Conjugates and uses thereof

Abstract

The present invention relates to a conjugate formed from a cell penetrating peptide vector linked to a therapeutic molecule wherein the peptide vector is defined by a specific domain and the therapeutic molecule is a nucleic acid formed from a trinucleotide repeat. The invention further relates to the use of such conjugates in methods of treatment or as a medicament, in particular in the treatment of trinucleotide repeat disorders such as ankylosing muscular dystrophy (DM1).

Description

[0001] This application is a divisional application of the invention patent application filed on August 7, 2020, with Chinese national application number 202080071067.8 and entitled "Conjugates and Their Uses". Technical Field

[0002] This invention relates to conjugates of peptide carriers and therapeutic molecules, wherein the peptide carrier is defined by specific structural domains and the therapeutic molecule is a nucleic acid formed by trinucleotide repeats. The invention further relates to the use of such conjugates in therapeutic methods or as medicines, particularly in the treatment of trinucleotide repeat disorders such as myotonic dystrophy (DM1). Background Technology

[0003] Nucleic acid therapy is a type of genomic medicine that has the potential to revolutionize human healthcare. Research indicates that such therapies can be applied to a wide range of diseases. In particular, the use of antisense oligonucleotide-based methods to modulate mRNA expression has become an ideal therapeutic approach at the forefront of precision medicine.

[0004] However, the development of these promising antisense therapies is hampered by insufficient extracellular penetrance and poor distribution characteristics.

[0005] Therefore, there is an urgent need to improve the delivery of antisense oligonucleotides in order to provide more effective treatments for genetic diseases such as devastating trinucleotide repeat disorders.

[0006] Trinucleotide duplication disorder is a genetic condition characterized by an abnormally high number of repeats of a specific sequence of three nucleotides in the genomic DNA, also known as trinucleotide duplication amplification. Trinucleotide duplication amplification is a specific type of microsatellite duplication, commonly referred to as microsatellite amplification. Typically, there is a threshold number of repeats in normal healthy subjects; if this number is exceeded, the disease will develop. The threshold number differs between the disease and the affected gene. Often, in these diseases, the number of repeats can indicate the severity of the disease. Generally, a higher number of repeats indicates a more severe disease presentation. The number of repeats can also be used to predict the age of onset; a higher number of repeats indicates an earlier onset.

[0007] Currently, 14 trinucleotide repeat disorders affecting humans are known. These disorders can be grouped in several ways, such as according to the location of the trinucleotide repeat in the gene: whether it is in a protein-coding ORF; in an exon; or in an untranslated region. Alternatively, they can be grouped according to the sequence of the triplet repeat. In many trinucleotide disorders, the triplet repeat is “CAG” and encodes glutamine; this group is often referred to as polyglutamine disorders. However, trinucleotide repeats with other sequences are known and can be grouped as non-polyglutamine repeat disorders.

[0008] One type of trinucleotide disorder called non-polyglutamine repeat disorder is myotonic dystrophy type 1 (DM1). DM1 is caused by a trinucleotide repeat called "CTG" present in the 3'UTR of the DMPK gene. The normal number of repeats in this gene is between 5 and 34. More than 34 repeats may cause some symptoms of the disease, while more than 50 repeats will cause the disease to develop.

[0009] DM1 and other trinucleotide repeat disorders typically affect the neuromuscular system, and there are currently no effective treatments.

[0010] While the use of antisense oligonucleotides that can bind to repeat regions and disrupt splicing or translation has been theoretically proposed and demonstrated in vitro, their use as therapeutic agents has been hampered by the difficulty in delivering these molecules to affected cells. This is the case for treating a variety of genetic disorders, including trinucleotide repeats.

[0011] Viruses have been proposed as delivery vectors, but their use is limited by the immunotoxicity and potential carcinogenicity of viral capsid proteins. Alternatively, various non-viral delivery vectors have been developed, among which peptides have shown the most promise due to their small size, target specificity, and ability to deliver large biocargoes across capillaries. The ability of several peptides to penetrate cells, either alone or carrying biocargo, has been reported.

[0012] For many years, cell-penetrating peptides have been conjugated with antisense oligonucleotides, particularly charge-neutral phosphoryldiamine morpholino oligomers (PMOs) and peptide nucleic acids (PNAs), to enhance the cellular delivery of such oligonucleotide analogs by efficiently carrying them across the cell membrane to their pre-mRNA targets in the cell nucleus. It has been shown that PMO therapeutics conjugated with certain arginine-rich peptides (referred to as P-PMOs or peptide-PMOs) can effectively penetrate into the relevant cells.

[0013] Specifically, PNA / PMO internalizing peptides (Pips) have been developed, which are arginine-rich CPPs consisting of two arginine-rich sequences separated by a short, hydrophobic central sequence. These “Pip” peptides are designed to improve serum stability while maintaining high levels of exon skipping, initially achieved by attaching them to PNA cargo. Other derivatives of these peptides have been engineered as conjugates of PMO, and following systemic administration in mice, they have demonstrated the ability to induce systemic skeletal muscle therapy, and importantly, cardiac therapy as well.

[0014] Although these carrier peptides are effective, their associated toxicity hinders their therapeutic applications.

[0015] Alternative carrier peptides with a single arginine-rich domain, such as R6Gly, have also been developed. These peptides have been used to produce peptide conjugates with reduced toxicity antisense oligonucleotides, but these conjugates have shown lower efficacy compared to Pip peptides.

[0016] Furthermore, almost all carrier peptide development has been conducted in the treatment of DMD. Peptides with hydrophobic core domains have been shown to be particularly active in the context of DMD. The use of such carrier peptides in other neuromuscular diseases with different etiologies and pathologies has not yet been investigated.

[0017] Therefore, currently available carrier peptides have not been proven suitable for use in conjugates containing nucleic acid therapeutic agents for treating genetic diseases, and are particularly unsuitable for diseases caused by different pathologies, such as trinucleotide duplication disorders.

[0018] A challenge in the field of carrier peptide technology is separating efficacy from toxicity. The inventors of this invention have now identified, synthesized, and tested conjugates comprising improved carrier peptides having a specific structure covalently linked to therapeutic nucleic acids for treating trinucleotide disorders, which at least address this problem. Summary of the Invention

[0019] According to a first aspect of the invention, a conjugate is provided comprising: a peptide carrier covalently linked to a therapeutic molecule;

[0020] The total length of the peptide carrier is 40 or fewer amino acids, and includes: two or more cationic domains, each cationic domain containing at least 4 amino acid residues and one or more hydrophobic domains, each hydrophobic domain containing at least 3 amino acid residues, wherein the peptide carrier does not contain artificial amino acid residues.

[0021] Furthermore, the therapeutic molecule comprises a nucleic acid, wherein the nucleic acid comprises multiple trinucleotide repeats.

[0022] According to a second aspect of the invention, a conjugate according to the first aspect is provided for use as a medicine.

[0023] According to a third aspect of the invention, a method for treating a disease in a subject is provided, the method comprising: administering to the subject an effective amount of the conjugate according to the first aspect.

[0024] According to a fourth aspect of the invention, a conjugate according to the first aspect is provided for the prevention or treatment of trinucleotide duplication syndromes.

[0025] According to a fifth aspect of the invention, a method for preventing or treating trinucleotide duplication syndrome in a subject is provided, the method comprising: administering to the subject an effective amount of the conjugate according to the first aspect.

[0026] According to a sixth aspect of the invention, a pharmaceutical composition comprising the conjugate according to the first aspect is provided.

[0027] In one embodiment of the second, third, fourth, or fifth aspect, the conjugate is contained in the pharmaceutical composition.

[0028] Other features and embodiments of the invention will now be described in the following heading sections. Unless otherwise expressly stated, any feature may be combined with the foregoing aspects or other features herein in any compatible combination. Individual features are not limited to any particular embodiment. The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described.

[0029] Throughout the text, "peptide carrier" refers to a peptide suitable for transporting molecules conjugated to it into cells, i.e., a cell-penetrating peptide. The terms "cell-penetrating peptide," "peptide carrier," and "peptide" are used interchangeably throughout the text.

[0030] Always use "X" to represent any form of artificially prepared, synthetic aminocaproic acid.

[0031] The amino acid β-alanine, which is naturally occurring but not genetically encoded, is always represented by "B".

[0032] The acetylation of the relevant peptide is always indicated by "Ac".

[0033] The amino acid hydroxyproline, which is naturally occurring but not genetically encoded, is always referred to as "Hyp".

[0034] Amino acid residues encoded genetically according to recognized letter amino acid codes are always represented by uppercase letters.

[0035] The term "artificial" amino acid or residue as used herein refers to any amino acid that is not naturally occurring, and includes synthetic amino acids, modified amino acids (e.g., amino acids modified with sugars), non-natural amino acids, artificial amino acids, spacers, and non-peptide-bonded spacers. For the avoidance of ambiguity, in the context of this invention, aminocaproic acid (X) is an artificial amino acid. For the avoidance of ambiguity, β-alanine (B) and hydroxyproline (Hyp) are naturally occurring and therefore, in the context of this invention, are natural amino acids, not artificial amino acids. Artificial amino acids may include, for example, 6-aminocaproic acid (X), tetrahydroisoquinoline-3-carboxylic acid (TIC), 1-(amino)cyclohexanecarboxylic acid (Cy), and 3-azacyclobutanecarboxylic acid (Az), and 11-aminoundecanoic acid.

[0036] The term "cation" as used in this article refers to an amino acid or an amino acid domain that has an overall positive charge at physiological pH.

[0037] "Arginine-rich" or "histidine-rich" means that at least 40% of the cationic domains are formed by the residues.

[0038] The term "hydrophobicity" as used in this article refers to amino acids or amino acid domains that have the ability to repel water or not mix with water. Detailed Implementation

[0039] This invention is based on the discovery that binding a specific peptide carrier to a nucleic acid suitable for the prevention and treatment of trinucleotide duplication disorders allows the nucleic acid to efficiently penetrate target cells and bind to target trinucleotide duplication amplifications present in the genes of affected subjects. This activity reduces the levels of duplication transcripts and / or proteins present in cells, thereby blocking their pathological interactions with cellular splicing mechanisms, normalizing splicing, and improving the physiological condition of the subjects.

[0040] Advantageously, the peptide carriers described herein appear to enhance the ability of therapeutic nucleic acids to resist degradation, penetrate target cells, and reach target trinucleotide amplification for therapeutic delivery. Furthermore, the conjugates of the present invention exhibit significantly lower toxicity than conjugates formed using known peptide carriers. Therefore, this conjugate provides an efficient means of delivering nucleic acid therapy for trinucleotide duplication disorders while remaining non-toxic to the subject.

