Indel molecular markers related to early growth potential in sweet sorghum and their applications

By developing Indel molecular markers related to early growth potential in sweet sorghum and creating a high-throughput genotyping method using SbDOGL3 locus variations, the problem of weak molecular regulation of early growth potential traits in sweet sorghum was solved, achieving accurate genotyping of early growth potential traits and improving breeding efficiency.

CN120829989BActive Publication Date: 2025-12-02XIANGHU LABORATORY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511340913.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-19
Publication Date
2025-12-02
Estimated Expiration
2045-09-19

AI Technical Summary

Technical Problem

Research on the molecular regulatory mechanisms of early growth potential traits in sweet sorghum is weak, and there is a lack of practical molecular markers suitable for rapid typing of early growth potential traits in sweet sorghum varieties, which limits the efficiency and application prospects of stress-resistant germplasm breeding.

Method used

Indel molecular markers associated with early growth potential of sweet sorghum were developed, and a high-throughput genotyping method was created using SbDOGL3 locus variants. The level of early growth potential was identified by detecting 89 bp and 97 bp fragments of insertion and deletion variants.

Benefits of technology

It enables precise typing of early growth vigor traits in sweet sorghum, improves breeding efficiency, shortens the breeding cycle, enhances seed germination uniformity and seedling growth vigor, and is suitable for sweet sorghum planting in cool and arid regions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120829989B_ABST
    Figure CN120829989B_ABST
Patent Text Reader

Abstract

This application provides an Indel molecular marker related to the early growth potential of sweet sorghum and its application. Specifically, this invention develops an Indel molecular marker related to the early growth potential of sweet sorghum. The nucleotide sequence of this molecular marker is shown in SEQ ID NO: 1, wherein positions 2539-2546 of SEQ ID NO: 1 contain an insertion / deletion variation of the sequence CCGCCGAG. Primers were designed for rapid detection of this Indel molecular marker in sweet sorghum. It was found that sweet sorghum lacking the CCGCCGAG sequence at this marker showed high early growth potential, while sweet sorghum containing the CCGCCGAG sequence showed low early growth potential. This invention utilizes Indel molecular markers to rapidly and accurately identify and screen sweet sorghum seeds with high early growth potential, which is beneficial for shortening the breeding time of sweet sorghum, thereby reducing agricultural production costs and increasing sweet sorghum yield.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular genetic breeding technology, and in particular to the Indel molecular markers related to the early growth potential of sweet sorghum and their applications. Background Technology

[0002] Sweet sorghum ( Sorghum bicolor (L.) Moench It is an important economic crop that combines multiple uses such as food, feed, sugar, and bioenergy. Its stems are rich in fermentable sugars, have high biomass yield, and are also highly drought-resistant and tolerant of poor soil, showing broad application prospects in marginal land use and sustainable agriculture.

[0003] Precise regulation of key early growth potential traits such as seed dormancy and germination is an important strategy for plants to adapt to environmental changes. It is particularly important to note that early growth potential directly affects the uniformity of emergence, the rate of canopy formation, and the final yield of sweet sorghum, often becoming a key factor limiting production efficiency under adverse conditions such as early spring low temperatures and brief droughts. However, compared with major food crops, research on the molecular regulatory mechanisms of key early growth potential traits such as seed germination and the creation of stress-resistant germplasm in sweet sorghum remains relatively weak. Currently, the key genes controlling early growth potential traits in sweet sorghum have not been identified, and there is a lack of practical molecular markers suitable for rapid typing of early growth potential traits in sweet sorghum varieties. This severely limits the efficiency and application prospects of stress-resistant germplasm breeding. Summary of the Invention

[0004] To overcome the aforementioned technical bottlenecks, this invention provides Indel molecular markers related to the early growth potential of sweet sorghum and their applications. Specifically, the inventors, for the first time, have developed Indel molecular markers based on... SbDOGL3 The creation of Indel molecular markers through locus mutations for high-throughput typing of early growth potential (integrating germination vigor and seedling vigor) in sweet sorghum fills a technological gap in this area; it can be used for targeted breeding of breakthrough sweet sorghum varieties that combine strong germination ability and high seedling vigor.

