Castration HBsAg virus-like particle subunit vaccine and preparation method thereof

Abstract

Relates to the technical field of biology, in particular to a castrated HBsAg virus-like particle subunit vaccine and a preparation method thereof. The invention provides the GnRH-I-HBsAg recombinant protein which is high in purity and good in specificity. The vaccine prepared from the GnRH-I-HBsAg recombinant protein is high in antigen purity and good in safety, and has a good castration effect.

Description

Castration-resistant HBsAg virus-like particle subunit vaccine and preparation method thereof

[0001] This application claims priority to the Chinese patent application filed with the China Patent Office on March 21, 2023, with application number 202310317333.6 and invention name “GnRH-VLP recombinant castration vaccine and its preparation method”, the entire contents of which are incorporated by reference into this application. Technical Field

[0002] The present invention relates to the field of biotechnology, in particular to a castrated HBsAg virus-like particle subunit vaccine and a preparation method thereof. Background Art

[0003] Castration is the indirect removal of an animal's reproductive system or the resulting loss of sexual function. This includes the removal of the testes in males and the ovaries in females, collectively known as gonadectomy. In addition to surgical removal of the gonads, local radiation exposure and chemical treatment can also be used for castration. Castration deprives vertebrates of their source of sex hormones, which can sometimes lead to the degeneration of genital appendages and secondary and tertiary sexual characteristics.

[0004] Gonadotropin-releasing hormone (GnRH) is an endogenous polypeptide hormone in animals. Physiological doses of GnRH-I can increase gonadotropin concentrations (e.g., a mild increase in FSH and a significant increase in LH), promote the synthesis and secretion of gonadal hormones (e.g., estradiol, progesterone, and testosterone), and promote follicular maturation and ovulation, testicular development and sperm maturation, and the development and maintenance of secondary sexual characteristics. Furthermore, GnRH-I can directly affect the gonads, regulating the synthesis and secretion of gonadal steroid hormones and promoting gamete formation.

[0005] Self-antigen proteins are often difficult to elicit antibody responses against. One approach to improving vaccination efficacy is to increase the reproducibility of the applied antigens. Unlike isolated proteins, viruses can induce rapid and potent immune responses, both with and without T cell help, without any adjuvants. Compared to a few proteins, they can trigger immune responses far more robust than their isolated components. With respect to B cell responses, it is well known that a key factor in viral immunogenicity is the reproducibility and order of surface epitopes. Many viruses exhibit quasi-crystalline surfaces with regularly arranged epitopes that efficiently crosslink epitope-specific immunoglobulins on B cells. This crosslinking of B cell surface immunoglobulins is a strong activation signal, directly inducing cell cycle progression and IgM antibody production. Furthermore, this triggered B cell activation can activate T helper cells, in turn inducing the conversion of IgM to IgG antibodies in B cells and the generation of long-lived B cell memory targets for any vaccination. Viral structure has even been implicated in the production of anti-antibodies in autoimmune diseases and is part of the natural response to pathogens. Therefore, antigens presented on highly organized viral surfaces can induce strong antibody responses against these antigens.

[0006] Virus-like particles are the main capsid protein of an RNA bacteriophage. They are self-assembled from multiple monomers into a new type of highly immunogenic virus-like particles (VLPs). These VLPs do not contain the phage RNA genome and cannot replicate. However, studies have found that a variety of polypeptides can be fused to the N- or C-terminus of the virus-like particle protein, and the resulting fusion protein forms virus-like particles when expressed in a host, typically and preferably in Escherichia coli. In addition, it has been found that if the polypeptide contains at least one antigen, the antigen or at least one antigenic site of the antigen is displayed on the outer surface of the assembled VLP, the assembled VLP can effectively improve the immunogenicity of the target antigen. In addition to the virus-like particles AP205 and Qβ that have been reported, there are also a variety of VLP platforms such as CuMV and tobacco mosaic virus VLP, all of which have the potential to be developed into castration vaccines.

[0007] Hepatitis B virus (HBV) is a double-stranded DNA virus belonging to the family Hepadnavividae. Its genetic material consists of partially double-stranded circular DNA. HBV has three primary structural proteins: hepatitis B virus core antigen (HBcAg), hepatitis B virus surface antigen (HBsAg), and hepatitis B virus E antigen (HBeAg). HBsAg is a hemiglycosylated protein that forms virus-like particles (VLPs) approximately 22 nm in diameter. Each VLP contains a highly immunogenic region on its exterior. Insertion of exogenous gene sequences or epitopes into this region does not affect particle formation or immunogenicity. HBV-like particles (HBPs) can be self-assembled in vitro from HBV structural proteins. Due to their excellent biocompatibility and the high modifiability of their structural proteins, they are playing an increasingly important role in antigen carriers for exogenous epitopes, vaccine development, and nanocarriers. There is no report in the existing technology on how to use HBsAg to construct GnRH castration vaccine.

[0008] Summary of the Invention

[0009] In view of this, the technical problem to be solved by the present invention is to provide a castrated HBsAg virus-like particle subunit vaccine and a preparation method thereof, which is easy to obtain through bacterial culture, has a high expression yield, is convenient for industrial production, has strong immunogenicity and a fast immune response.

[0010] The present invention provides a GnRH-VLP recombinant protein, namely GnRH-HBsAg, which comprises GnRH and hepatitis B virus surface antigen.

[0011] The GnRH has an amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2, or a sequence in which one or more amino acids are substituted, deleted, added and / or replaced based on the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2; or a sequence with more than 90% homology to the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0012] The hepatitis B virus surface antigen (HBsAg) has an amino acid sequence as shown in SEQ ID NO: 5, or a sequence in which one or more amino acids are substituted, deleted, added and / or replaced based on the amino acid sequence as shown in SEQ ID NO: 5; or a sequence with a homology of more than 90% to the amino acid sequence as shown in SEQ ID NO: 5.