[0041] The inventors believe this is the first time that a peptide carrier with a hydrophobic core has been demonstrated to be effective in treating neuromuscular diseases beyond the scope of DMD. Previous research has focused on using peptide carriers to deliver therapeutic agents for DMD. The pathology of DMD is quite different from that of trinucleotide repeat disorders. In particular, DMD involves active muscle degeneration and muscle turnover and repair, including inflammation, while trinucleotide repeat disorders such as ankylosing dystrophy type 1 (DM1) involve muscle dysfunction without significant degeneration. The inventors of this invention believe that peptide carriers interact with the muscle membrane to allow for efficient delivery of therapeutic molecules; therefore, the type of membrane they interact with differs greatly between degenerative and non-degenerative muscles (i.e., between DMD and trinucleotide repeat disorders). Unlike degenerative diseases such as DMD, in DM1, the muscle membrane is not disrupted, so conjugate penetration into muscle tissue is expected to be inhibited and more difficult to achieve. However, based on the data presented herein, peptide carriers have not only shown for the first time efficient delivery to non-degenerative muscles for the treatment of DM1, but have also unexpectedly shown to be more effective for DM1 than for DMD.

[0042] In the data provided herein, the conjugates of the present invention maintain good levels of efficacy and are delivered to key target tissues affected by trinucleotide disorders, such as the gastrocnemius and quadriceps skeletal muscles. Furthermore, these conjugates exhibit improved efficacy compared to previously available carrier peptides used in the same conjugates. The conjugates of the present invention target mutant CUG amplification-DMPK transcripts to prevent the formation of nuclear foci, thereby preventing the harmful isolation of MBNL1 splicing factors by nuclear RNA foci, thus mitigating MBNL1 function loss leading to splicing defects and muscle dysfunction in multiple genes.

[0043] This is demonstrated herein by a reduction in the number of aggregation sites formed by the amplified DMPK transcript after administration of the conjugate of the present invention and by splicing correction of genes typically misjoined in DM1 due to reduced availability of MBNL1 isolated by the trinucleotide repeat amplified transcript. Specifically, the conjugate shown herein exhibits 50-90% splicing correction in healthy controls excluding clicn1 exon 7a and mblnl1 exon 5 and including serca exon 22, compared to untreated cells / subjects. This is further confirmed by improvements in the physiological condition of trinucleotide disorders, as illustrated herein in the DM1 model, where myotonia in mice is restored to normal and corrected to a degree of complete recovery, even after a single injection of the conjugate described herein.

[0044] Surprisingly, the inventors discovered that the peptide carrier used in the conjugate effectively delivers the therapeutic molecule at a sufficient concentration into the nuclear compartment and into the nuclear aggregates of the DMPK transcript to allow for a favorable stoichiometric interaction with the CUG mutation.

[0045] Simultaneously, the conjugates of the present invention exert their effects effectively in vivo, exhibiting reduced clinical symptoms after systemic injection and lower toxicity observed by measuring biochemical markers. Crucially, the conjugates of the present invention, after similar systemic injection into mice, have been shown to exhibit remarkably reduced toxicity compared to previous carrier peptides in the same conjugates. As demonstrated herein, the conjugates of the present invention do not cause a significant increase in toxicity markers at treatment-related doses and maintain cell viability compared to saline, while conjugates using existing peptide carriers show significant cell death. When the conjugates are administered to mice, the mice exhibit rapid recovery times, which are much faster than after administration of conjugates formed from previously available peptides.

[0046] Therefore, the conjugates of the present invention offer improved applicability and can be used as a safe and effective therapy for human trinucleotide duplication syndromes, thereby providing a pathway to treat these previously incurable and devastating diseases.

[0047] Artificial amino acids

[0048] This invention relates to conjugates comprising a carrier peptide having a specific structure in which no artificial amino acid residues are present.

[0049] Suitablely, the peptide does not contain aminocaproic acid residues. Suitablely, the peptide does not contain any form of aminocaproic acid residue. Suitablely, the peptide does not contain 6-aminocaproic acid residues.

[0050] Appropriately, the peptide contains only natural amino acid residues and is therefore composed of natural amino acid residues.

[0051] Appropriately, artificial amino acids such as 6-aminocaproic acid, commonly used in cell-penetrating peptides, are replaced with natural amino acids. Appropriately, artificial amino acids such as 6-aminocaproic acid, commonly used in cell-penetrating peptides, are replaced with amino acids selected from β-alanine, serine, proline, arginine, and histidine or hydroxyproline.

[0052] In one embodiment, aminocaproic acid is replaced by β-alanine. Suitablely, 6-aminocaproic acid is replaced by β-alanine.

[0053] In one embodiment, aminocaproic acid is replaced by histidine. Suitablely, 6-aminocaproic acid is replaced by histidine.

[0054] In one embodiment, aminocaproic acid is replaced by hydroxyproline. Suitable alternatively, 6-aminocaproic acid is replaced by hydroxyproline.

[0055] Appropriately, artificial amino acids such as 6-aminocaproic acid, which are commonly used in cell-penetrating peptides, can be replaced by a combination of any one of β-alanine, serine, proline, arginine, and histidine or hydroxyproline, appropriately, a combination of any one of β-alanine, histidine, and hydroxyproline.

[0056] In one embodiment, the total length of the peptide carrier may be 40 or fewer amino acid residues, and the peptide comprises:

[0057] Two or more cationic domains, each containing at least four amino acid residues; and

[0058] One or more hydrophobic domains, each hydrophobic domain containing at least 3 amino acid residues;

[0059] At least one of the cationic domains contains histidine residues.

[0060] Appropriately, at least one of the cationic domains is rich in histidine.

[0061] Appropriately, the meaning of histidine richness in this paper is defined in relation to the cationic domain.

[0062] cationic domain

[0063] This invention relates to conjugates comprising short peptide carriers having a specific structure, wherein at least two cationic domains having a certain length are present.

[0064] Appropriately, the peptide comprises up to four cationic domains and up to three cationic domains.

[0065] Appropriately, the peptide comprises two cationic domains.

[0066] As defined above, the peptide comprises two or more cationic domains, each having a length of at least four amino acid residues.

[0067] Appropriately, each cationic domain is 4 to 12 amino acid residues in length, or 4 to 7 amino acid residues in length.

[0068] Appropriately, each cationic domain has a length of 4, 5, 6, or 7 amino acid residues.

[0069] Appropriately, each cation domain has a similar length, or each cation domain has the same length.

[0070] Appropriately, each cationic domain contains a cationic amino acid, and may also contain polar and / or nonpolar amino acids.

[0071] Nonpolar amino acids can be selected from: alanine, β-alanine, proline, glycine, cysteine, valine, leucine, isoleucine, methionine, tryptophan, and phenylalanine. Appropriately, nonpolar amino acids do not carry an electric charge.

[0072] Polar amino acids can be selected from: serine, asparagine, hydroxyproline, histidine, arginine, threonine, tyrosine, and glutamine. Appropriately, the selected polar amino acids do not have a negative charge.

[0073] Cationic amino acids can be selected from arginine, histidine, and lysine. Appropriately, cationic amino acids carry a positive charge at physiological pH.

[0074] Appropriately, each cationic domain does not contain anionic or negatively charged amino acid residues.

[0075] Appropriately, each cationic domain contains arginine, histidine, β-alanine, hydroxyproline, and / or serine residues.

[0076] Appropriately, each cationic domain consists of arginine, histidine, β-alanine, hydroxyproline, and / or serine residues.

[0077] Appropriately, each cationic domain contains at least 40%, at least 45%, or at least 50% cationic amino acids.

[0078] Suitablely, each cationic domain contains a majority of cationic amino acids. Suitablely, each cationic domain contains at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of cationic amino acids.

[0079] Appropriately, the isoelectric point (pI) of each cation domain is at least 7.5, at least 8.0, at least 8.5, at least 9.0, at least 9.5, at least 10.0, at least 10.5, at least 11.0, at least 11.5, or at least 12.0.

[0080] Appropriately, the isoelectric point (pI) of each cation domain is at least 10.0.

[0081] Appropriately, the isoelectric point (pI) of each cation domain is between 10.0 and 13.0.

[0082] In one embodiment, the isoelectric point (pI) of each cation domain is 10.4 to 12.5.

[0083] Suitablely, the isoelectric point of the cation domain can be calculated at physiological pH using any suitable method available in the art. Suitablely, a network-based algorithm developed by Lukasz Kozlowski, BiolDirect. 2016; 11:55. DOI:10.1186 / s13062-016-0159-9 was used via IPC (www.isoelectric.org).

[0084] Appropriately, each cationic domain contains at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 60%, at least 65%, or at least 70% of arginine and / or histidine residues.

[0085] Appropriately, the cation domain comprises at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 60%, at least 65%, and at least 70% of arginine residues.

[0086] Appropriately, the cation domain comprises at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 60%, at least 65%, or at least 70% of histidine residues.

[0087] Suitablely, the cationic domain may contain a total of 1-5 histidine and 1-5 arginine residues. Suitablely, the cationic domain may contain 1-5 arginine residues. Suitablely, the cationic domain may contain 1-5 histidine residues. Suitablely, the cationic domain may contain a total of 2-5 histidine and 3-5 arginine residues. Suitablely, the cationic domain may contain 3-5 arginine residues. Suitablely, the cationic domain may contain 2-5 histidine residues.

[0088] Suitablely, each cationic domain contains one or more β-alanine residues. Suitablely, each cationic domain may contain a total of 2-5 β-alanine residues, suitablely, a total of 2 or 3 β-alanine residues.

[0089] Appropriately, the cation domain may contain one or more hydroxyproline residues or serine residues.

[0090] Appropriately, the cationic domain may contain 1-2 hydroxyproline residues. Appropriately, the cationic domain may contain 1-2 serine residues.

[0091] Appropriately, all cationic amino acids in a given cationic domain may be histidine, or, appropriately, all cationic amino acids in a given cationic domain may be arginine.

[0092] Suitablely, the peptide may comprise at least one histidine-rich cationic domain. Suitablely, the peptide may comprise at least one arginine-rich cationic domain.

[0093] Suitablely, the peptide may comprise at least one arginine-rich cationic domain and at least one histidine-rich cationic domain.

[0094] In one embodiment, the peptide comprises two arginine-rich cationic domains.

[0095] In one embodiment, the peptide comprises two histidine-rich cationic domains.

[0096] In one embodiment, the peptide comprises two cationic domains rich in arginine and histidine.

[0097] In one embodiment, the peptide comprises an arginine-rich cationic domain and a histidine-rich cationic domain.

[0098] Appropriately, each cationic domain contains no more than 3 consecutive arginine residues, and appropriately no more than 2 consecutive arginine residues.

[0099] Appropriately, each cationic domain does not contain consecutive histidine residues.

[0100] Suitablely, each cationic domain contains arginine, histidine, and / or β-alanine residues. Suitablely, each cationic domain contains a majority of arginine, histidine, and / or β-alanine residues. Suitablely, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, and 100% of the amino acid residues in each cationic domain are arginine, histidine, and / or β-alanine residues. Suitablely, each cationic domain is composed of arginine, histidine, and / or β-alanine residues.

[0101] In one embodiment, the peptide comprises a first cationic domain containing arginine and β-alanine residues and a second cationic domain containing arginine and β-alanine residues.

[0102] In one embodiment, the peptide comprises a first cationic domain containing arginine and β-alanine residues and a second cationic domain containing histidine, β-alanine, and optionally arginine residues.

[0103] In one embodiment, the peptide comprises a first cationic domain containing arginine and β-alanine residues and a second cationic domain containing histidine and β-alanine residues.

[0104] In one embodiment, the peptide comprises a first cationic domain consisting of arginine and β-alanine residues and a second cationic domain consisting of arginine and β-alanine residues.