[0005] In this regard, the technical solutions of the present invention include, but are not limited to, the following:

[0006] In one aspect, the present invention provides an Indel molecular marker associated with the early growth potential of sweet sorghum, characterized in that the nucleotide sequence of the Indel molecular marker is as shown in SEQ ID NO: 1, wherein positions 2539-2546 of SEQ ID NO: 1 have an insertion / deletion variation, sweet sorghum with the sequence CCGCCGAG at positions 2539-2546 of SEQ ID NO: 1 has a low early growth potential, and sweet sorghum with the sequence CCGCCGAG deleted at positions 2539-2546 of SEQ ID NO: 1 has a high early growth potential.

[0007] In another aspect, the present invention provides a primer pair for detecting Indel molecular markers associated with early growth potential of sweet sorghum, the primer pair being:

[0008] Forward primer: TCCGGAAAAGGTGAAAAGCAG (SEQ ID NO: 2);

[0009] Reverse primer: AGGGAAGATGACACGCAAGATT (SEQ ID NO: 3).

[0010] In another aspect, the present invention provides a detection kit comprising the primer pairs described herein.

[0011] In another aspect, the present invention provides the use of the Indel molecular markers, primer pairs, or detection kits described herein in any of the following:

[0012] (1) Identify the early growth potential of sweet sorghum;

[0013] (2) Application in improving sweet sorghum germplasm resources.

[0014] In one aspect, the improved sweet sorghum germplasm resources described in this invention aim to enhance the early growth potential of sweet sorghum.

[0015] In another aspect, the present invention also provides a method for identifying the growth potential of sweet sorghum, the method comprising: using genomic DNA of a sweet sorghum sample to be tested as a template, performing PCR amplification on the template using the primer set or detection kit described in the present invention, and detecting the insertion or deletion of Indel molecular markers in the amplification product.

[0016] If the amplification product is an 89 bp fragment, it indicates that the early growth potential of sweet sorghum is high.

[0017] If the amplification product is a 97 bp fragment, it indicates that the early growth potential of sweet sorghum is low.

[0018] In one aspect of the invention, compared with sweet sorghum containing the sequence CCGCCGAG at the Indel molecular marker, sweet sorghum with high early growth potential has higher seed germination vigor and seedling height.

[0019] In one aspect of the invention, compared with sweet sorghum lacking the CCGCCGAG sequence at the Indel molecular marker, the low early growth potential described in the invention refers to lower seed germination activity and / or lower seedling height.

[0020] In one aspect, the present invention determines the insertion or deletion of Indel molecular markers by detecting the size of the amplification products using gel electrophoresis.

[0021] In one aspect, the PCR amplification reaction system of the present invention comprises: 5 μL 2×taq enzyme Mix, 1 μL DNA template, 2 μL SbDOGL3-SSR-F / R primer (2.5 μM), and 2 μL ddH2O (i.e., 10 μL system).

[0022] In one aspect, the PCR amplification program of the present invention is as follows: 94℃ pre-denaturation for 3 min; 95℃ denaturation for 10 s, 58℃ annealing for 30 s, 68℃ extension for 15 s, 35 cycles; 68℃ extension for 5 min.

[0023] In one aspect, the germplasm of the sweet sorghum described in this invention is selected from, for example... Figure 5 Those listed in the document, especially BTX623, J5, J26, J112, 377, 2049, 2059, 61, 14, WSC17 or WSC71.

[0024] The beneficial technical effects of the present invention include, but are not limited to:

[0025] The Indel molecular markers provided by this invention can be used to efficiently identify individual plants carrying superior allelic variations in early-stage sweet sorghum breeding populations, achieving precise genotyping of early growth potential-related traits. This results in obtaining sweet sorghum germplasm resources with strong germination and vigor, effectively shortening the breeding cycle. Furthermore, this invention provides an original Indel molecular marker solution to address key issues in sweet sorghum production, such as poor germination uniformity and weak seedlings, focusing on early growth potential. Improved varieties obtained through screening using this invention can achieve rapid and uniform emergence, laying a foundation for robust seedlings. This improves population uniformity, resource utilization efficiency, and stress resistance and yield stability, making it particularly suitable for large-scale sweet sorghum cultivation in cold and seasonally arid regions of northern my country. It provides important germplasm resources and technical support for increasing sweet sorghum biomass and developing marginal land. Attached Figure Description

[0026] Figure 1 This is a schematic diagram of seed morphology at the sampling period (A) and the corresponding period. SbDOGL3 Transcription level of genes (B).

