptible genotype, under the same conditions, the amplified product could not be digested by the enzyme, and a main band of 233bp was present after digestion.

[0087] The above results show that the genotypes at the 4D-AX-110950982 locus of the resistant and susceptible materials are consistent with the genomic and resequencing data. By using the dCAPS primers of this invention for amplification and combining them with the HphI enzyme digestion results, the different genotypes of the resistant and susceptible materials can be accurately distinguished.

[0088] Example 3 Verification Experiment

[0089] Fourteen wheat materials other than the research materials were selected, including disease-resistant materials (WATAN-7 / SEKHRAH-2 (R1'), ATTILA 50Y / / ATTILA / BCN / 3 / KAPSW / SHUHA-17 (R2'), HUBARA-5 / ANGI-1 (R3'), Yangmai 17 (R4'), Wannian 2 (R5'), Heng 136 (R6'), Xinchun 8 (R7')) and disease-susceptible materials (Yumai 48 (S1'), Xiaoyan 22 (S2'), Hengguan 35 (S3'), Qingfeng 1 (S4'), Yangmai 18 (S5'), Xinyang 12 (S6'), ROANE (S7')). The dCAPS molecular marker was validated using the same method as parts 2-4 of Example 2. The enzyme digestion results are as follows: Figure 3 As shown, the disease-resistant material (R1'-R7') has two bands of 31bp and 202bp after enzyme digestion, while the disease-susceptible material (S1'-S7') has only one main band of 233bp after enzyme digestion. The experimental results are consistent with the conclusion.

[0090] In summary, the dCAPS molecular marker designed for this SNP site in this invention can be effectively used for the molecular identification of wheat varieties with different leaf rust resistance at different maturity stages. The development of this dCAPS marker can significantly shorten the breeding cycle and reduce the cost of breeding work, which is of great significance in the breeding of wheat varieties resistant to leaf rust at the maturity stage using wheat germplasm resources.

[0091] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A dCAPS molecular marker for detecting wheat leaf rust resistance-linked SNP sites, characterized in that, The nucleotide sequence of the dCAPS molecular marker is shown in any one of SEQ ID NO. 1~2; the SNP site is located at 134261400 bases on chromosome 4D of the wheat Chinese spring reference sequence with version number IWGSC_v1.1, and its polymorphic site is T / G.

2. The dCAPS molecular marker according to claim 1, characterized in that, The 22nd position of SEQ ID NO.1~2 is the SNP site.

3. A primer set for detecting the dCAPS molecular marker according to any one of claims 1 to 2, characterized in that, The primer set includes the primers shown in SEQ ID NO.3~4.

4. A reagent kit, characterized in that, The kit comprises the primer set as described in claim 3.

5. The reagent kit according to claim 4, characterized in that, The kit also contains the restriction endonuclease HphI.

6. The application of the dCAPS molecular marker according to any one of claims 1 to 2, the primer set according to claim 3, or the kit according to any one of claims 4 to 5 in molecular marker-assisted breeding of wheat.

7. The application according to claim 6, characterized in that, The marker-assisted breeding of wheat includes the identification of genetic loci for wheat resistance to leaf rust, the identification of wheat resistance to leaf rust, or the selection of germplasm for wheat resistance to leaf rust.

8. A method for identifying resistance to wheat leaf rust, characterized in that, The identification method includes: detecting the genotype of wheat leaf rust resistance-linked SNP sites in the genome of wheat samples; when the genotype is GG, the wheat sample is a disease-resistant material; when the genotype is TT, the wheat sample is a disease-susceptible material; the SNP site is located at 134261400 bases on chromosome 4D of the wheat Chinese Spring reference sequence with version number IWGSC_v1.1, and its polymorphic site is T / G.

9. A method for identifying genetic loci for resistance to leaf rust in mature wheat plants, characterized in that, The method includes the following steps: using the genomic DNA of the wheat to be tested as a template, performing PCR amplification using the primer set described in claim 3; digesting the PCR amplification product with the restriction endonuclease HphI; when the digestion product contains two bands of 31 bp and 202 bp, the wheat material contains a genetic locus for resistance to adult leaf rust; when the digestion product contains a band of 233 bp, the wheat material does not contain a genetic locus for resistance to adult leaf rust.

Images