[0105] In one embodiment, the peptide comprises a first cationic domain consisting of arginine and β-alanine residues and a second cationic domain consisting of arginine, histidine, and β-alanine residues.

[0106] Suitably, the peptide comprises at least two cationic domains, and suitably, these cationic domains form arms of the peptide. Suitably, the cationic domains are located at the N and C ends of the peptide. Suitably, therefore, the cationic domains may be referred to as cationic arm domains.

[0107] In one embodiment, the peptide comprises two cationic domains, one located at the N-terminus of the peptide and the other at the C-terminus of the peptide. Suitably, at either end of the peptide. Suitably, no other amino acids or domains are present at the N-terminus and C-terminus of the peptide, except for other groups such as terminal modifications, linkers, and / or therapeutic molecules. For the avoidance of doubt, other groups may be present besides the term "peptide" as described herein and claimed. Suitably, each cationic domain thus forms the terminus of the peptide. Suitably, this does not preclude the presence of other linker groups as described herein.

[0108] Suitable, the peptide may comprise up to four cationic domains. Suitable, the peptide comprises two cationic domains.

[0109] In one embodiment, the peptide comprises two arginine-rich cationic domains.

[0110] In one embodiment, the peptide comprises an arginine-rich cationic domain.

[0111] In one embodiment, the peptide comprises two cationic domains, both rich in arginine and histidine.

[0112] In one embodiment, the peptide comprises an arginine-rich cationic domain and a histidine-rich cationic domain.

[0113] Suitable, the cation domain comprises an amino acid unit selected from the following: R, H, B, RR, HH, BB, RH, HR, RB, BR, HB, BH, RBR, RBB, BRR, BBR, BRB, RBH, RHB, HRB, BRH, HRR, RRH, HRH, HBB, BBH, RHR, BHB, HBH, or any combination thereof.

[0114] Suitablely, the cationic domain may also include serine, proline, and / or hydroxyproline residues. Suitablely, the cationic domain may further comprise an amino acid unit selected from: RP, PR, RPR, RRP, PRR, PRP, Hyp; R[Hyp]R, RR[Hyp], [Hyp]RR, [Hyp]R[Hyp], [Hyp][Hyp]R, R[Hyp][Hyp], SB, BS, or any combination thereof, or any combination with the amino acid units listed above.

[0115] Suitable, each cation domain comprises any one of the following sequences: RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRR (SEQ ID NO:3), RBRRBR (SEQ ID NO:4), RRBRBR (SEQ ID NO:5), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9), RBRHBHR (SEQ ID NO:10), RBRBBHR (SEQ ID NO:11), RBRRBH (SEQ ID NO:12), HBRRBR (SEQ ID NO:13), HBHBH (SEQ ID NO:14), BHBH (SEQ ID NO:15), BRBSB (SEQ ID NO:16), BRB[Hyp]B (SEQ ID NO:17), R[Hyp]H[Hyp]HB (SEQ ID NO:18), R[Hyp]RR[Hyp]R (SEQ ID NO:19) or any combination thereof.

[0116] Suitable, each cation domain consists of any one of the following sequences: RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRR (SEQ ID NO:3), RBRRBR (SEQ ID NO:4), RRBRBR (SEQ ID NO:5), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9), RBRHBHR (SEQ ID NO:10), RBRBBHR (SEQ ID NO:11), RBRRBH (SEQ ID NO:12), HBRRBR (SEQ ID NO:13), HBHBH (SEQ ID NO:14), BHBH (SEQ ID NO:15), BRBSB (SEQ ID NO:16), BRB[Hyp]B, R[Hyp]H[Hyp]HB, R[Hyp]RR[Hyp]R (SEQ ID NO:19) or any combination thereof.

[0117] Appropriately, each cation domain consists of one of the following sequences: RBRBR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRRBR (SEQ ID NO:4), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9).

[0118] Suitablely, each cationic domain in the peptide may be the same or different. Suitablely, each cationic domain in the peptide is different.

[0119] Hydrophobic domain

[0120] The present invention relates to conjugates comprising short peptide carriers having a specific structure, wherein at least one hydrophobic domain having a certain length is present.

[0121] Suitable, the peptide comprises up to three hydrophobic domains and up to two hydrophobic domains.

[0122] Appropriately, the peptide comprises a hydrophobic domain.

[0123] As defined above, the peptide comprises two or more hydrophobic domains, each having a length of at least three amino acid residues.

[0124] Appropriately, each hydrophobic domain has a length of 3-6 amino acids. Appropriately, each hydrophobic domain has a length of 5 amino acids.

[0125] Appropriately, each hydrophobic domain may contain nonpolar, polar, and hydrophobic amino acid residues.

[0126] Hydrophobic amino acid residues can be selected from: alanine, valine, leucine, isoleucine, phenylalanine, tyrosine, methionine, and tryptophan.

[0127] Nonpolar amino acid residues can be selected from: proline, glycine, cysteine, alanine, valine, leucine, isoleucine, tryptophan, phenylalanine, and methionine.

[0128] The polar amino acid residues can be selected from: serine, asparagine, hydroxyproline, histidine, arginine, threonine, tyrosine, and glutamine.

[0129] Appropriately, the hydrophobic domain does not contain hydrophilic amino acid residues.

[0130] Suitablely, each hydrophobic domain contains a majority of hydrophobic amino acid residues. Suitablely, each hydrophobic domain contains at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% hydrophobic amino acids. Suitablely, each hydrophobic domain is composed of hydrophobic amino acid residues.

[0131] Appropriately, the hydrophobicity of each hydrophobic domain is at least 0.3, at least 0.4, at least 0.5, at least 0.6, at least 0.7, at least 0.8, at least 0.8, at least 1.0, at least 1.1, at least 1.2, or at least 1.3.

[0132] Appropriately, the hydrophobicity of each hydrophobic domain is at least 0.3, at least 0.35, at least 0.4, and at least 0.45.

[0133] Appropriately, the hydrophobicity of each hydrophobic domain is at least 1.2, at least 1.25, at least 1.3, and at least 1.35.

[0134] Appropriately, the hydrophobicity of each hydrophobic domain is between 0.4 and 1.4.

[0135] In one implementation, the hydrophobicity of each hydrophobic domain is 0.45 to 0.48.

[0136] In one implementation, the hydrophobicity of each hydrophobic domain is 1.27 to 1.39.

[0137] Appropriately, hydrophobicity was measured by White and Wimley: WC Wimley and SH White, "Experimentally determined hydrophobicity scale for proteins at membrane interfaces" Nature Struct Biol 3:842 (1996).

[0138] Appropriately, each hydrophobic domain contains at least three or at least four hydrophobic amino acid residues.

[0139] Suitablely, each hydrophobic domain comprises phenylalanine, leucine, isoleucine, tyrosine, tryptophan, proline, and glutamine residues. Suitablely, each hydrophobic domain is composed of phenylalanine, leucine, isoleucine, tyrosine, tryptophan, proline, and / or glutamine residues.

[0140] In one embodiment, each hydrophobic domain is composed of phenylalanine, leucine, isoleucine, tyrosine, and / or glutamine residues.

[0141] In one embodiment, each hydrophobic domain is composed of tyrosine and / or proline residues.

[0142] Suitably, the peptide comprises a hydrophobic domain. Suitably, the hydrophobic domain is located at the center of the peptide. Suitably, the hydrophobic domain may therefore be referred to as a core hydrophobic domain. Suitably, the core hydrophobic domain is side-connected to an arm domain on either side. Suitably, the arm domain may comprise one or more cationic domains and one or more other hydrophobic domains. Suitably, each arm domain comprises a cationic domain.

[0143] In one embodiment, the peptide comprises two arm domains that are laterally attached to a hydrophobic core domain, wherein each arm domain comprises a cationic domain.

[0144] In one embodiment, the peptide consists of two cationic arm domains flanked by a hydrophobic core domain.

[0145] Suitable, the hydrophobic domain comprises one of the following sequences: YQFLI (SEQ ID NO:20), FQILY (SEQ ID NO:21), ILFQY (SEQ ID NO:22), FQIY (SEQ ID NO:23), WWW, WWPWW (SEQ ID NO:24), WPWW (SEQ ID NO:25), WWPW (SEQ ID NO:26) or any combination thereof.

[0146] Suitable, the hydrophobic domain is composed of one of the following sequences: YQFLI (SEQ ID NO:20), FQILY (SEQ ID NO:21), ILFQY (SEQ ID NO:22), FQIY (SEQ ID NO:23), WWW, WWPWW (SEQ ID NO:24), WPWW (SEQ ID NO:25), WWPW (SEQ ID NO:26) or any combination thereof.

[0147] Suitable, each of the hydrophobic domains consists of one of the following sequences: FQILY (SEQ ID NO:21), WWW, WWPWW (SEQ ID NO:24).

[0148] Suitablely, each hydrophobic domain is composed of FQILY (SEQ ID NO:21):

[0149] Appropriately, each hydrophobic domain in the peptide may have the same sequence or different sequences.

[0150] peptide carrier

[0151] This invention relates to conjugates containing peptide carriers for the transport of therapeutic nucleic acids formed by trinucleotide repeats in the treatment of medical conditions.

[0152] The peptide sequence is a continuous single molecule, therefore the peptide domains are continuous. Suitably, the peptide includes several domains arranged linearly between the N-terminus and C-terminus. Suitably, the domains are selected from the above-described cationic and hydrophobic domains. Suitably, the peptide consists of cationic and hydrophobic domains, wherein the domains are as defined above.

[0153] Each domain possesses the common sequence characteristics described in the relevant sections above, but the exact sequence of each domain can be varied and modified. Therefore, each domain may have a series of sequences. Combinations of each possible domain sequence produce a series of peptide structures, each peptide structure forming part of this invention. The characteristics of these peptide structures are described below.

[0154] Appropriately, hydrophobic domains separate any two cationic domains. Appropriately, each hydrophobic domain is side-attached to a cationic domain on either side.

[0155] Appropriately, no cation domain is adjacent to another cation domain.

[0156] In one embodiment, the peptide comprises a hydrophobic domain flanked by two cationic domains, arranged as follows:

[0157] [Cat domain]-[Hydrophobic domain]-[Cat domain]

[0158] Therefore, the hydrophobic domain may be referred to as the core domain, and each cationic domain may be referred to as an arm domain. Suitablely, the hydrophobic arm domain is side-attached to a cationic core domain on either side.

[0159] In one embodiment, the peptide consists of two cationic domains and one hydrophobic domain.

[0160] In one embodiment, the peptide consists of a hydrophobic core domain flanked by two cationic arm domains.

[0161] In one embodiment, the peptide comprises a hydrophobic core domain comprising sequences selected from the following: YQFLI (SEQ ID NO:20), FQILY (SEQ ID NO:21), ILFQY (SEQ ID NO:22), FQIY (SEQ ID NO:23), WWW, WWPWW (SEQ ID NO:24), WPWW (SEQ ID NO:25), and WWPW (SEQ ID NO:26), flanked by two cationic arm domains, each cationic arm domain comprising sequences selected from the following: RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRR (SEQ ID NO:3), RBRRBR (SEQ ID NO:4), RRBRBR (SEQ ID NO:5), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8), HBHBR (SEQ ID NO:9), RBRHBHR (SEQ ID NO:10), RBRBBHR (SEQ ID NO:11), RBRRBH (SEQ ID NO:26). NO:12), HBRRBR (SEQ ID NO:13), HBHBH (SEQ ID NO:14), BHBH (SEQ ID NO:15), BRBSB (SEQ ID NO:16), BRB[Hyp]B (SEQ ID NO:17), R[Hyp]H[Hyp]HB (SEQ ID NO:18) and R[Hyp]RR[Hyp]R (SEQ ID NO:18) NO:19).