[0027] Figure 2 yes SbDOGL3 A schematic diagram of the selected detection sites in the locus region (A) and the results of FAIRE-qPCR detection (B).

[0028] Figure 3 yes SbDOGL3 A schematic diagram of the MAF ratio and cis-elements in the region where the gene locus is located.

[0029] Figure 4 This is a schematic diagram of the Indel molecular label.

[0030] Figure 5 The results are obtained by gel electrophoresis of PCR products amplified using Indel molecular marker-specific primers. Detailed Implementation

[0031] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.

[0032] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.

[0033] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0034] Unless otherwise stated, the implementation of this invention will utilize conventional botanical techniques, microbiological techniques, tissue culture techniques, molecular biology techniques, chemical techniques, biochemical techniques, DNA recombination techniques, and bioinformatics techniques that are readily apparent to those skilled in the art. These techniques have been fully explained in published literature. Furthermore, the methods employed in this invention, including DNA extraction, phylogenetic tree construction, gene editing methods, gene editing vector construction, and the acquisition of gene-edited plants, except for those used in the examples below, can all be implemented using methods already disclosed in existing literature.

[0035] As used herein, the terms “nucleic acid,” “nucleic acid sequence,” “nucleotide,” “nucleic acid molecule,” or “polynucleotide” mean, but are not limited to, isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), naturally occurring, mutant, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, and single-stranded or double-stranded structures. These nucleic acids or polynucleotides include, but are not limited to, gene coding sequences, antisense sequences, and regulatory sequences of non-coding regions. These terms include a gene. “Gene” or “gene sequence” is broadly used to refer to a functional DNA nucleic acid sequence. Therefore, a gene may include introns and exons in a genomic sequence, and / or include coding sequences in cDNA, and / or include cDNA and its regulatory sequences. In particular embodiments, such as concerning isolated nucleic acid sequences, cDNA is preferred by default.

[0036] 1. Biomaterials:

[0037] Sweet sorghum ( Sorghum bicolor (L.) Moench Germplasm resources (including but not limited to BTX623, J5, J26, J112, 377, 2049, 2059, 61, 14, WSC17 and WSC71, etc.) are all preserved in the inventor's laboratory.

[0038] The germination conditions for sweet sorghum seeds were: hydroponics with absorbent filter paper underneath, temperature 28 ± 1℃, full sunlight, and light intensity of 40 μmol•m. -2 •s -1 The seedling cultivation conditions were as follows: after the true leaves emerged, the seedlings were transferred to a greenhouse for soil cultivation at a temperature of 28 ± 1℃, a light-dark cycle of 16 h / 8 h, and natural light plus supplemental lighting (light intensity 100 μmol•m). -2 •s -1 ).

[0039] Primer synthesis was performed by Sangon Biotech (Shanghai) Co., Ltd. Gene sequencing was performed by Beijing Qingke Biotechnology Co., Ltd.

[0040] 2. Experimental reagents:

[0041] The RNA extraction kit was purchased from Aikerui Biotechnology Co., Ltd.

[0042] Commonly used reagents such as NaCl were purchased from Zhongke Ruitai (Beijing) Biotechnology Co., Ltd.

[0043] The reverse transcriptase MLV was purchased from Invitrogen.

[0044] 3. Experimental equipment:

[0045] The T100 PCR instrument was purchased from Bio-Rad.

[0046] The ambient temperature centrifuges and refrigerated centrifuges were purchased from Eppendorf.

[0047] The qRT-PCR instrument was purchased from Roche.

[0048] The spectrophotometer was purchased from EMC.

[0049] The digital camera was purchased from Olympus.

[0050] Example 1: Identification of genes associated with seed germination and seedling vigor phenotypes based on transcription results.