[0013] In some embodiments, the C-terminus of GnRH is coupled to the N-terminus of HBV surface antigen.

[0014] In some embodiments, the amino acid sequence of the recombinant protein of the present invention is shown in SEQ ID NO: 7 or SEQ ID NO: 9.

[0015] The present invention also provides:

[0016] 1), a nucleic acid encoding the GnRH-VLP recombinant protein;

[0017] II), an expression unit containing a nucleic acid encoding GnRH-VLP;

[0018] III), a recombinant vector containing a nucleic acid encoding GnRH-VLP or an expression unit as described above;

[0019] IV), transforming or transfecting host cells with an expression vector for GnRH-VLP;

[0020] V) The culture product of the host cells as described above.

[0021] The nucleic acid may be DNA, RNA, cDNA, or PNA. The DNA forms include cDNA, genomic DNA, or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The nucleic acid may include nucleotide sequences with different functions, such as coding regions and non-coding regions such as regulatory sequences (e.g., promoters or transcription terminators). The nucleic acid may be linear or circular in topology. The nucleic acid may be, for example, a portion of a vector (e.g., an expression or cloning vector), or a fragment. The nucleic acid may be obtained directly from a natural source, or may be prepared with the assistance of recombinant, enzymatic, or chemical techniques. The RNA form may be mRNA obtained by gene transcription, etc. The gene sequence may be a wild-type sequence or may be codon-optimized, which is not limited in the present invention. The nucleic acids of the present invention encode GnRH-I and HBsAg, respectively. The nucleic acid encoding HBsAg is a nucleic acid encoding the full length or a partial fragment of HBsAg. In some embodiments, the nucleic acid encoding the recombinant protein of the present invention is shown in SEQ ID NO: 6.

[0022] The expression units provided herein include those containing GnRH and those containing HBsAg. Alternatively, the expression units include the nucleic acid encoding the recombinant protein described above. The expression units include the nucleic acids described herein, either singly or in tandem, with a promoter and terminator, but are not limited thereto.

[0023] Furthermore, the recombinant expression vector herein refers to a nucleic acid vector, a recombinant DNA molecule comprising a desired coding sequence and appropriate nucleic acid sequences or elements necessary for expression of the operably linked coding gene in a specific host organism. Nucleic acid sequences or elements necessary for expression in bacteria include promoters, ribosome binding sites, and possibly other sequences. The recombinant expression vector is selected based on the host organism. The expression vector described in the present invention can be circular or linear, and this is not a limitation of the present invention. For example, a prokaryotic host can be Escherichia coli, Bacillus, Streptomyces, or Cyanobacteria; its backbone vector can be a pET series plasmid, a pGEX series plasmid, a pKBP series plasmid, or a pcDNA series plasmid. For example, the recombinant backbone vector is a pET series vector, and optionally, the backbone vector of the recombinant vector is pET-21(+), pET-24(+), pET-23(+), pET-28a(+), or pETM41.

[0024] The construction of the recombinant vector provided by the present invention comprises cloning the nucleic acid fragment encoding the fusion protein as described above into an expression vector by homologous recombination method.

[0025] In some embodiments, the present invention provides a recombinant plasmid GnRH-I-HBsAg-pET28a, which is obtained by cloning the nucleotide sequence shown in SEQ ID NO. 6 into the NdeI site and XhoI site of the prokaryotic expression vector pET28a by homologous recombination.

[0026] In other embodiments, the present invention provides a recombinant plasmid his-TEV-HBsAg-pET28a, which is obtained by directly synthesizing a his tag, a TEV restriction site (amino acid sequence is ENLYFQG) and a HBsAg gene into the BamHI restriction site and the XhoI restriction site of the pET28a vector.

[0027] In other embodiments, the present invention also provides his-MBP-TEV-GNRH-I-pETM41, which is a vector in which the TEV restriction site and the GnRH-I gene (SEQ ID NO. 3) are directly synthesized by BGI into the BamHI restriction site and XhoI restriction site of the pETM41 vector.

[0028] Furthermore, the present invention also provides a host cell transformed or transfected with the aforementioned recombinant vector, or with the aforementioned nucleic acid integrated into its genome.

[0029] The host described in the present invention includes bacteria, fungi, viruses or animals. The bacteria include Gram-positive bacteria and Gram-negative bacteria; the Gram-positive bacteria include but are not limited to Escherichia coli. The fungi include molds, yeasts, and mushrooms; the yeast include Saccharomyces cerevisiae, Saccharomyces cerevisiae, Pichia pastoris and Candida, etc. The viruses include but are not limited to adenovirus, adeno-associated virus, lentivirus, and prion virus. The animals include humans, mice, rabbits, pigs, zebrafish, etc. The expression mode of the nucleic acid encoding the recombinant protein in the host can be either integrated or free, and the present invention does not limit this. In the embodiment of the present invention, Escherichia coli BL21 (DE3) is used as the host to express the recombinant protein.

[0030] Furthermore, the present invention also provides a culture product of the host cell.

[0031] The method for preparing the GnRH-I-HBsAg recombinant protein of the present invention comprises: culturing the host cell as described above to obtain a culture product containing the recombinant protein;

[0032] Specifically, the method for preparing the GnRH-I-HBsAg virus-like particles of the present invention comprises the following steps:

[0033] (1) The GnRH-I 10 peptide gene was concatenated with the codon-optimized HBsAg capsid protein gene (GenBank: NC_003977.2) using a G4S linker. The synthesized fragment was directly cloned into the Escherichia coli expression vector pET28a to obtain the positive recombinant plasmid GnRH-I-HBsAg-pET28a.