[0162] In one embodiment, the peptide comprises a hydrophobic core domain consisting of sequences selected from the following: FQILY (SEQ ID NO:21), WWW, and WWPWW (SEQ ID NO:24) flanked by two cationic arm domains, the cationic arm domains comprising sequences selected from the following: RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRRBR (SEQ ID NO:4), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), and RBHBH (SEQ ID NO:8).

[0163] In one embodiment, the peptide comprises a hydrophobic core domain containing the sequence FQILY (SEQ ID NO:21) and two cationic arm domains flanking it, the cationic arm domains comprising sequences selected from the following: RBRRBRR (SEQ ID NO:1), RBRBR (SEQ ID NO:2), RBRBR (SEQ ID NO:4), RBRRB (SEQ ID NO:6), BRBR (SEQ ID NO:7), RBHBH (SEQ ID NO:8).

[0164] In any such implementation, other groups may be present, such as connectors, end modifications, and / or therapeutic molecules.

[0165] Appropriately, the peptide is N-terminally modified.

[0166] Suitably, the peptide is N-acetylated, N-methylated, N-trifluoroacetylated, N-trifluoromethylsulfonylated, or N-methylsulfonylated. Suitably, the peptide is N-acetylated.

[0167] Optionally, the N-terminus of the peptide may be unmodified.

[0168] In one embodiment, the peptide is N-acetylated.

[0169] Suitable, the peptide comprises a C-terminal modification selected from the following: carboxyl-, thioacid-, aminooxy-, hydrazine-, thioester-, azide-, strained alkyne, strained olefin, aldehyde-, thiol or haloacetyl.

[0170] Advantageously, C-terminal or N-terminal modifications can provide a means for linking peptides to therapeutic molecules.

[0171] Therefore, C-terminal or N-terminal modifications may include joints, and vice versa. Appropriately, C-terminal or N-terminal modifications may consist of joints, and vice versa. Suitable joints are described elsewhere in this document.

[0172] Appropriately, the peptide comprises a C-terminal carboxyl group.

[0173] Suitable, the C-terminal carboxyl group is provided by a glycine, β-alanine, glutamic acid, or γ-aminobutyric acid residue.

[0174] In one embodiment, the C-terminal carboxyl group is provided by a β-alanine residue.

[0175] Suitablely, the C-terminal residue is a linker. Suitablely, the C-terminal β-alanine residue is a linker.

[0176] Suitablely, each cationic domain may further comprise an N- or C-terminal modification. Suitablely, the cationic domain comprises a C-terminal modification at its C-terminus. Suitablely, the cationic domain comprises an N-terminal modification at its N-terminus. Suitablely, the cationic domain comprises a linker group at its C-terminus, and suitablely, the cationic domain comprises a C-terminal β-alanine. Suitablely, the cationic domain is N-acetylated at its N-terminus.

[0177] The peptides of the present invention are defined as having a total length of 40 amino acid residues or less. Therefore, the peptides can be considered oligopeptides.

[0178] Suitablely, the total length of the peptide is 3-30 amino acid residues, suitablely 5-25 amino acid residues, 10-25 amino acid residues, 13-23 amino acid residues, or 15-20 amino acid residues.

[0179] Suitable, the total length of the peptide is at least 12, at least 13, at least 14, at least 15, at least 16, or at least 17 amino acid residues.

[0180] Appropriately, the peptide is capable of penetrating cells. Appropriately, the peptide can be considered a cell-penetrating peptide.

[0181] Suitablely, the peptide is used to attach to a therapeutic molecule. Suitablely, the peptide is used to transport a therapeutic molecule into a target cell. Suitablely, the peptide is used to deliver a therapeutic molecule into a target cell. Therefore, the peptide is considered a peptide carrier.

[0182] Appropriately, the peptide carrier can penetrate into cells and tissues, appropriately into the cell nucleus, and appropriately into muscle tissue.

[0183] Suitable, the peptide carrier may be selected from any of the following sequences:

[0184] RBRRBRRFQILYRBRBR(SEQ ID NO:27)

[0185] RBRRBRRFQILYRBRR(SEQ ID NO:28)

[0186] RBRRBRFQILYRRBRBR(SEQ ID NO:29)

[0187] RBRBRFQILYRBRRBRR(SEQ ID NO:30)

[0188] RBRRBRRYQFLIRBRBR(SEQ ID NO:31)

[0189] RBRRBRRILFQYRBRBR(SEQ ID NO:32)

[0190] RBRRBRFQILYRBRBR(SEQ ID NO:33)

[0191] RBRRBFQILYRBRRBR(SEQ ID NO:34)

[0192] RBRRBRFQILYBRBR(SEQ ID NO:35)

[0193] RBRRBFQILYRBRBR(SEQ ID NO:36)

[0194] RBRRBRRFQILYRBHBH(SEQ ID NO:37)

[0195] RBRRBRRFQILYHBHBR(SEQ ID NO:38)

[0196] RBRRBRRFQILYHBRBH(SEQ ID NO:39)

[0197] RBRRBRRYQFLIRBHBH(SEQ ID NO:40)

[0198] RBRRBRRILFQYRBHBH(SEQ ID NO:41)

[0199] RBRHBHRFQILYRBRBR(SEQ ID NO:42)

[0200] RBRBBHRFQILYRBHBH(SEQ ID NO:43)

[0201] RBRRBRFQILYRBHBH(SEQ ID NO:44)

[0202] RBRRBRFQILYHBHBH(SEQ ID NO:45)

[0203] RBRRBHFQILYRBHBH(SEQ ID NO:46)

[0204] HBRRBRFQILYRBHBH(SEQ ID NO:47)

[0205] RBRRBFQILYRBHBH(SEQ ID NO:48)

[0206] RBRRBRFQILYBHBH(SEQ ID NO:49)

[0207] RBRRBRYQFLIHBHBH(SEQ ID NO:50)

[0208] RBRRBRILFQYHBHBH(SEQ ID NO:51)

[0209] RBRRBRRFQILYHBHBH(SEQ ID NO:52)

[0210] Suitable, the peptide may be selected from any of the following additional sequences:

[0211] RBRRBRFQILYBRBS (SEQ ID NO:53)

[0212] RBRRBRFQILYBRB[Hyp](SEQ ID NO:54)

[0213] RBRRBRFQILYBR[Hyp]R(SEQ ID NO:55)

[0214] RRBRRBRFQILYBRBR(SEQ ID NO:56)

[0215] BRRBRRFQILYBRBR(SEQ ID NO:57)

[0216] RBRRBRWWWBRBR(SEQ ID NO:58)

[0217] RBRRBRWWPWWBRBR(SEQ ID NO:59)

[0218] RBRRBRWPWWBRBR(SEQ ID NO:60)

[0219] RBRRBRWWPWBRBR(SEQ ID NO:61)

[0220] RBRRBRRWWWRBRBR(SEQ ID NO:62)

[0221] RBRRBRRWWPWWRBRBR(SEQ ID NO:63)

[0222] RBRRBRRWPWWRBRBR(SEQ ID NO:64)

[0223] RBRRBRRWWPWRBRBR(SEQ ID NO:65)

[0224] RBRRBRRFQILYBRBR(SEQ ID NO:66)

[0225] RBRRBRRFQILYRBR(SEQ ID NO:67)

[0226] BRBRBWWPWWRBRRBR(SEQ ID NO:68)

[0227] RBRRBRRFQILYBHBH(SEQ ID NO:69)

[0228] RBRRBRRFQIYRBHBH(SEQ ID NO:70)

[0229] RBRRBRFQILYBRBH(SEQ ID NO:71)

[0230] RBRRBRFQILYR[Hyp]H[Hyp]H(SEQ ID NO:72)

[0231] R[Hyp]RR[Hyp]RFQILYRBHBH(SEQ ID NO:73)

[0232] R[Hyp]RR[Hyp]RFQILYR[Hyp]H[Hyp]H(SEQ ID NO:74)

[0233] RBRRBRWWWRBHBH(SEQ ID NO:75)

[0234] RBRRBRWWPRBHBH(SEQ ID NO:76)

[0235] RBRRBRPWWRBHBH(SEQ ID NO:77)

[0236] RBRRBRWWPWWRBHBH(SEQ ID NO:78)

[0237] RBRRBRWWPWRBHBH(SEQ ID NO:79)

[0238] RBRRBRWPWWRBHBH(SEQ ID NO:80)

[0239] RBRRBRRWWWRBHBH(SEQ ID NO:81)

[0240] RBRRBRRWWPWWRBHBH(SEQ ID NO:82)

[0241] RBRRBRRWPWWRBHBH(SEQ ID NO:83)

[0242] RBRRBRRWWPWRBHBH(SEQ ID NO:84)

[0243] RRBRRBRFQILYRBHBH(SEQ ID NO:85)

[0244] BRRBRRFQILYRBHBH(SEQ ID NO:86)

[0245] RRBRRBRFQILYBHBH(SEQ ID NO:87)

[0246] BRRBRRFQILYBHBH (SEQ ID NO:88)

[0247] RBRRBHRFQILYRBHBH(SEQ ID NO:89)

[0248] RBRRBRFQILY[Hyp]R[Hyp]R(SEQ ID NO:90)

[0249] R[Hyp]RR[Hyp]RFQILYBRBR(SEQ ID NO:91)

[0250] R[Hyp]RR[Hyp]RFQILY[Hyp]R[Hyp]R(SEQ ID NO:92)

[0251] RBRRBRWWWBRBR(SEQ ID NO:93)

[0252] RBRRBRWWPWWBRBR(SEQ ID NO:94)

[0253] Suitable, the peptide consists of one of the following sequences:

[0254] RBRRBRRFQILYRBRBR(SEQ ID NO:27)

[0255] RBRRBRRYQFLIRBRBR(SEQ ID NO:31)

[0256] RBRRBRRILFQYRBRBR(SEQ ID NO:32)

[0257] RBRRBRFQILYBRBR(SEQ ID NO:35)

[0258] RBRRBRRFQILYRBHBH(SEQ ID NO:37)

[0259] RBRRBRRFQILYHBHBR(SEQ ID NO:38)

[0260] RBRRBRFQILYRBHBH(SEQ ID NO:44)

[0261] In one embodiment, the peptide consists of the following sequence: RBRRBRFQILYBRBR (SEQ ID NO:35).

[0262] In one embodiment, the peptide consists of the following sequence: RBRRBRRFQILYRBHBH (SEQ ID NO:37).

[0263] In one embodiment, the peptide consists of the following sequence: RBRRBRFQILYRBHBH (SEQ ID NO:44).

[0264] Therapeutic molecules

[0265] The peptide carrier is covalently linked to a therapeutic molecule to provide the conjugate of the present invention, wherein the therapeutic molecule is a nucleic acid comprising a plurality of trinucleotide repeats.