[0051] During the seed filling and ripening stages of sweet sorghum BTX623 (specific times are indicated as day after pollination, DAP), and several hours after the dried seeds have imbibed, the endosperm was removed and samples were taken. Figure 1 (Part A of the sorghum) was freeze-ground, RNA was extracted, and cDNA was obtained by reverse transcription. The transcription levels of multiple genes in sweet sorghum were then detected.

[0052] The specific steps for the RNA extraction experiment from sweet sorghum seed embryos are as follows:

[0053] 1. Tissue lysis: Add 1 mL of lysis buffer (PPS), vortex to mix, aliquot into two tubes, freeze one tube for later use, and proceed to the next step; centrifuge at 12000 rpm, 4℃ for 5 min; transfer 500 μL of supernatant to a new 1.5 mL tube, add 1 / 10 volume of Buffer PA-2 (precipitation will occur), vortex to mix (approximately 15 s); centrifuge at 12000 rpm, 4℃ for 5 min; transfer 500 μL of supernatant to a new 1.5 mL tube, add 500 μL of lysis buffer (RLS) (confirm that 50× DTT solution has been added to the buffer before use), vortex to mix.

[0054] 2. RNA purification: Add 1 / 2 volume (500 μL) of anhydrous ethanol, mix thoroughly by pipetting to avoid precipitation and blockage; transfer to an RNA adsorption column, 700 μL each time (approximately twice), centrifuge at 12000 rpm for 2 min at room temperature each time, and discard the liquid; add 600 μL RWA buffer, centrifuge at 12000 rpm for 1 min, and discard the liquid; add 750 μL RWB buffer, centrifuge at 12000 rpm for 1 min, and discard the liquid; for the first DNase I digestion, pre-mix the DNase I reaction solution (components include 4 μL DNase I, 5 μL 10×DNase I buffer, and 41 μL RNase-free water), add 50 μL of DNase I reaction solution to the center of the adsorption column membrane, and let the reaction stand for 1 h or more; add 350 μL RWA buffer, centrifuge at 12000 rpm for 1 min, and discard the liquid; add 350 μL RWB buffer, centrifuge at 12000 rpm for 1 min, and discard the liquid; add 700 μL RWA buffer, centrifuge at 12000 rpm for 1 min, and discard the liquid; add 700 μL RWA buffer, centrifuge at 12000 rpm for 1 min, and discard the liquid; add 700 μL RWA buffer, centrifuge at 12000 rpm for 1 min, and discard the liquid; add 700 μL RWB ... Centrifuge at 12000 rpm for 1 min with μL RWB buffer and discard the liquid. Place the adsorption column in a new collection tube (RNase-free) and centrifuge at 12000 rpm for 2 min. Then place the adsorption column in a new 1.5 mL tube (RNase-free), add 50 μL RNase-free water to the center of the membrane, let stand for 5 min, centrifuge at 12000 rpm at room temperature for 2 min, and add the liquid back to the center of the membrane. Repeat the centrifugation once. For the second DNase I digestion, digest directly at the bottom of the 1.5 mL tube with 5 μL DNase I and 6 μL 10×DNase I buffer, and react for 1 h or more. To detect the digestion, use RNA as the experimental group and gDNA as the control, and use qRT-Primer as the primer. Perform PCR for 50 cycles to ensure complete digestion. Freeze the completely digested RNA.

[0055] 3. Reverse transcription to obtain cDNA: Prepare Component I in a 200 μL RNase-free tube: containing 8 μL RNA, 2 μL oligo(dT), and 2.5 μL RNase-free water (total 12.5 μL). Incubate in a metal bath at 65 °C for 5 min; place on ice for 1 min, then cool rapidly (no longer than 2 min, to avoid secondary structure formation). Prepare Component II in advance: containing 4 μL 5×RTbuffer, 2 μL dNTP, 1 μL RTase, and 0.5 μL RNase-free water (total 7.5 μL). Add to the total volume (20 μL), run a PCR program (42 °C for 60 min, 70 °C for 10 min, 10 °C for 1 s), and freeze the obtained cDNA.