[0034] (2) Transformation of the recombinant plasmid into the Escherichia coli expression strain: The recombinant plasmid GnRH-I-HBsAg-pET28a was transformed into the Escherichia coli expression strain BL21(DE3) to obtain the recombinant expression strain GnRH-I-HBsAg-pET28a-BL21(DE3);

[0035] (3) Expression and purification of GnRH-I-HBsAg VLP: The recombinant expression strain GnRH-I-HBsAg-pET28a-BL21(DE3) was induced to express using IPTG to obtain GnRH-I-HBsAg recombinant protein, which was then purified using a Ni affinity chromatography column to obtain GnRH-I-HBsAg VLP.

[0036] As a preferred embodiment of the method for preparing GnRH-I-HBsAg virus-like particles expressed by recombinant Escherichia coli, the prokaryotic expression vector is pET28a.

[0037] As a preferred embodiment of the method for preparing recombinant Escherichia coli expressing GnRH-I-HBsAg virus-like particles, the recombinant expression strain GnRH-I-HBsAg-pET28a-BL21 (DE3) is cultured to an OD of 600 When the expression level reaches 0.8-1.0, IPTG with a final concentration of 1 mM is added to induce expression.

[0038] Alternatively, the method for preparing the GnRH-HBsAg recombinant protein of the present invention comprises:

[0039] TEV-HBsAg protein and MBP-TEV-GnRH-I protein were prepared respectively, and fusion proteins were obtained by enzyme digestion and coupling.

[0040] Specifically, the method includes:

[0041] (1) The his tag, TEV restriction site (amino acid sequence: ENLYFQG) and HBsAg gene were directly synthesized into the pET28a vector BamHI restriction site and XhoI restriction site to obtain the recombinant plasmid his-TEV-HBsAg-pET28a; the recombinant plasmid was transformed into the Escherichia coli BL21 (DE3) expression strain, induced by IPTG, and then purified to obtain his-TEV-HBsAg virus-like particles.

[0042] (2) The TEV restriction site and GNRH-I gene were synthesized into the pETM41 vector BamHI restriction site and XhoI restriction site to obtain the recombinant plasmid his-MBP-TEV-GnRH-I-pETM41. The recombinant plasmid was transformed into the Escherichia coli BL21 (DE3) expression strain, and the his-MBP-TEV-GnRH-I recombinant protein was obtained by purification after IPTG induction.

[0043] (3) His-TEV-HBsAg virus-like particles and his-MBP-TEV-GnRH-I recombinant protein were reacted at a ratio of 10 μg TEV enzyme digestion to 1 mg recombinant protein, and the reaction was shaken at 30°C for 3 h. The reaction solution was then passed through a nickel column to obtain the permeate containing GnRH-I recombinant protein and HBsAg virus-like particles.

[0044] Furthermore, the fusion protein, the nucleic acid, the expression unit, the recombinant vector, the host cell, the culture product or the composition of the present invention are used in the preparation of subunit vaccines.

[0045] The present invention also provides a vaccine containing GnRH-VLP. Specifically, the present invention provides a castration HBsAg virus-like particle subunit vaccine, which includes the recombinant protein as described above. The vaccine is a castration vaccine for male animals. The male animals are animals that can be castrated, including birds and mammals. For example, mice, rats, cats, dogs, horses, or animals of the same family and genus as the above animals. Preferably, they are felines, canines, or rodents, such as mice. The vaccine also includes an adjuvant. The adjuvant includes an aluminum salt adjuvant, a protein adjuvant, a nucleic acid adjuvant, a lipid-containing adjuvant, a mixed adjuvant, or an aggregate structure adjuvant. In some embodiments of the present invention, the adjuvant is an aluminum hydroxide adjuvant. In the GnRH-VLP vaccine of the present invention, the adjuvant is not limited. In some embodiments, the GnRH-VLP vaccine is prepared using an aluminum adjuvant. The concentration of GnRH-VLP in the vaccine is 800, 400, 200, or 100 μg / mL, preferably, the concentration is 400 μg / mL.

[0046] Furthermore, the method for preparing the subunit vaccine comprises mixing the recombinant protein with an adjuvant; or mixing the composition with a buffer solution. Preferably, the volume ratio of the mixture is 1:1.

[0047] Immunizing animals with the vaccine of the present invention can achieve the effect of castration. Therefore, the present invention also provides the use of the above-mentioned vaccine in animal castration. Accordingly, the present invention also provides the use of the above-mentioned vaccine in animal castration. Accordingly, the present invention also provides a method for castrating an animal, comprising administering the vaccine as described above. In the present invention, the castration includes increasing the level of GnRH-I antibodies, reducing testosterone levels, reducing testicular volume and / or weight, and preventing animal pregnancy. In the present invention, the dosage administered is 200 μg. 10 to 100 days after immunization, the anti-GnRH-I recombinant protein antibody titer and testosterone levels decrease.

[0048] In some tests, testosterone levels are reduced to 50% to 90% of the original level, specifically 50% to 70%, 60% to 80%, 70% to 90%, and more specifically 50% to 60%, 60% to 70%, 70% to 80%, or 80% to 90%. In a specific embodiment, testosterone levels are reduced to 3.07% of the original level.

[0049] In some tests, the testicular weight of mice was reduced to 50% to 90% of the original level, specifically 50% to 70%, 60% to 80%, 70% to 90%, and more specifically 50% to 60%, 60% to 70%, 70% to 80%, and 80% to 90%. In a specific embodiment, the testicular weight of mice was reduced to 15.86% of the original level.