[0266] Suitable, the nucleic acid may be selected from: antisense oligonucleotides (e.g., PNA, PMO), mRNA, gRNA (e.g., when using CRISPR / Cas9 technology), short interfering RNA, microRNA, and antagomiRNA.

[0267] Appropriately, the nucleic acid is an antisense oligonucleotide.

[0268] Suitable of the antisense oligonucleotide, the antisense oligonucleotide is phosphoryldiamine morpholino oligonucleotide (PMO).

[0269] Alternatively, the antisense oligonucleotide may be a modified PMO or any other charge-neutral antisense oligonucleotide, such as peptide nucleic acid (PNA), chemically modified PNA such as γ-PNA (Bahal, Nat. Comm. 2016), oligonucleotide aminophosphate (where the non-bridging oxygen of the phosphate group is replaced by an amine or alkylamine) as described in WO2016028187A1, or any other partially or completely charge-neutral oligonucleotide.

[0270] Appropriately, the nucleic acid is composed of multiple trinucleotide repeats.

[0271] Suitably, the nucleic acid comprises any trinucleotide repeat. Suitably, the nucleic acid comprises trinucleotide repeats selected from the following: GTC, CAG, GCC, GGC, CTT, and CCG repeats. Suitably, the nucleic acid consists of trinucleotide repeats selected from the following: GTC, CAG, GCC, GGC, CTT, and CCG repeats.

[0272] Suitablely, the nucleic acid comprises CAG repeats. Suitablely, the nucleic acid is composed of CAG repeats.

[0273] In one embodiment, the nucleic acid is an antisense oligonucleotide comprising CAG repeats. In another embodiment, the nucleic acid is an antisense oligonucleotide composed of CAG repeats.

[0274] Suitably, the nucleic acid comprises or consists of multiple trinucleotide repeats. Suitably, the nucleic acid comprises at least two trinucleotide repeats. Suitably, the nucleic acid comprises 5-50 trinucleotide repeats. Suitably, the nucleic acid comprises 5-40 trinucleotide repeats. Suitably, the nucleic acid comprises 5-30 trinucleotide repeats. Suitably, the nucleic acid comprises 5-20 trinucleotide repeats. Suitably, the nucleic acid comprises 5-10 trinucleotide repeats. Suitably, the nucleic acid comprises seven trinucleotide repeats.

[0275] In one embodiment, the nucleic acid is an antisense oligonucleotide comprising 7 CAG repeats. In another embodiment, the nucleic acid is an antisense oligonucleotide composed of 7 CAG repeats. Suitably, in such an embodiment, the nucleic acid is an antisense oligonucleotide composed of [CAG]7.

[0276] Appropriately, the nucleic acid is complementary to the microsatellite region, appropriately complementary to the repeat amplification, and appropriately complementary to the trinucleotide repeat amplification.

[0277] Suitablely, the nucleic acid targets and binds to the microsatellite region. Suitablely, the microsatellite region contains repeat extensions, and suitablely, they contain trinucleotide repeat extensions.

[0278] In some implementations, repeat expansion may include higher repeat expansions, such as four, five, six, seven, eight, nine, or ten repeat expansions, each of which contains four, five, six, seven, eight, nine, or ten nucleotides, respectively.

[0279] Therefore, in some embodiments, the therapeutic molecule is a nucleic acid comprising multiple tetra-, penta-, hexa-, hepta-, octa-, ni-, or deca-nucleotide repeats.

[0280] Any statements in this article concerning nucleic acids containing trinucleotide repeats also apply to nucleic acids containing higher nucleotide repeats.

[0281] Appropriately, the nucleic acid binds to a complementary microsatellite region, appropriately, binds to a complementary repeat amplification region, and appropriately, binds to a complementary trinucleotide repeat amplification region.

[0282] Suitablely, the microsatellite regions are present in DNA or RNA. Suitablely, the microsatellite regions are present in RNA.

[0283] Suitablely, the microsatellite region may exist in either a coded or non-coded sequence. Suitablely, the microsatellite region exists in a non-coded sequence, such as a 3' or 5' UTR. Suitablely, the microsatellite region exists in a 3' UTR.

[0284] Appropriately, the nucleic acid may be formed from a trinucleotide repeat that binds to the amplification of a complementary trinucleotide repeat.

[0285] Appropriately, the nucleic acid may be formed from a trinucleotide repeat that amplifies and binds to a complementary trinucleotide repeat in RNA.

[0286] Appropriately, the nucleic acid may be formed from a trinucleotide repeat amplified and bound to a complementary trinucleotide repeat in a non-coding sequence of RNA.

[0287] Appropriately, the nucleic acid may be formed from a trinucleotide repeat that amplifies and binds to a complementary trinucleotide repeat in the untranslated region of RNA.

[0288] In one embodiment, the nucleic acid may be formed from a trinucleotide repeat amplified and bound to a complementary trinucleotide repeat in the 3'UTR of RNA.

[0289] Optionally, lysine residues may be added to one or both ends of the nucleic acid (e.g., PMO or PNA) before attachment to the peptide carrier to improve water solubility.

[0290] Trinucleotide duplication syndrome

[0291] The conjugates of the present invention are used as medicines, preferably for the prevention or treatment of trinucleotide duplication disorders.

[0292] In a proper sense, trinucleotide duplication syndrome is a genetic disorder caused by trinucleotide duplication amplification (also known as triplet duplication amplification).

[0293] Suitablely, the trinucleotide repeat amplification is present in the gene. Suitablely, the trinucleotide repeat amplification is present in genes selected from: ATN1, HTT, AR, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, TBP, FMR1, AFF2, FXN, DMPK, SCA8, JPH3, and PPP2R2B.

[0294] Appropriately, the trinucleotide repeat amplification is present in the AR, SCA8, or DMPK genes.

[0295] In one embodiment, the trinucleotide repeat amplification is present in the DMPK gene.

[0296] Suitable, the trinucleotide repeat amplification consists of repeats selected from the following: CAG, CTG, CGG, CCG, GAA, TTC, and GGC.

[0297] Appropriately, the trinucleotide repeat amplification consists of CAG or CTG repeats.

[0298] In one embodiment, the trinucleotide repeat amplification is composed of CTG repeats.

[0299] Trinucleotide duplication disorders are typically caused by the amplification of a specific trinucleotide repeat found in a particular gene. Typically, the number of trinucleotide repeats present in the gene is higher than the number present in the same gene in normal healthy individuals.

[0300] Suitable, the trinucleotide repeat amplification is a CAG repeat selected from the following genes: ATN1, HTT, AR, ATXN1, ATXN, ATXN3, CACNA1A, ATXN7, JPH3, and TBP.

[0301] Appropriately, trinucleotide repeat disorders caused by CAG repeats are referred to as "polyglutamine disorders." Therefore, appropriately, the trinucleotide repeat disorders can be polyglutamine disorders. Appropriately, the polyglutamine disorders can be selected from: DRPLA (Dentate nucleus-globus pallidus Lewy body atrophy), HD (Huntington's disease), HDL2 (Huntington-like syndrome 2), SBMA (Spinal medullary muscular atrophy), SCA1 (Spinocerebellar ataxia type 1), SCA2 (Spinocerebellar ataxia type 2), SCA3 (Spinocerebellar ataxia type 3 or Machado-Jospeh disease), SCA6 (Spinocerebellar ataxia type 6), SCA7 (Spinocerebellar ataxia type 7), and SCA17 (Spinocerebellar ataxia type 17).

[0302] Appropriately, the trinucleotide repeat amplification is a CGG repeat selected from the following gene: FMR1.

[0303] Appropriately, the trinucleotide repeat amplification is a CCG repeat selected from the gene AFF2.

[0304] Appropriately, the trinucleotide repeat amplification is a GAA repeat selected from the gene of FXN.

[0305] Appropriately, the trinucleotide repeat amplification is a CTG repeat selected from the genes of DMPK and ATXN8.

[0306] Appropriately, the trinucleotide repeat amplification is a GTC repeat selected from the JPH3 gene.

[0307] Appropriately, trinucleotide repeat disorders caused by trinucleotide repeats other than CAG repeats are termed "non-polyglutamine disorders." Therefore, appropriately, the trinucleotide repeat disorders can be non-polyglutamine disorders. Appropriately, the non-polyglutamine disorders can be selected from: HDL2 (Huntington's disease-like syndrome 2), FRAXA (Fragile X syndrome), FXTAS (Fragile X-related tremor / ataxia syndrome), FRAXE (Fragile XE intellectual disability), FRDA (Friedrich's ataxia), DM1 (Myotonic dystrophy type 1), SCA8 (Spinocerebellar ataxia type 8), and SCA12 (Spinocerebellar ataxia type 12).

[0308] Appropriately, the trinucleotide duplication disorder is due to an increase in the number of trinucleotide repeats compared to healthy subjects. Appropriately, the number of trinucleotide repeats in the gene is increased compared to the same gene in healthy subjects. Appropriately, the number of trinucleotide repeats in trinucleotide repeat amplification is increased compared to the number of trinucleotide repeats in normal healthy subjects.

[0309] Appropriately, the number of repeats in the trinucleotide repeat amplification is at least 1.5 times the number of repeats in normal healthy subjects. Appropriately, the number of repeats in the trinucleotide repeat amplification is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 times the number of repeats in normal healthy subjects.

[0310] Appropriately, trinucleotide duplication syndrome is caused by an increase in the number of duplications in trinucleotide duplication amplification by at least 1.5 times compared to the number of duplications in normal healthy subjects.

[0311] Appropriately, trinucleotide duplication syndrome is caused by an increase in the number of duplications in trinucleotide duplication amplification by at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 times compared to the number of duplications in normal healthy subjects.

[0312] Appropriately, the number of repeats in trinucleotide repeat amplification is 1.5 to 15 times that in normal healthy subjects.

[0313] Appropriately, trinucleotide duplication syndrome is caused by the number of duplications amplified by trinucleotide duplications being 1.5 to 15 times greater than the number of duplications present in normal healthy subjects.

[0314] Appropriately, the number of repeats in the trinucleotide amplification is greater than 50, greater than 75, greater than 100, greater than 125, greater than 150, greater than 175, greater than 200, greater than 225, or greater than 250.

[0315] Appropriately, trinucleotide repeat syndrome is caused by the amplification of trinucleotide repeats containing more than 50, 75, 100, 125, 150, 175, 200, 225, or 250 repeats.

[0316] Appropriately, the number of repeats in trinucleotide amplification is greater than 50.

[0317] Appropriately, trinucleotide repeat syndrome is caused by the amplification of trinucleotide repeats containing more than 50 repeats.

[0318] Appropriately, the number of repeats in trinucleotide amplification is between 50 and 250.

[0319] Appropriately, trinucleotide repeat syndrome is caused by the amplification of trinucleotide repeats containing 50 to 250 repeats.

[0320] Appropriately, the trinucleotide repeat syndrome is a non-polyglutamine syndrome.

[0321] Appropriately, the trinucleotide repeat syndrome is DM1 or SCA8.

[0322] In one implementation, the trinucleotide syndrome is DM1.