[0056] Results of transcription level measurements showed that SbDOGL3 Genes may be responsible for maintaining seed dormancy. See also Figure 1 As shown in Part B, compared to sweet sorghum seeds with a DAP (day after pollination) of 17, DAP20 has a higher [percentage missing]. SbDOGL3 Transcriptional levels (~2-fold), DAP32, dry seeds, and seeds after sowing and imbibition all showed lower levels. SbDOGL3 Transcription level (<0.5-fold).

[0057] Example 2 SbDOGL3 Association analysis of chromatin accessibility at gene loci with their function

[0058] Based on the above results, we consider sequencing the sweet sorghum species BTX623. SbDOGL3 The accessibility of chromatin loci was investigated by selecting detection sites and designing FAIRE-qPCR primers to detect their openness (see [link to FAIRE-qPCR]). Figure 2 Part A).

[0059] The specific experimental steps for FAIRE-PCR (Formaldehyde-assisted isolation of regulatory elements-PCR) are as follows:

[0060] 1. Sample Fixation: Prepare two samples, one for fixation (FAIRE) and the other for non-fixation (Un-FAIRE); prepare a fixation buffer (40 mL) with the following components: 10 mM Tris-HCl (pH 8.0), 0.4 M Sucrose, and 1% formaldehyde. Freeze the sample, add the fixation buffer, and vacuum at room temperature for approximately 15 min; after the sample settles, add 0.125 M glycine to the system and vacuum again for 5 min; wash the sample three times with ddH2O, drain the water, and store frozen at -80℃.

[0061] 2. Nuclear DNA Extraction: Prepare reagents including Extraction Buffer I (0.4M Sucrose, 10mM Tris-HCl (pH 8.0), 5mM β-mercaptoethanol), Extraction Buffer II (0.25M Sucrose, 10mM Tris-HCl (pH 8.0), 10mM MgCl2, 1% Triton X-100, 5mM β-mercaptoethanol), Extraction Buffer III (1.7M Sucrose, 10mM Tris-HCl (pH 8.0), 2mM MgCl2, 0.15% Triton X-100, 5mM β-mercaptoethanol), and Nuclear Lysis Buffer (50mM Tris-HCl (pH 8.0), 10mM EDTA, 1% SDS); pre-chill the mortar and grind the sample into powder; resuspend the powder in 30°C water. Incubate in 1 mL of Buffer I at 4°C; filter the liquid through a filter cloth (4 layers) into a new tube; centrifuge at 2880 g for 20 min at 4°C; remove the supernatant, resuspend the precipitate in 1 mL of Extraction Buffer II, and transfer to a 1.5 mL tube; centrifuge at 12000 g for 10 min at 4°C; remove the supernatant, resuspend the precipitate in 300 μL of Extraction Buffer III; add 300 μL of Extraction Buffer III to a new 1.5 mL tube, covering the new tube with the resuspended precipitate; centrifuge at 16000 g for 1 h at 4°C; remove the supernatant, resuspend the chromatin precipitate in 300 μL of Nuclear lysis buffer, vortex, and invert to mix (keeping at 4°C); sonicate at 5% power for 10 sec, repeat 4 times, to shear the DNA to 0.5~2 kb size. The sonicated chromatin solution can be frozen at -80°C or used for CHIP precipitation; extract with phenol-chloroform (1:1), centrifuge at 10000 rpm for 5 minutes. After 3 min, collect the supernatant and repeat 3 times; add twice the volume of anhydrous ethanol (2% glycogen can be added), precipitate at -80℃ for 30 min or at -30℃ for 1~2 h / overnight; rinse twice with 70% ethanol; air dry, add 100-200 μL ddH2O, and store at -30℃ for later use.