[0050] In some tests, the testicular volume of the cats was reduced to 50% to 90% of the original level, specifically 50% to 70%, 60% to 80%, 70% to 90%, more specifically 50% to 60%, 60% to 70%, 70% to 80%, 80% to 90%. In a specific embodiment, the testicular volume of the cats was reduced to 92.13% of the original level.

[0051] As a preferred embodiment of the GnRH-I-HBsAg virus-like particle subunit vaccine, the invention is used to produce the vaccine. The beneficial effects of the invention are as follows:

[0052] First, HBsAg is the capsid protein of the hepatitis B virus. This viral capsid protein has the ability to self-assemble into nanoparticles. It is non-infectious and has strong antigenic immunity.

[0053] Second, the antigen expressed in tandem with HBsAg virus-like particles showed high antigenicity, inducing high levels of specific antibodies in mice, rats, cats, dogs, and horses, and a rapid humoral immune response;

[0054] Third, the GnRH-I-HBsAg virus-like particles of the present invention can be expressed at high levels by E. coli, with a simple production process, a short culture cycle, and high purity of the GnRH-I-HBsAg virus-like particles;

[0055] Fourth, the recombinant expression strain of Escherichia coli selected in the present invention has the characteristics of fast growth, easy cultivation, simple genetic manipulation, fast reproduction speed, low requirements for culture conditions, cheap culture medium, high density culture capability, and tolerance to high liquid static pressure, which is convenient for industrial production. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for the embodiments or the description of the prior art. Obviously, the drawings described below are only exemplary. For those skilled in the art, other implementation drawings can be derived from the provided drawings without inventive effort:

[0057] FIG1 is a schematic diagram of a recombinant plasmid after the GnRH-I-HBsAg gene provided in an embodiment of the present invention is connected to the pET28a plasmid;

[0058] FIG2 is a schematic diagram of SDS-PAGE of GnRH-I-HBsAg virus-like particle protein provided in an embodiment of the present invention;

[0059] Figure 3 shows the serum antibody titers of mice immunized with GnRH-I-HBsAg;

[0060] FIG4 shows the testosterone levels in mouse serum;

[0061] Figure 5 shows the average testicular weight of mice;

[0062] Figure 6 shows the changes in testicular volume in male cats. DETAILED DESCRIPTION

[0063] To make the above-mentioned objects, features, and advantages of the present invention more readily apparent, specific embodiments of the present invention are described in detail below with reference to the accompanying drawings. The following description sets forth numerous specific details to facilitate a full understanding of the present invention. However, the present invention can be implemented in many other ways than those described herein, and those skilled in the art may make similar modifications without departing from the scope of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0064] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention pertains. The terms used herein in the specification of the present invention are for the purpose of describing specific embodiments only and are not intended to limit the present invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0065] The molecular biology experimental methods used in the examples of the present invention, such as enzyme digestion and homologous recombination ligation, can be found in the second edition of Molecular Cloning. The basic materials for preparing the GnRH-I-HBsAg virus-like particles of the present invention include: HBsAg protein nucleotide sequence (GenBank: NC_003977.2), GnRH-I nucleotide sequence (SEQ ID NO. 3), pET28a plasmid, BL21(DE3) Escherichia coli strain, Tiangen Plasmid Miniprep Kit, LB medium, IPTG, kanamycin, nickel column, and imidazole. The nucleotide sequence was sent to BGI for synthesis of the GnRH-I-HBsAg-pET28a recombinant plasmid.

[0066] The present invention provides a GnRH-I-HBsAg protein expressed in Escherichia coli. The GnRH-I-HBsAg protein is obtained by cloning an HBsAg capsid protein gene (GenBank: NC_003977.2) and a GnRH-I 10 peptide gene sequence into a pET28a vector and expressing the protein in Escherichia coli BL21 (DE3). The amino acid sequence of the GnRH-I-HBsAg is SEQ ID NO. 1.

[0067] The sequence involved in the present invention is as follows:

[0068] The sequences involved in the present invention include:

[0069] GnRH is also referred to herein as GnRH-I, and its amino acid sequence is:

[0070] QHWSYGLRPG (SEQ ID NO: 1, denoted as GnRH-I Q )

[0071] or EHWSYGLRPG (SEQ ID NO: 2, denoted as GnRH-I E )

[0072] The nucleic acid sequence encoding GnRH-1 is:

[0073] CAACACTGGAGCTACGGTTTGAGACCCGGT (SEQ ID NO.3, encoding GnRH-I Q )

[0074] or GAACACTGGAGCTACGGTTTGAGACCCGGT (SEQ ID NO. 4, encoding GnRH-I E )

[0075] The amino acid sequence of HBsAg capsid protein is:

[0076] The nucleic acid sequence encoding the HBsAg capsid protein is:

[0077] GnRH-I Q The amino acid sequence of the HBsAg protein is:

[0078] Encoding GnRH-I Q -The nucleic acid sequence of HBsAg protein is:

[0079] GnRH-I E The amino acid sequence of the HBsAg protein is:

[0080] Encoding GnRH-I E -The nucleic acid sequence of HBsAg protein is:

[0081] The test materials used in the present invention are all common commercial products and can be purchased in the market.

[0082] The present invention is further described below in conjunction with the embodiments:

[0083] Example 1

[0084] Provided is a method for preparing GnRH-I-HBsAg virus-like particles, comprising the following steps:

[0085] 1. Obtaining the GnRH-I-HBsAg target protein

[0086] (1) Construction of recombinant plasmid

[0087] The HBsAg and GnRH-I gene sequences were directly synthesized into the pET28a plasmid vector by a gene company to obtain the recombinant plasmid GnRH-I Q -HBsAg-pET28a and GnRH-I E -HBsAg-pET28a, the inserted coding nucleic acid sequences are shown in SEQ ID NO: 8 and SEQ ID NO: 10;

[0088] (2) Preparation of recombinant plasmid GnRH-I-HBsAg-pET28a

[0089] Use a pipette to inoculate 5 μl of the glycerol stock containing the plasmid into 5 mL of LB medium (containing 50 μg / mL kanamycin). Incubate at 37°C with shaking for 14-16 hours. After incubation, remove 1 mL of the culture medium for sequencing. Extract the plasmid using a plasmid extraction kit from the remaining culture medium, and measure the nucleic acid concentration using a Nanodrop 2000 nucleic acid detector.