[0323] In one embodiment, when the trinucleotide duplication syndrome is DM1, the number of repeats in the trinucleotide amplification is greater than 50. In one embodiment, when the trinucleotide duplication syndrome is DM1, the number of CTG repeats in the trinucleotide amplification is greater than 50. In one embodiment, when the trinucleotide duplication syndrome is DM1, the number of CTG repeats in the trinucleotide amplification of the DMPK gene is greater than 50.

[0324] In one embodiment, when the trinucleotide repeat syndrome is SCA8, the number of repeats in the trinucleotide amplification is 110 to 250. In one embodiment, when the trinucleotide repeat syndrome is SCA8, the number of CTG repeats in the trinucleotide amplification is 110 to 250. In one embodiment, when the trinucleotide repeat syndrome is SCA8, the number of CTG repeats in the trinucleotide amplification of the ATXN8 gene is 110 to 250.

[0325] In some embodiments, the conjugates of the present invention are used as medicines, preferably for the prevention or treatment of nucleotide duplication disorders.

[0326] Appropriately, nucleotide duplication syndrome is a genetic disorder caused by nucleotide duplication amplification (also known as duplication amplification or microsatellite duplication amplification).

[0327] Appropriately, the nucleotide duplication syndrome may be caused by the repeated amplification of four, five, six, seven, eight, nine, or ten nucleotides.

[0328] Suitable, the nucleotide repeat amplification can be a higher repeat amplification as discussed above, such as tetranucleotide, pentanucleotide, hexanucleotide, septumnucleotide, octanucleotide, nitrophus, or decanucleotide repeat amplification.

[0329] Therefore, the conjugates of the present invention are suitably used as medicines, preferably for the prevention or treatment of diseases involving tetranucleotide repeats (tetrapoe, quinone, hexanucleotide, septone, octone, quinone, or decanucleotide repeats).

[0330] Suitablely, the nucleotide repeat amplification is a tetranucleotide repeat, and suitably, the tetranucleotide repeat is a CCTG repeat.

[0331] Therefore, the conjugates of the present invention are suitably used as medicines, preferably for the prevention or treatment of DM2 (myotonic dystrophy type 2).

[0332] Suitablely, the nucleotide repeat amplification is a pentanucleotide repeat, and suitably, the pentanucleotide repeat is an ATTCT repeat.

[0333] Therefore, the conjugates of the present invention are suitably used as medicines, preferably for the prevention or treatment of SCA10 (spinocerebellar ataxia type 10).

[0334] Therefore, the conjugates of the present invention are suitably used as medicines, preferably for the prevention or treatment of SCA31 (spinocerebellar ataxia type 31).

[0335] Suitablely, the nucleotide repeat amplification is a hexanucleotide repeat, and suitablely, the hexanucleotide repeat is a GGCCTG repeat or a GGGGCC repeat.

[0336] Therefore, the conjugates of the present invention are suitably used as medicines, preferably for the prevention or treatment of SCA36 (spinocerebellar ataxia type 36).

[0337] Therefore, the conjugates of the present invention are suitably used as medicines, preferably for the prevention or treatment of C9ORF72-ALS (amyotrophic lateral sclerosis).

[0338] Any statements in this article relating to the treatment of trinucleotide repeat syndromes also apply to the treatment of higher nucleotide repeat syndromes, such as tetranucleotide, pentanucleotide, hexanucleotide, septalnucleotide, octalnucleotide, or decanucleotide repeat syndromes.

[0339] covalent connection

[0340] In this invention, the peptide carrier present in the conjugate is covalently linked to the therapeutic molecule.

[0341] Suitablely, the peptide carrier is covalently linked to the therapeutic molecule at its C-terminus or N-terminus. Suitablely, the peptide carrier is covalently linked to the therapeutic molecule at its C-terminus.

[0342] Appropriately, if desired, the peptide carrier is covalently linked to the therapeutic molecule via a linker. The linker can act as a spacer to separate the peptide sequence from the therapeutic molecule.

[0343] The connector can be selected from any suitable sequence.

[0344] Suitablely, the linker is present between the peptide and the therapeutic molecule. Suitablely, the linker is a spacer group between the peptide and the therapeutic molecule. Therefore, the linker may contain artificial amino acids.

[0345] In one embodiment, the conjugate comprises a peptide carrier covalently linked to a therapeutic molecule via a linker.

[0346] In one embodiment, the conjugate comprises the following structure:

[0347] [Peptide]-[Connector]-[Therapeutic Molecule]

[0348] In one embodiment, the conjugate comprises the following structure:

[0349] [Peptide]-[Connector]-[Therapeutic Molecule]

[0350] Suitablely, any peptide listed herein may be used in conjugates according to the invention. In one embodiment, the conjugate comprises a peptide carrier selected from one of the following sequences: RBRRBRFQILYBRBR (SEQ ID NO:35), RBRRBRFQILYRBHBH (SEQ ID NO:37), and RBRRBRFQILYRBHBH (SEQ ID NO:44).

[0351] Suitablely, in any case, the peptide carrier may further comprise the N-terminal modification as described above.

[0352] Suitable linkers include, for example, C-terminal cysteine ​​residues that can form disulfides, thioethers, or thiols-maleimides; C-terminal aldehydes to form oximes, which can undergo click reactions with basic amino acids or carboxylic acid moieties on the peptide or form morpholino linkages, wherein the peptide is covalently linked to an amino group to form a carboxamide linkage.

[0353] Suitablely, the length of the linker is 1-5 amino acids. Suitablely, the linker may include any linker known in the art.

[0354] Suitablely, the linker is selected from any of the following sequences: G, BC, XC, C, GGC, BBC, BXC, XBC, X, XX, B, BB, BX, XB, succinic acid, GABA, and E. Suitablely, X is 6-aminohexanoic acid.

[0355] Suitable of use, the connector may be a polymer, such as PEG.

[0356] Suitablely, the linker is selected from β-alanine (B), succinic acid (Succ), GABA (Ab), and glutamic acid (E).

[0357] In one embodiment, the linker is β-alanine (B).

[0358] In one embodiment, the peptide carrier is conjugated to a therapeutic molecule via a formamide bond.

[0359] The linker of the conjugate can form part of the therapeutic molecule to which the peptide is attached. Alternatively, the therapeutic molecule can be directly attached to the C-terminus or N-terminus of the peptide carrier. Suitablely, in such embodiments, a linker is not required.

[0360] Alternatively, the peptide carrier can be chemically conjugated to a therapeutic molecule. The chemical link can be, for example, a disulfide, alkenyl, alkynyl, aryl, ether, thioether, triazole, amide, carboxamide, urea, thiourea, aminourea, carbazide, hydrazine, oxime, phosphate ester, aminophosphate ester, thiophosphate ester, boron phosphate ester, iminophosphate ester, or thiol-maleimide linker.

[0361] Optionally, a cysteine ​​residue may be added to the N-terminus of the therapeutic molecule to allow disulfide bond formation with the peptide carrier, or the N-terminus may be brominated to conjugate a thioether to the peptide carrier.

[0362] In one embodiment, the conjugate comprises a peptide carrier selected from one of the following sequences: RBRRBRFQILYBRBR (SEQ ID NO:35), RBRRBRFQILYRBHBH (SEQ ID NO:37), and RBRRBRFQILYRBHBH (SEQ ID NO:44), which is covalently linked to an antisense oligonucleotide containing a CAG repeat via a linker, wherein the linker is selected from β-alanine (B), GABA (Ab), and glutamic acid (E).

[0363] In one embodiment, the conjugate comprises a peptide carrier selected from one of the following sequences: RBRRBRFQILYBRBR (SEQ ID NO:35), RBRRBRFQILYRBHBH (SEQ ID NO:37), and RBRRBRFQILYRBHBH (SEQ ID NO:44), which is covalently linked to an antisense oligonucleotide composed of CAG repeats via a linker, wherein the linker is selected from β-alanine (B), GABA (Ab), and glutamic acid (E).

[0364] In one embodiment, the conjugate comprises a peptide carrier selected from one of the following sequences: RBRRBRFQILYBRBR (SEQ ID NO:35), RBRRBRFQILYRBHBH (SEQ ID NO:37), and RBRRBRFQILYRBHBH (SEQ ID NO:44), which is covalently linked to an antisense oligonucleotide consisting of seven CAG repeats via a linker, wherein the linker is selected from β-alanine (B), GABA (Ab), and glutamic acid (E).

[0365] In one embodiment, the conjugate comprises a peptide carrier RBRRBRFQILYBRBR (SEQ ID NO: 35), which is covalently linked via β-alanine (B) to an antisense oligonucleotide consisting of seven CAG repeats.

[0366] (DPEP1.9)

[0367] In one embodiment, the conjugate comprises the peptide carrier RBRRBRFQILYBRBR (SEQ ID NO:35), which is covalently linked via glutamate (E) to an antisense oligonucleotide consisting of seven CAG repeats. (DPEP1.9b) In one embodiment, this conjugate increases penetration into the diaphragmatic tissue. Appropriately, increased penetration into the diaphragm can be used to treat muscular disorders affecting the respiratory system, such as ankylosing spondylitis.

[0368] In one embodiment, the conjugate comprises a peptide carrier RBRRBRRFQILYRBHBH (SEQ ID NO:37), which is covalently linked via β-alanine (B) to an antisense oligonucleotide consisting of seven CAG repeats. (DPEP3.1) In one embodiment, this conjugate increases penetration into muscle tissue. Appropriately, increased penetration into muscle can be used to treat muscle disorders.

[0369] In one embodiment, the conjugate comprises a peptide carrier RBRRBRRFQILYRBHBH (SEQ ID NO:37), which is covalently linked via glutamate (E) to an antisense oligonucleotide consisting of seven CAG repeats. (DPEP3.1b) In one embodiment, this conjugate increases penetration into muscle tissue. Appropriately, increased penetration into muscle can be used to treat muscle disorders.

[0370] In one embodiment, the conjugate comprises a peptide carrier RBRRBRRFQILYRBHBH (SEQ ID NO:37), which is covalently linked to an antisense oligonucleotide consisting of seven CAG repeats via GABA(Ab). (DPEP3.1a)

[0371] In one embodiment, the conjugate comprises a peptide carrier RBRRBRFQILYRBHBH (SEQ ID NO:44), which is covalently linked via β-alanine (B) to an antisense oligonucleotide consisting of seven CAG repeats. (DPEP3.8) In one embodiment, this conjugate increases penetration into muscle tissue. Appropriately, increased penetration into muscle can be used to treat muscle disorders.

[0372] In one embodiment, the conjugate comprises the peptide carrier RBRRBRFQILYRBHBH (SEQ ID NO:44), which is covalently linked via glutamate (E) to an antisense oligonucleotide consisting of seven CAG repeats. (DPEP.3.8b) In one embodiment, this conjugate increases permeability into diaphragmatic tissue. Appropriately, increased permeability into the diaphragm can be used to treat muscular disorders affecting the respiratory system, such as ankylosing spondylitis.

[0373] Any of the above conjugates can be acetylated at the N-terminus.

[0374] Pharmaceutical composition and administration

[0375] The conjugates of the present invention can be formulated into pharmaceutical compositions as described above.

[0376] According to a sixth aspect of the invention, the pharmaceutical composition comprises the conjugate of the invention.