[0062] The design of FAIRE-qPCR primers is as follows:

[0063] SbDOGL3-CHIP-F1 TGGGTGGCATGTAAGGGGTAG

[0064] SbDOGL3-CHIP-R1ACTTCACCGGAAACATTTGCA

[0065] SbDOGL3-CHIP-F2CATGGTTGATTTCTTGGCCCAG

[0066] SbDOGL3-CHIP-R2TTGAGGCTAGTTAGTCCATGGTTG

[0067] SbDOGL3-CHIP-F3GGTAGGCCGCAAATAATCATTTTGC

[0068] SbDOGL3-CHIP-R3GATCGTGTCGTTGTCCTAAACG

[0069] SbDOGL3-CHIP-F4CTCAATGTTTGACCCAAAATTTATCC

[0070] SbDOGL3-CHIP-R4TCGTTTTTCCTATACTACGTGGG

[0071] SbDOGL3-CHIP-F5 GATGAGTAGTTATATTTGGGATCAG

[0072] SbDOGL3-CHIP-R5 CTTGTCGTTTGTGTAGAAGCCC

[0073] SbDOGL3-CHIP-F6ACTACTCCTGCCATCGTTTTGC

[0074] SbDOGL3-CHIP-R6CGCCCTGCTTTTCACCTTTT

[0075] SbDOGL3-CHIP-F7TGCGTGTCATCTTCCCTGTC

[0076] SbDOGL3-CHIP-R7CACTCTATGGTTCGTCGGATTT

[0077] SbDOGL3-CHIP-F8ACCGCAGAAACAAACAAGCA

[0078] SbDOGL3-CHIP-R8TGTCCATCCCGTCCAAGAAG

[0079] SbDOGL3-CHIP-F9CTCACTGCACACAGAGTCTCTT

[0080] SbDOGL3-CHIP-R9TAGTCCTGGTACCCGAGCATGC

[0081] SbDOGL3-CHIP-F10CTACAACATATCCGGGGAAGG

[0082] SbDOGL3-CHIP-R10TGGAGGTCGTTGATGAGCAG

[0083] It can be observed that, compared to sample DAP23, sample DAP33... SbDOGL3 The locus region chromatin has a higher degree of openness, while the locus chromatin in the leaf sample has a very low degree of openness, which is consistent with... SbDOGL3 The high expression of the gene during seed after-ripening is consistent with its function of maintaining seed dormancy; meanwhile, based on the chromatin openness of the DAP33 sample, the 5'UTR (locus 5-9) has relatively open chromatin segments, with locus 7 having the highest openness and locus 9 the second highest (see...). Figure 2 (Part B). The focus is on whether this region contains key SNP / INDEL sites and cis-regulatory elements that can be used for subsequent SSR molecular marker development and design.

[0084] At the same time, SbDOGL3 The gene locus sequence (SEQ ID NO: 1) information FASTA file was uploaded to the PlantPAN 4.0 website for analysis. SbDOGL3 Information on cis-acting elements upstream and downstream (-3kb ~ +2kb) of the locus. Additionally, a search for Sobic.003G302466 in the Variation Search section of the SorGSD database website yielded... SbDOGL3 Nucleotide diversity information (-3kb to +2kb) upstream and downstream of the gene locus, including SNP and INDEL sites and their MAF (minimum allele frequency). Comparison reveals that key cis-regulatory elements largely overlap with SNPs and INDELs and exhibit high MAF levels. Figure 3 This shows that, SbDOGL3 Genes have rich potential for genetic regulation and can be used to discover and design SSR molecular markers from wild germplasm resources.

[0085] Example 3 Based on SbDOGL3 Indel molecular marker development of gene loci

[0086] Based on the above results, we selected a relatively open chromatin region (site 7) to design sequencing primers, extracted genomic DNA (gDNA) from representative varieties of different haplotypes, cloned this region, and sequenced it. The specific primers are as follows:

[0087] SbDOGL3-cexu-F GATGAGTAGTTATATTTGGGATCAG

[0088] SbDOGL3-cexu-RGCCTTCCCCGGATATGTTGTAGA

[0089] The specific steps for extracting total gDNA from sweet sorghum are as follows: Cut 1-2 leaves from sweet sorghum that have grown for 4-5 weeks using a blade, place them in a 2 mL centrifuge tube, add sterile steel balls, and then grind thoroughly using a plant breaker (parameter settings: 60 Hz, 60 s); add 500 μL of 2× CTAB lysis buffer system (0.1 M Tris-HCl, pH 8.0, 20 mM EDTA, pH 8.0, 1.5 M NaCl, 2% (w / v) CTAB) to the ground sample, mix thoroughly by inversion, and incubate at 65℃ for 30 min; after the lysis products have equilibrated to room temperature, add an equal volume of phenol-chloroform-isopropanol (25:24:1), vortex for 30 s to fully emulsify the system, and let stand for 2-3 min; centrifuge at 12,000 rpm for 5 min to separate the aqueous and organic phases; accurately pipette 400 μL of the solution... Add μL of the upper aqueous phase to a new centrifuge tube, add 2 volumes of pre-chilled anhydrous ethanol, mix gently, and incubate at -30°C for 30 min. Centrifuge at 12,000 rpm for 1 min, collect the precipitate, discard the supernatant, and wash the precipitate twice with 75% (v / v) ethanol solution (1 mL each time, centrifugation conditions: 12,000 rpm, 1 min). Finally, invert the centrifuge tube to air dry for 5-10 min to ensure complete ethanol evaporation. Add 30-50 μL of sterile ddH2O, resuspend the DNA precipitate, and gently pipette to mix. Store the dissolved DNA sample at 4°C for later use.

[0090] Sequencing results showed that haplotype identification contained specific SNPs and INDELs, with the INDEL located at positions 2539-2546 of SEQ ID NO: 1. This position spans two cis-regulatory elements (i.e., GCC-box and STRE). Specifically, this INDEL location involves an 8 bp sequence insertion or deletion (CCGCCGAG / -). Figure 4 ).

[0091] Example 4: Development of specific primers for detecting INDEL molecular markers

[0092] Specific primer pairs for detecting this molecular marker were designed based on the aforementioned INDEL positions. The specific sequences of the primer pairs are as follows:

[0093] SbDOGL3-SSR-F1 TCCGGAAAAGGTGAAAAGCAG;

[0094] SbDOGL3-SSR-R1 AGGGAAGATGACACGCAAGATT.

[0095] Method for detecting the INDEL molecular marker: Using genomic DNA of the mutant material to be identified as a template, PCR amplification was performed (PCR 10 μL system: 5 μL 2×taq enzyme Mix, 1 μL DNA template, 2 μL SbDOGL3-SSR-F / R primers (2.5 μM), 2 μL ddH2O). The PCR amplification program was: 94℃ pre-denaturation for 3 min; 95℃ denaturation for 10 s, 58℃ annealing for 30 s, 68℃ extension for 15 s, 35 cycles; 68℃ extension for 5 min. The gel was run using 2% agarose. Based on the 8 bp difference in the length of the amplified product, the sequence CCGCCGAG at the INDEL molecular marker was determined to be inserted or deleted. Therefore, based on this molecular marker, the germplasm resources were divided into high early growth potential and low early growth potential types. Among them, sweet sorghum seeds with shorter amplified products (89 bp) exhibited higher germination activity and seedling vigor (i.e., higher early growth vigor), while sweet sorghum seeds with longer amplified products (96 bp) showed lower germination activity and seedling vigor (i.e., lower early growth vigor). For example... Figure 5 The results shown.

[0096] Example 5: Application of INDEL molecular markers in identifying early growth potential of sweet sorghum

[0097] In addition, the above primers were used to genotype 289 existing sweet sorghum germplasm resources, and gene sequencing was used to verify the genotyping results. The results showed that the primer set of Example 4 could successfully distinguish the insertion or deletion of the sequence CCGCCGAG at the INDEL position of SEQ ID NO: 1 at positions 2539-2546, thereby genotyping the aforementioned germplasm resources (see Table 1).

[0098] When the amplification product was 96 bp, an 8 bp sequence CCGCCGAG was found at the INDEL position (labeled as "1" in Table 1). Following the seed germination steps and seedling growth conditions described earlier, statistical analysis revealed that germplasm resources labeled as "1" could germinate within 1-2 days after imbibition, with a final germination rate of nearly 100%. Furthermore, this haplotype exhibited higher plant height at the 5-leaf stage, indicating strong early growth potential. When the amplification product was 89 bp, the 8 bp sequence CCGCCGAG was missing at the INDEL position (labeled as "2" in Table 1). Germplasm resources with haplotype "2" required 3 days after imbibition to germinate, with a final germination rate below 40%. This haplotype also showed shorter plant height at the 5-leaf stage, indicating weaker early growth potential. The results demonstrate that the INDEL molecular marker of this invention is usable and accurately genotyped.