[0090] (3) Transform the recombinant plasmid into the expression strain

[0091] Recombinant plasmid GnRH-I Q -HBsAg-pET28a and GnRH-I E -HBsAg-pET28a were transformed into BL21 (DE3) Escherichia coli expression strain to obtain GnRH-I Q -HBsAg-pET28a-BL21 and GnRH-I E -HBsAg-pET28a-BL21 recombinant expression strain;

[0092] (4) Bacterial culture and GnRH-I-HBsAg VLP purification

[0093] The recombinant strain was shaken and concentrated by centrifugation, coated on a kanamycin-resistant plate, cultured overnight at 37°C, and the colonies were scraped and inoculated into 10 mL of LB medium containing kanamycin. The culture was shaken at 37°C, 200 rpm, until the OD value of the bacterial solution reached 0. 600 Transfer it to 500 mL of LB medium containing kanamycin and shake at 37°C and 180 rpm until the OD value of the bacterial solution reaches 0.8. 600The value was around 0.8. IPTG was added for overnight expression at 30°C. On the third day, the cells were harvested by centrifugation at 4500 rpm for 15 minutes. Ultrasonic disruption of the cells was performed for 30 minutes. After sonication, the supernatant was collected by centrifugation at 9500 rpm for 20 minutes at 4°C.

[0094] The supernatant was centrifuged and purified by passing it through a nickel column. The column was equilibrated with PBS for 5 column volumes. Sample was loaded and washed with PBS for 5 column volumes, followed by 2 column volumes with 25 mM imidazole, and then 5 column volumes with 25 mM imidazole. Elution was then performed with 5 column volumes of 50, 100, 150, 200, and 250 mM imidazole, and the flow-through was collected.

[0095] 8 μL of each collected solution was aspirated and added to 2 μL of 5× protein electrophoresis loading buffer, followed by heating at 100°C for 5 min. Protein electrophoresis was performed and the concentration of the collected solution where the target band was located was observed by staining. The target protein was ultrafiltered using an ultrafiltration tube and replaced with PBS solvent to obtain GnRH-I. Q -HBsAg and GnRH-I E -HBsAg virus-like particles.

[0096] Comparative Example 1

[0097] Provide HBsAg virus-like particles and GnRH-I recombinant protein as a control group:

[0098] 1. A method for preparing a his-TEV-HBsAg recombinant protein, comprising the following steps:

[0099] (1) Construction of recombinant plasmid: BGI Corporation directly synthesized the his tag, TEV restriction site (amino acid sequence ENLYFQG) and HBsAg gene into the pET28a vector BamHI restriction site and XhoI restriction site to obtain the recombinant plasmid his-TEV-HBsAg-pET28a;

[0100] (2) Transforming the recombinant plasmid into an expression strain: Transforming the his-TEV-HBsAg-pET28a recombinant plasmid into an Escherichia coli BL21 (DE3) expression strain to obtain a his-TEV-HBsAg-pET28a-BL21 (DE3) recombinant expression strain;

[0101] (3) Bacterial culture and purification of HBsAg virus-like particles: The his-TEV-HBsAg-pET28a-BL21 (DE3) recombinant expression strain was cultured and IPTG-induced expression was used to obtain his-TEV-HBsAg virus-like particles.

[0102] Specifically, the steps for expressing and purifying his-TEV-HBsAg virus-like particles are as follows:

[0103] (1) Preparation of his-TEV-HBsAg-pET28a recombinant plasmid

[0104] Use a pipette to inoculate 5 μl of the glycerol stock containing the plasmid into 5 mL of LB medium (containing 50 μg / mL kanamycin). Incubate at 37°C with shaking for 14-16 hours. After incubation, remove 1 mL of the culture medium for sequencing. Extract the plasmid using a plasmid extraction kit.

[0105] (2) Expression of his-TEV-HBsAg virus-like particles

[0106] Transform the BL21 (DE3) expression strain, shake the bacteria and concentrate them by centrifugation, spread them on kanamycin-resistant plates, culture them at 37°C overnight, scrape the colonies, inoculate 10 mL of LB medium containing kanamycin, and shake the bacteria at 37°C at 180 rpm until the OD value of the bacterial solution reaches 0. 600 = about 0.8. Transfer it to 2000mL LB medium containing kanamycin and shake at 37℃180rpm until the bacterial solution OD 600 = 0.8 to 1.0. Add IPTG inducer to a final concentration of 1 mM and express overnight at 30°C. On the third day, centrifuge at 4500 rpm for 15 minutes to collect the cells. Ultrasonicate the cells for 45 minutes, 3 seconds on, 4 seconds off, at 125W power. After the sonication is complete, heat at 9500 rpm for 20 minutes at 4°C to collect the supernatant.

[0107] (3) Purification of his-TEV-HBsAg virus-like particles

[0108] The supernatant was centrifuged and purified on a nickel column equilibrated with lysis buffer (50 mM NaH2PO4·2H2O, 300 mM NaCl, 10% glycerol, and 10 mM imidazole, pH = 8.0) for 5 column volumes. After loading, the column was washed with lysis buffer for 5 column volumes and then with wash buffer-1 (50 mM NaH2PO4·2H2O, 300 mM NaCl, 10% glycerol, and 25 mM imidazole, pH = 8.0) for 5 column volumes. Elution was then performed with wash buffer containing 50, 100, 250, and 500 mM imidazole for 5 column volumes, respectively, and the flow-through was collected.