[0377] Suitable, the pharmaceutical composition may also contain one or more pharmaceutically acceptable components, such as one or more diluents, adjuvants, or carriers.

[0378] Appropriate pharmaceutically acceptable diluents, adjuvants, and carriers are well known in the art.

[0379] As used herein, the phrase “pharmaceutically acceptable” means that ligands, materials, formulations, and / or dosage forms are suitable for contact with human and animal tissues, within reasonable medical judgment, without excessive toxicity, irritation, allergic reactions, or other problems or complications, and that meet a reasonable benefit / risk ratio.

[0380] As used herein, the phrase "pharmaceutically acceptable carrier" refers to a pharmaceutically acceptable material, formulation, or medium, such as a liquid or solid filler, diluent, excipient, solvent, or encapsulation material, relating to carrying or transporting the conjugate from one organ or site of the body to another. Each peptide must be "acceptable" and harmless to the individual in the sense of compatibility with other components of the composition, such as peptides and therapeutic molecules.

[0381] Reconstructable and applicable lyophilized compositions are also within the scope of the compositions of this invention.

[0382] Pharmaceutically acceptable carriers can be, for example, excipients, mediators, diluents, and combinations thereof. For instance, when the compositions are administered orally, they can be formulated as tablets, capsules, granules, powders, or syrups; or for parenteral administration, they can be formulated as injections, infusions, or suppositories. These compositions can be prepared by conventional methods, and if desired, the active compound (i.e., the conjugate) can be mixed with any conventional additives, such as excipients, binders, disintegrants, lubricants, flavoring agents, solubilizers, suspending agents, emulsifiers, coating agents, or combinations thereof.

[0383] It should be understood that the pharmaceutical compositions disclosed herein may further include other known therapeutic agents, drugs, compounds modified into prodrugs, etc., for use in medical purposes to alleviate, regulate, prevent and treat the diseases, symptoms and conditions described herein.

[0384] Suitablely, the pharmaceutical composition is used as a medicine. Suitablely, it is used as a medicine in the same manner as the conjugates described herein. All characteristics described herein relating to medical treatment using the conjugates are applicable to the pharmaceutical composition.

[0385] Therefore, in another aspect of the invention, a pharmaceutical composition according to the sixth aspect is provided for use as a medicament. In another aspect, a method for preventing or treating a disease condition in a subject is provided, comprising administering an effective amount of the pharmaceutical composition according to the sixth aspect to the subject.

[0386] Suitablely, the pharmaceutical composition is used for the prevention or treatment of trinucleotide disorders, and suitablely, the prevention or treatment method is for the trinucleotide disorder of the subject.

[0387] Prevention or treatment

[0388] The conjugates of the present invention can be used as drugs for the prevention or treatment of diseases, preferably trinucleotide repeat diseases.

[0389] The drug may be in the form of a pharmaceutical composition as defined above.

[0390] A method for preventing or treating a subject with a disease condition requiring treatment is also provided, the method comprising the step of administering a therapeutically effective amount of the conjugate to the subject.

[0391] Appropriately, the conjugate is used for the prevention or treatment of trinucleotide duplication disorders.

[0392] Details of the appropriate genes containing trinucleotide repeat amplification and the resulting trinucleotide repeat disorders are described above.

[0393] Alternatively, the conjugate can be used to prevent or treat other nucleotide duplication disorders. The appropriate details of such higher duplication amplifications and the resulting nucleotide duplication disorders are described above.

[0394] The specific mechanisms by which nucleic acids formed from trinucleotide repeats act to treat trinucleotide repeat disorders will vary depending on the specific trinucleotide repeat disorder being discussed. Suitablely, the nucleic acid binds to trinucleotide repeat amplifications in genes or transcripts. Suitablely, the nucleic acid reduces the level of transcripts containing trinucleotide repeat amplifications. Suitablely, the nucleic acid can prevent the pathological effects of trinucleotide repeat amplifications, thereby preventing trinucleotide repeat disorders. This also applies to other nucleotide repeat disorders.

[0395] Therefore, the conjugate improves the physiological condition of the subject.

[0396] For example, the therapeutic nucleic acid of the conjugate may be operable to correct splicing defects caused by trinucleotide duplication syndrome. Suitablely, the therapeutic nucleic acid of the conjugate may be operable to normalize splicing in subjects suffering from trinucleotide duplication syndrome.

[0397] Suitably, the therapeutic nucleic acid of the conjugate is operable to bind to the transcript of the DMPK gene. Suitably, the therapeutic nucleic acid of the conjugate is operable to bind to repeat amplifications present in the DMPK gene transcript. Suitably, the therapeutic nucleic acid of the conjugate is operable to bind to CUG repeat amplifications present in the DMPK gene transcript.

[0398] Therefore, appropriately, the conjugate reduces the level of DMPK transcripts. Therefore, appropriately, the conjugate reduces the level of DMPK transcripts with repeat amplification. Therefore, appropriately, the conjugate reduces the level of DMPK transcripts with CUG repeat amplification.

[0399] Therefore, suitably, the conjugate reduces the number of nuclear aggregation sites. Suitably, the conjugate prevents nuclear aggregation sites from interacting with the cell's splicing mechanisms. Suitably, the conjugate prevents nuclear aggregation sites from interacting with MBNL1. Suitably, the conjugate prevents nuclear aggregation sites from isolating MBNL1.

[0400] Appropriately, these effects are used to prevent or treat DM1.

[0401] Suitablely, compared with healthy subjects, the conjugate can reduce myotonia in subjects with DM1 by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, or 100%. Suitablely, the conjugate reduces myotonia in subjects with DM1 by at least 50%. Suitablely, the conjugate reduces myotonia in subjects with DM1 by 50%–100%.

[0402] Suitably, the conjugate reduces nuclear aggregation sites in myoblasts of subjects with DM1 by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, or 90%. Suitably, the conjugate reduces nuclear aggregation sites in myoblasts of subjects with DM1 by at least 50%. Suitably, the conjugate reduces nuclear aggregation sites in myoblasts of subjects with DM1 by 50%–90%.

[0403] Suitablely, the conjugate corrected cardiac conduction in subjects with DM1 by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50%. Suitablely, the conjugate improved cardiac conduction in subjects with DM1 by at least 10%. Suitablely, the conjugate improved cardiac conduction in subjects with DM1 by 10%–50%.

[0404] Suitablely, the conjugate improved motor function in subjects with DM1 by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, and 50%. Suitablely, the conjugate improved motor function in subjects with DM1 by at least 10%. Suitablely, the conjugate improved motor function in subjects with DM1 by 10%–50%.

[0405] Suitably, the conjugate improved muscle strength relative to body weight in subjects with DM1 by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, and 50%. Suitably, the conjugate improved muscle strength relative to body weight in subjects with DM1 by at least 10%. Suitably, the conjugate improved muscle strength relative to body weight in subjects with DM1 by 10%–50%.

[0406] Appropriately, the subject to be treated can be any animal or human. Appropriately, the subject can be a non-human mammal. Appropriately, the subject can be male or female.

[0407] Appropriately, the subject to be treated can be of any age. Appropriately, the age of the subject to be treated is 0-40 years, appropriately 0-30 years, appropriately 0-25 years, or appropriately 0-20 years.

[0408] Suitable, the conjugate is used for systemic administration to a subject, for example, via intramedullary, intrasheath, intravenous, intravitreal, enteric, parenteral, intravenous, intraarterial, intramuscular, intratumoral, subcutaneous, oral, or nasal routes.

[0409] In one embodiment, the conjugate is administered intravenously to a subject.

[0410] In one embodiment, the conjugate is used to administer to a subject via intravenous injection.

[0411] Appropriately, the conjugate is administered to the subject in a “therapeuticly effective amount,” which means that the amount is sufficient to demonstrate benefit to the individual. The actual amount administered, as well as the rate and timing of administration, will depend on the nature and severity of the disease being treated. The determination of dosage is the responsibility of the general practitioner and other physicians. Examples of this technique and protocol can be found in Remington's Pharmaceutical Sciences, 20th Edition, 2000, pub. Lippincott, Williams & Wilkins.

[0412] Exemplary doses may be between 0.01 mg / kg and 50 mg / kg, between 0.05 mg / kg and 40 mg / kg, between 0.1 mg / kg and 30 mg / kg, between 0.5 mg / kg and 18 mg / kg, between 1 mg / kg and 16 mg / kg, between 2 mg / kg and 15 mg / kg, between 5 mg / kg and 10 mg / kg, between 10 mg / kg and 20 mg / kg, between 12 mg / kg and 18 mg / kg, and between 13 mg / kg and 17 mg / kg.

[0413] Advantageously, the dosage of the conjugate of the present invention is one level or order of magnitude lower than the dosage required for therapeutic nucleic acids to take effect when applied alone.

[0414] Appropriately, after application of the conjugates of the present invention, one or more toxicity markers are significantly reduced compared to conjugates using currently available peptide carriers.

[0415] Appropriate toxicity markers can be nephrotoxicity markers.

[0416] Appropriate toxicity markers include serum KIM-1, NGAL, BUN, creatinine, alkaline phosphatase, alanine transferase, and aspartate aminotransferase levels.

[0417] Other suitable markers of toxicity include urinary sodium, potassium, chloride, urea, creatinine, calcium, phosphorus, glucose, uric acid, magnesium, and protein levels.

[0418] Appropriately, when compared with conjugates using currently available peptide carriers, the levels of at least one of KIM-1, NGAL, and BUN are appropriately reduced after application of the conjugates of the present invention.

[0419] Appropriately, the levels of each of KIM-1, NGAL, and BUN are appropriately reduced after application of the conjugates of the present invention, compared to conjugates using currently available peptide carriers.

[0420] Appropriately, the levels of said or each marker are significantly reduced when compared to conjugates using currently available peptide carriers.

[0421] Appropriately, when compared with conjugates using currently available peptide carriers, the level of the conjugates of the present invention is reduced by up to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% after application of the conjugates of the present invention.

[0422] Advantageously, the conjugates exhibit significantly reduced toxicity compared to existing peptides and conjugates. In particular, KIM-1 and NGAL-1, which are markers of toxicity, are significantly reduced by up to 120-fold compared to conjugates using currently available peptide carriers.

[0423] Suitablely, the long-term toxicity of the conjugate is negligible. Suitablely, the conjugate has no long-term toxic effects.

[0424] Appropriately, apart from the expected effect on the amplification of the target trinucleotide repeat, the conjugate had no significant effect on the subject's gene expression. Appropriately, the conjugate had no negative effect on the subject's gene expression.

[0425] Appropriately, after application of the conjugates of the present invention, cell viability is significantly improved compared to conjugates using currently available peptide carriers.

[0426] Suitablely, after application of the conjugates of the present invention, myoblast and hepatocyte viability is significantly improved compared with conjugates using currently available peptide carriers. Suitablely, after application of the conjugates of the present invention, myoblast and hepatocyte viability is increased by up to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, and 50% compared with conjugates using currently available peptide carriers.

[0427] Appropriately, after application of the conjugates of the present invention, cell survival is significantly improved compared with conjugates using currently available peptide carriers.

[0428] Appropriately, after application of the conjugates of the present invention, the recovery time is reduced by up to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% compared to conjugates using currently available peptide carriers.