[0099] Table 1. Haplotype and gene sequencing validation results of representative varieties

[0100]

[0101] In the "Haplotype" column, the number 2 represents germplasm resources with low early growth vigor, and the number 1 represents germplasm resources with high early growth vigor. "-" indicates germplasm resources that cannot be classified into haplotypes.

[0102] In summary, this invention is the first to develop... SbDOGL3 Locus targeting Indel molecular markers allows for the screening of superior germplasm with both strong germination ability and high seedling vigor in the early stages of sowing.

[0103] The application of the Indel molecular marker of this invention helps improve breeding efficiency. This marker enables synergistic selection of seed germination and seedling growth traits, shortening the breeding cycle to some extent and providing support for the breeding of stress-resistant, high-yielding new varieties. Simultaneously, this technology has positive implications for crop production on marginal lands; the resulting vigorous varieties are expected to enhance crop adaptability under cold and arid conditions, thereby providing germplasm resources for a stable supply of bioenergy feedstock and the effective utilization of marginal lands.

[0104] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

[0105] sequence list

[0106] SEQ ID NO: 1 SbDOGL3 nucleotide sequence of the locus where the gene is located

[0107]

[0108] SEQ ID NO: 2

[0109] TCCGGAAAAGGTGAAAAGCAG

[0110] SEQ ID NO: 3

[0111] AGGGAAGATGACACGAAGATT。

Claims

1. An Indel molecular marker associated with the early growth potential of sweet sorghum, characterized in that, The nucleotide sequence of the Indel molecular marker is shown in SEQ ID NO: 1, wherein positions 2539-2546 of SEQ ID NO: 1 have an insertion / deletion variation. Sweet sorghum with the sequence CCGCCGAG at positions 2539-2546 of SEQ ID NO: 1 has low early growth potential, while sweet sorghum with the sequence CCGCCGAG deleted at positions 2539-2546 of SEQ ID NO: 1 has high early growth potential.

2. The application of the Indel molecular marker according to claim 1 in any of the following: (1) Identify the early growth potential of sweet sorghum; (2) Improve sweet sorghum germplasm resources, wherein the improved sweet sorghum germplasm resources are used to enhance the early growth potential of sweet sorghum.

3. The use of a primer pair for detecting Indel molecular markers associated with early growth potential in sweet sorghum, or a detection kit containing said primer pair, in any of the following: (1) Identify the early growth potential of sweet sorghum; (2) Improve sweet sorghum germplasm resources, wherein the improved sweet sorghum germplasm resources are those that enhance the early growth vigor of sweet sorghum. The primer pair is: Forward primer: TCCGGAAAAGGTGAAAAGCAG; Reverse primer: AGGGAAGATGACACGCAAGATT.

4. A method for identifying the early growth potential of sweet sorghum, characterized in that, The method includes: using the genomic DNA of the sweet sorghum to be tested as a template, performing PCR amplification on the template using primer pairs that detect Indel molecular markers related to the early growth potential of sweet sorghum or a detection kit containing the primer pairs, and then detecting the insertion or deletion of Indel molecular markers in the amplification product. If the amplification product is an 89 bp fragment, it indicates that the early growth potential of the sweet sorghum to be tested is high. If the amplification product is a 97 bp fragment, it indicates that the early growth potential of the sweet sorghum being tested is low. The primer pair is: Forward primer: TCCGGAAAAGGTGAAAAGCAG; Reverse primer: AGGGAAGATGACACGCAAGATT.

5. The method according to claim 4, characterized in that, The PCR amplification reaction system includes: 5 μL 2×taq enzyme Mix, 1 μL DNA template, 2 μL 2.5 μM SbDOGL3-SSR-F / R primers, and 2 μL ddH2O.

6. The method according to claim 4, characterized in that, The insertion or deletion of Indel molecular markers can be determined by detecting the size of the amplification products using gel electrophoresis.

Citation Information

Patent Citations

  • SCAR marker of sweet sorghum high sugar gene

    CN103013992A

  • Recombinant protein for marking plant ubiquitination modified protein and application thereof

    CN118496384A