[0109] Aspirate 10 μL of each collected solution and add 10 μL of 2× protein electrophoresis loading buffer. Heat at 100°C for 4 minutes to denature the protein. Then, perform protein electrophoresis and stain to determine the concentration of the target band in the collected solution. Ultrafilter the target protein using a 30 kDa ultrafiltration tube and replace with desalting buffer (containing 50 mM NaH2PO4·2H2O and 10% glycerol, pH 7.4).

[0110] 2. Method for preparing His-MBP-TEV-GnRH-I recombinant protein. The method for preparing the his-MBP-TEV-GnRH-I recombinant protein comprises the following steps:

[0111] (1) Construction of recombinant plasmid: The TEV restriction site and GnRH-I gene (SEQ ID NO.3 and SEQ ID NO.4) were directly synthesized by BGI into the BamHI restriction site and XhoI restriction site of pETM41 vector to obtain the recombinant plasmid his-MBP-TEV-GnRH-I Q -pETM41 and his-MBP-TEV-GnRH-I E -pETM41;

[0112] (2) Transform the recombinant plasmid into the expression strain: the his-MBP-TEV-GnRH-I Q -pETM41 and his-MBP-TEV-GnRH-I E -pETM41 recombinant plasmid was transformed into Escherichia coli BL21 (DE3) expression strain to obtain his-MBP-TEV-GnRH-I Q -pETM41-BL21(DE3) and his-MBP-TEV-GnRH-I E -pETM41-BL21(DE3) recombinant expression strain;

[0113] (3) Bacterial culture and purification of his-MBP-TEV-GnRH-I recombinant protein: Cultivate the his-MBP-TEV-GnRH-I Q -pETM41-BL21(DE3) and his-MBP-TEV-GnRH-I E -pETM41-BL21 (DE3) recombinant expression strain, IPTG-induced expression to obtain his-MBP-TEV-GnRH-I Q and his-MBP-TEV-GnRH-I E Recombinant protein.

[0114] The specific steps for expression and purification of his-MBP-TEV-GnRH-I recombinant protein are as follows:

[0115] (c1) Preparation of his-MBP-TEV-GnRH-I-pETM41 recombinant plasmid

[0116] Use a pipette to inoculate 5 μl of the glycerol stock containing the plasmid into 5 mL of LB medium (containing 50 μg / mL kanamycin). Incubate at 37°C with shaking for 14-16 hours. After incubation, remove 1 mL of the culture medium for sequencing. Use a plasmid extraction kit to extract the plasmid from the remaining culture medium, and measure the nucleic acid concentration using a protein nucleic acid detector.

[0117] (c2) Expression of his-MBP-TEV-GnRH-I recombinant protein

[0118] Transform the BL21 (DE3) expression strain, shake the bacteria and concentrate them by centrifugation, spread them on kanamycin-resistant plates, culture them at 37°C overnight, scrape the colonies, inoculate 10 mL of LB medium containing kanamycin, and shake the bacteria at 37°C at 180 rpm until the OD value of the bacterial solution reaches 0. 600 = about 0.8. Transfer it to 500 mL of LB medium containing ampicillin and shake at 37°C 180 rpm until the bacterial solution OD 600 = approximately 0.8. Add IPTG inducer to a final concentration of 0.8 mM and express overnight at 30°C. On the third day, harvest the cells by centrifugation at 4500 rpm for 15 minutes. Ultrasonicate the cells for 45 minutes (3 seconds on, 4 seconds off) at 125W. After sonication, sonicate at 9500 rpm for 20 minutes at 4°C and collect the supernatant.

[0119] (c3) Purification of his-MBP-TEV-GnRH-I recombinant protein

[0120] The supernatant was centrifuged and purified on a nickel column equilibrated with lysis buffer (50 mM NaH2PO4·2H2O, 300 mM NaCl, 10% glycerol, and 10 mM imidazole, pH = 8.0) for 5 column volumes. After loading, the column was washed with lysis buffer for 5 column volumes and then with wash buffer-1 (50 mM NaH2PO4·2H2O, 300 mM NaCl, 10% glycerol, and 25 mM imidazole, pH = 8.0) for 5 column volumes. Elution was then performed with wash buffer containing 50, 100, 250, and 500 mM imidazole for 5 column volumes, respectively, and the flow-through was collected.

[0121] Aspirate 10 μL of each collected solution and add 10 μL of 2× protein electrophoresis loading buffer. Heat at 100°C for 4 minutes to denature the protein. Then, perform protein electrophoresis and stain to determine the concentration of the target band in the collected solution. Ultrafilter the target protein using a 30 kDa ultrafiltration tube and replace with desalting buffer (containing 50 mM NaH2PO4·2H2O and 10% glycerol, pH 7.4).

[0122] 3. Preparation of HBsAg virus-like particles and GnRH-I recombinant protein: the his-TEV-HBsAg virus-like particles prepared in step 1 and the his-MBP-TEV-GnRH-I prepared in step 2 are Q and his-MBP-TEV-GnRH-I E The recombinant proteins were dissolved in Desalting buffer and TEV recombinase was added for enzymatic digestion. The reaction was carried out at a ratio of 10 μg TEV to 1 mg recombinant protein. The reaction was shaken at 30°C for 3 hours. The reaction solutions were then passed through nickel columns. The penetrants were GNRH-I recombinant protein and HBsAg virus-like particles, while his-TEV enzyme and incompletely digested recombinant proteins would hang on the nickel columns. The GnRH-I recombinant protein and HBsAg virus-like particles were concentrated using 30 kDa concentrators for the immune control group.

[0123] Comparative Example 2

[0124] GnRH-I-AP205 virus-like particles were prepared according to the same system as the GnRH-I-AP205 virus-like particle preparation method mentioned in patent CN112500456B for subsequent immune control experiments.

[0125] Example 2

[0126] Provided is a GnRH-I-HBsAg virus-like particle subunit vaccine immunization method:

[0127] The GnRH-I described in Example 1 Q -HBsAg and GnRH-I E -HBsAg virus-like particles and aluminum hydroxide adjuvant were mixed in a volume ratio of 1:1 for immunization. On day 0, day 14, and day 28, 50 μg GnRH-I Q -HBsAg and GnRH-I E Eight-week-old male C57BL / 6 mice were immunized with HBsAg virus-like particles vaccine (five mice per group), and the GnRH-I-AP205 virus-like particles and aluminum hydroxide adjuvant immunization group, GnRH-I Q -HBsAg without adjuvant group, GnRH-IE -HBsAg without adjuvant group, adjuvant PBS negative group, simple HBsAg (prepared in comparative example 1) experimental group and simple GnRH-I Q and GnRH-I E (Comparative Example 1) Experimental group. Anti-GnRH-I protein antibody titers and testosterone levels of these mice were measured. On day 70 after immunization, the mice were sacrificed and testicular weights were measured.

[0128] Example 3 Determination of mouse anti-GnRH-I antibody titer

[0129] At various time points during the experiment, serum was collected from immunized and control mice. Anti-GNRH-I IgG antibody titers were determined by ELISA as follows. 96-well plates were coated with 2 μg / ml GnRH-I overnight at 4°C, with 100 μl per well added. The next day, the plates were washed five times with 1:1000 PBST and blocked with 300 μl of 2% BSA at 37°C for 2 h. The plates were then washed five times with 1:1000 PBST. Mouse serum was serially diluted with 2% BSA at a starting concentration of 1:500, followed by two-fold dilutions to 1:1000, 1:2000, 1:4000, 1:8000, 1:16000, 1:32000, 1:64000, 1:128000, and 1:256000. From the highest to the lowest dilution, 100 μl per well was added, and the plates were incubated at room temperature with shaking for 45 min. Wash the plate five times with 1:1000 PBST. Use HRP-conjugated goat anti-mouse polyclonal antibody as a secondary antibody at a dilution of 1:5000 in 2% skim milk powder, 100 μl per well, and incubate at room temperature with shaking for 45 minutes. TMB color development takes 5-10 minutes, followed by addition of 2M sulfuric acid to terminate the color development. Read the absorbance at 450 nm. Optical density (OD) at 450 nm is measured using an ELISA reader (BioRad Benchmark). The maximum OD is calculated using these data. 450 Serum dilution.

[0130] FIG1 shows that, in the GnRH-I prepared in Example 1 Q -HBsAg and GnRH-I E In the male mice immunized with HBsAg virus-like particles without adjuvant, the average titer reached 16,000 on day 28, and after the third booster, the average titer first rose to 32,000 and then dropped to 16,000. Q -HBsAg and GnRH-I E The average titer of the HBsAg virus-like particles adjuvant group reached 64,000 on day 28, and increased to 256,000 on day 56 and maintained until day 70. Q and GnRH-IE The titer in the immunized group was only 4,000 after 28 days. Although it briefly rose to 8,000 after the third dose, it ultimately dropped to 4,000, a level far lower than that observed with GnRH-I-HBsAg virus-like particles. The HBsAg adjuvant-mixed and PBS-mixed adjuvant-mixed groups failed to stimulate the production of GnRH-I antibodies. These results clearly demonstrate that GnRH-I-HBsAg adjuvanted mice can significantly elevate GnRH-I antibody titers in the blood.

[0131] The GnRH-I-AP205+adjuvant immunization prepared in Comparative Example 2 can also stimulate the body to produce antibody titers, but the antibody titers are relatively low and not as long-lasting as the GnRH-I-HBsAg virus-like particles, and are not as suitable for the preparation of castration vaccines as the GnRH-I-HBsAg virus-like particles.

[0132] Example 4 Determination of testosterone levels and testicular weight in mice

[0133] At various time points during the above experiments, serum was collected from immunized mice and control mice. Testosterone levels in mouse serum were determined using a testosterone-ELISA (IBL, Hamburg, Germany).

[0134] Figure 3 shows that the use of GnRH-I Q -HBsAg and GnRH-I E In mice immunized with HBsAg virus-like particles without aluminum hydroxide adjuvant, the average testosterone level was greatly suppressed (<2 ng / ml) on day 42 after immunization, and the level was still below 1.5 ng / ml on day 70. Q In mice immunized with HBsAg supplemented with aluminum hydroxide adjuvant, the average testosterone level dropped to below 1.5 ng / ml on the 28th day, and remained stable at around 0.176 after 42 days. From the 28th day onwards, the average testosterone level was significantly lower than that of the group immunized without adjuvant. Q The average level of hormones in the central nervous system of mice immunized with aluminum hydroxide was about 31 times lower. E In mice immunized with HBsAg supplemented with aluminum hydroxide adjuvant, the average testosterone level dropped to below 1.5 ng / ml on the 28th day, and remained stable at around 0.186 after 42 days. From the 28th day onwards, the average testosterone level was significantly lower than that of the group immunized without adjuvant. EThe average hormone level in the central nervous system of the mice immunized with GnRH-I-AP205 virus-like particles + aluminum hydroxide adjuvant was about 27 times lower than the average hormone level in the GnRH-I + aluminum hydroxide immunized mice group, which clearly demonstrated that the GnRH-I-HBsAg + adjuvant immunization group had a stronger inhibitory effect on mouse testosterone.

[0135] Mice were sacrificed on day 70, and the testicles were removed and weighed before being fixed in 4% formaldehyde.

[0136] Figure 4 shows that on day 70, GnRH-I Q and GnRH-I E The testicular weight of immunized mice was not significantly reduced, while that of mice receiving GnRH-I Q -The testicular weight of mice immunized with HBsAg virus-like particles and aluminum hydroxide adjuvant decreased by 84.14%, and those receiving GnRH-I E Mice immunized with HBsAg VLPs and aluminum hydroxide adjuvant showed an 82.73% decrease in testicular weight, while mice immunized with GnRH-I-AP205 VLPs and aluminum hydroxide adjuvant showed a 79.5% decrease in testicular weight. This clearly demonstrates that the GnRH-I-HBsAg adjuvant-combined vaccine has a significant inhibitory effect on the mouse testicles. The effect of the HBsAg VLPs prepared in Comparative Example 1 on mice was negligible, and the GnRH-I-AP205 VLPs prepared in Comparative Example 2 were less effective than the GnRH-I-HBsAg VLPs.

[0137] Example 5: Testicular volume determination of experimental cats

[0138] Six healthy male rural cats aged 12 to 24 months were divided into two groups, with 3 cats in each group. One group was the injection group and the other was the control group. Q HBsAg virus-like particles (VLPs) were mixed with aluminum hydroxide adjuvant at a volume ratio of 1:1 for immunization. 200 μg was injected subcutaneously behind the ear and neck. A second injection was given 28 days later at the same dose and route. A control group received no injection. All experimental animals were housed individually under the same conditions and observation.

[0139] After the first vaccination, measure the width and length of the testicles with a vernier caliper and a tape measure every 14 days, and calculate the testicular volume according to the following formula: testicular volume = (width / 4) × (length / 2) × 4 / 3 × 3.14.

[0140] As shown in Figure 5, the testicular volume of the male cats in the injection group decreased, while the testicular volume of the male cats in the control group increased. This clearly shows that GnRH-I Q -The vaccine combining HBsAg and adjuvant has a significant inhibitory effect on the cat's testicles.

[0141] Example 6: Determination of pregnancy status of experimental cats

[0142] Ten healthy rural cats aged 12 to 24 months (6 male cats and 4 female cats) were divided into two groups, with 3 male cats and 2 female cats in each group. One group was the injection group and the other was the control group.

[0143] The injection group received a subcutaneous injection of 200 μg GnRH-I behind the ear and neck. Q HBsAg + adjuvant was injected a second time 28 days later, with the same route. The control group received no injection. All experimental cats were housed and observed under the same conditions.

[0144] Eight healthy male cats aged 12 to 24 months and 12 healthy female cats aged 12 to 14 months were cage-paired with the injected and control groups. Fourteen days after the second injection, three male cats from the injected and control groups were cage-paired with two healthy female cats, respectively; and four female cats from the injected and control groups were cage-paired with two healthy male cats, respectively. Male cats from each group were rotated to breed to minimize behavioral incompatibilities that could affect successful pairing.

[0145] After the cohabitation test begins, check whether the female cats in the experimental group and the male cats in the same cage are pregnant. After 30 days of observation, ultrasound is used to check for pregnancy.

[0146] As can be seen from Table 1, none of the female cats in the injection group and the paired female cats became pregnant, while the female cats in the control group and the paired female cats became pregnant, indicating that GnRH-I Q -HBsAg+adjuvant is very effective for castration of cats and is suitable for the development of castration vaccines.

[0147] Table 1 Pregnancy status of experimental animals

Claims

1. GnRH-VLP recombinant protein, characterized in that Including GnRH and hepatitis B virus surface antigen.

2. The recombinant protein according to claim 1, characterized in that The C-terminus of GnRH is linked in tandem with the N-terminus of the HBV surface antigen; wherein GnRH has an amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2; The hepatitis B virus surface antigen has the amino acid sequence shown in SEQ ID NO: 5; The amino acid sequence of the GnRH-VLP recombinant protein is shown in SEQ ID NO: 7 or SEQ ID NO:

9.

3. Biomaterial, characterized in that Include any of the following: 1), a nucleic acid encoding the recombinant protein according to claim 1; II), an expression unit containing the nucleic acid described in I); III), a recombinant vector containing the nucleic acid described in I) or the expression unit described in II); IV), a host cell transformed or transfected with the expression vector described in III); V) and IV) the culture products of the host cells.

4. The method for preparing the recombinant protein according to claim 1 or 2, characterized in that: The method comprises culturing the host cell described in claim 3 to obtain a culture product containing the recombinant protein described in claim 1; Or it includes preparing GNRH-I protein and hepatitis B virus surface antigen separately, and obtaining the recombinant protein according to claim 1 or 2 through coupling.

5. Use of the recombinant protein according to claim 1 or 2, the biological material according to claim 3 or the product obtained by the preparation method according to claim 4 in the preparation of a subunit vaccine for animal castration.

6. A vaccine, characterized in that The invention comprises the recombinant protein according to claim 1 or 2 and an adjuvant.

7. The vaccine according to claim 6, characterized in that The adjuvant is aluminum hydroxide adjuvant.

8. The method for preparing the vaccine according to claim 6 or 7, characterized in that: The method comprises mixing the recombinant protein according to claim 1 or 2 with an adjuvant.

9. The preparation method according to claim 8, characterized in that: The volume ratio of the mixture is 1:

1.

10. A method for castration of an animal, characterized in that: Comprising administration of the vaccine of claim 6 or 7.

Images