[0429] Suitably, after application of the conjugate of the present invention, the recovery time is less than 60 minutes, less than 50 minutes, less than 40 minutes, less than 30 minutes, less than 20 minutes, less than 10 minutes, or less than 5 minutes. Suitably, after application of the conjugate of the present invention, there is no recovery time.

[0430] Nucleic acid and host

[0431] The peptide carriers of the present invention can be prepared by any standard protein synthesis method (e.g., chemical synthesis, semi-chemical synthesis) or by using an expression system.

[0432] Therefore, the present invention also relates to DNA or nucleotide sequences comprising the conjugate, expression systems (e.g., vectors comprising the sequence and sequences required for expression and control of expression), and host cells and host organisms transformed by the expression system.

[0433] Therefore, nucleic acids encoding conjugates according to the present invention are also provided.

[0434] The nucleic acid may be provided in an isolated or purified form, if appropriate.

[0435] An expression vector comprising a nucleic acid encoding a conjugate according to the invention is also provided.

[0436] Appropriately, the vector is a plasmid.

[0437] Suitablely, the vector contains a regulatory sequence (e.g., a promoter) operatively linked to a nucleic acid encoding a conjugate according to the invention. Suitablely, the expression vector is capable of expressing the conjugate when transfected into suitable cells (e.g., mammalian, bacterial, or fungal cells).

[0438] Host cells containing the expression vector of the present invention are also provided.

[0439] The expression vector can be selected based on the host cell into which the nucleic acid of the present invention can be inserted. This transformation of the host cell involves conventional techniques, such as those taught in Sambrook et al. [Sambrook, J., Russell, D. (2001) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY, USA]. The selection of a suitable vector is within the capabilities of those skilled in the art. Suitable vectors include plasmids, bacteriophages, granules, and viruses.

[0440] The resulting conjugates can be isolated and purified from the host cell by any suitable method, such as precipitation or chromatographic separation, such as affinity chromatography.

[0441] Appropriate vectors, hosts, and recombination technologies are well known in the field.

[0442] In this specification, the term "operably linked" can include situations where a selected nucleotide sequence and a regulatory nucleotide sequence are covalently linked in such a manner that the expression of the nucleotide-coding sequence is under the control of the regulatory sequence, such that the regulatory sequence can influence the transcription of the nucleotide-coding sequence that forms part or all of the selected nucleotide sequence. The resulting transcript can then be translated into the desired conjugate, where appropriate. Attached Figure Description

[0443] The invention will now be described with reference to the following figures and embodiments, wherein:

[0444] Figure 1 The study showed a reduction in the number of pathogenic nuclear aggregation sites and redistribution of MBNL in myoblasts from DM1 patients with 2600 CTG replicates. Results showed that transfection with different doses of the DPEP1 / 3-[CAG]7PMO conjugate did not reduce cell viability of myoblasts or hepatocytes 48 hours later (shown at 10 μM).

[0445] Figure 2A B and C and Figure 3A Figures B, C, and D show that, at various concentrations, different DPEP1 / 3-[CAG]7PMO conjugates corrected the splicing defects of the Mbnl-dependent transcript in myoblasts derived from DM1 patients with 2600 repeats in the DMPK gene, compared to conjugates formed using existing peptide carriers Pip6a and Pip9b2.

[0446] Figure 4 This study demonstrates that systemic delivery of different DPEP1 / 3-[CAG]7PMO conjugates at 30 mg / kg (intravenous, tail vein) corrected splicing defects of the Mbnl-dependent transcript in the gastrocnemius and quadriceps muscles of HSA-LR mice. RT-PCR analysis of splicing at exon 7a of clcn1, exon 22 of serca, and exon 5 of mbnl1 (the most widely used DM1 biomarker) showed that splicing was normalized to wild-type levels for the DPEP1 and 3-based conjugates. Data from six HSA-LR mice for each peptide-PMO were analyzed by ANOVA and Tukey post-hoc tests compared to untreated HSA-LR mice. Data are presented as mean ± SEM (*p<0.05, **p<0.01, ***p<0.001, ns not significant).

[0447] Figure 5The percentage of myoblast cell viability is shown 48 hours after transfection of DM1 patient myoblasts with 2600 CTG replicates with various doses of different DPEP1 / 3-[CAG]7PMO conjugates. Compared with conjugates formed using existing peptide carriers Pip6a and Pip9b2, the concentration of DPEP1 / 3-[CAG]7PMO conjugates can be increased several times from therapeutic levels without causing cell death in myoblasts.

[0448] Figure 6 The percentage of hepatocyte viability 48 hours after transfection of DM1 patient myoblasts with 2600 CTG replicates with different DPEP1 / 3-[CAG]7 conjugates and a comparative conjugate is shown. The concentration of the DPEP1 / 3-[CAG]7PMO conjugate can be increased several-fold from therapeutic levels without causing cell death in hepatocytes, compared to conjugates formed with existing peptide carriers Pip6a and Pip9b2.

[0449] Figure 7 and Figure 9 Electromyographic myotonia measurements of the gastrocnemius muscle in HSA-LR mice 2 weeks after a single dose of different DPEP1 / 3-[CAG]7PMO conjugates (30 mg / kg, n = 6, intravenous, tail vein). Data were analyzed by ANOVA and Tukey post-hoc tests and compared with untreated HSA-LR mice and a control conjugate with DPEP 5.7. Data are presented as mean ± SEM (*p < 0.05, **p < 0.01, ***p < 0.001, ns not significant). Figure 10 shows detailed data for individual tests.

[0450] Figure 8 The results showed that, 2 weeks after a single dose of different DPEP1 / 3-[CAG]7PMO conjugates (30 mg / kg, n=6, intravenous injection, tail vein), HSA-LR mice... Figure 8 The corresponding myotonia grades were measured for the 10 data points. Data were analyzed using an unpaired Student's t-test and compared with untreated HSA-LR mice and a comparative conjugate with DPEP 5.7. Data are presented as mean ± SEM.

[0451] Figure 10A Tables B and C show the serum levels of ALP, ALT, and AST assessed in female C57BL6 mice (8–10 weeks old, n = 5 per group) administered via intravenous bolus (tail vein) injection of different DPEP1 / 3-[CAG]7PMO conjugates. Serum was collected 7 days post-injection and compared with saline. ALP, ALT, and AST levels were similar to the saline control injection compared to the fold increases induced by existing Pip series peptide carriers.

[0452] Figure 11 Figure A shows the urinary and serum KIM-1 levels assessed on days 2 and 7 after injection of different DPEP1 / 3-[CAG]7PMO conjugates into female C57BL6 mice. These levels were measured by ELISA (R&D cat#MKM100) using samples diluted to fit within the standard curve. Values ​​were normalized to urinary creatinine levels (Harwell) to calculate urinary protein concentrations. KIM-1 levels were similar to the saline control injection compared to the fold increase induced by existing Pip series peptide carriers.

[0453] Figure 11 Figures B and C show serum levels of BUN and creatinine on day 7 after injection of different DPEP1 / 3-[CAG]7PMO conjugates into female C57BL6 mice (Harwell) compared to saline injection. BUN and creatinine levels were similar to those induced by existing Pip series peptide carriers, compared to the saline control.

[0454] Figure 12 and 13 The KIM-1 / creatinine ratio, assessed in urine on days 2, 7, and 14 after administration of the DPEP3.8-[CAG]7PMO conjugate at 30 mg / kg or 5 mg / kg for six doses, was shown compared to saline injection. Creatinine and KIM-1 levels were similar to those induced by saline control injection, compared to the fold increase induced by existing Pip series peptide carriers.

[0455] Figure 14A Tables B, C, and D show the urinary sodium, potassium, chloride, urea, creatinine, calcium, phosphorus, glucose, uric acid, magnesium, and protein levels in female C57BL6 mice (8–12 weeks old, n = 5 per group) after injection of different DPEP1 / 3-[CAG]7PMO conjugates at 5, 7.5, and 30 mg / kg, compared to saline injection. Error bars represent SEM.

[0456] Figure 15 The body weight of HSA-LR mice treated with the DPEP3.8-[CAG]7PMO conjugate is shown. Compared with five HSA-LR mice injected with saline, five HSA-LR mice injected with a single 30 mg / kg dose showed no significant decrease in long-term body weight.

[0457] Figure 16This study presents a biodistribution delivery analysis of different DPEP1 / 3-[CAG]7PMO conjugates, measured by ELISA, two weeks after administration of 30 mg / kg conjugates or 3 x 200 mg / kg naked PMO in HSA-LR mice (intravenous). Assessment of the biodistribution of the DPEP1.9 and DPEP3.8 conjugates revealed optimal delivery to severely affected tissues in DM1. PMO was detected by a custom ELISA assay using probes labeled with digoxigenin and biotin. Two weeks after treatment, PMO concentrations in muscle tissue remained >1 nM, while lower pMs were detected after naked PMO injection (although the molar concentration difference between naked PMO and DPEP-PMO conjugate treatment was >20-fold) (n=4). Data are presented as mean + / - SEM. Statistical analysis: One-way ANOVA with Tukey post-hoc test.

[0458] Figure 17 The pharmacokinetic properties of different DPEP1 / 3-[CAG]7PMO conjugates, measured in serum after a single 5 mg / kg injection, are shown. Serum concentrations were quantified using a custom-made ELISA, reaching 500–800 nM 5 minutes after intravenous injection of 5 mg / kg, decreasing to 100 nM after 1 hour, and further decreasing to 10 nM after 3 hours. Concentrations were approximately 1 nM at 6 hours post-treatment, indicating that most of the compound had been cleared or delivered to the tissue of interest.

[0459] Figure 18A Figures B, C, and D show in more detail how systemic delivery of different DPEP1 / 3-[CAG]7PMO conjugates corrected splicing defects of the Mbnl-dependent transcript in the gastrocnemius muscle of HSA-LR mice. RT-PCR analysis of splicing at exon 7a of Clcn1, exon 22 of Serca, exon 5 of Mbnl1, and exon 11 of Ldb3 showed that splicing was normalized to wild-type levels using DPEP1.9 and DPEP3.8-based conjugates at 30 and 40 mg / kg. Splicing correction persisted for at least 3 months after treatment and was also significant after a single low dose (5 and 7.5 mg / kg) (boxes indicate data distribution to quartiles, highlighting the mean; error bars indicate variability outside the upper and lower quartiles, n=5 per group).

[0460] Figure 19A, B, and C show that myotonia grades in HSA-LR mice were corrected to wild-type levels (from 4 to 0) after a single dose of 30 or 40 mg / kg based on the DPEP1.9 and DPEP3.8 conjugates. This correction lasted for at least 3 months post-treatment (A). Myotonia was reduced to 50% when the dose was distributed over four injections (4 x 7.5 mg / kg) (B), while reducing the dose to 4 x 5 mg / kg resulted in a 20-25% reduction two weeks after the last injection (C) (error bars indicate SEM); (n = 6, intravenous, tail vein).

[0461] Figure 20 Toxicological screening of serum and urine at 2 days and 1 week after intravenous administration of different DPEP1 / 3-[CAG]7PMO conjugates in HSA-LR mice (8–12 weeks old, n=5 per group) is shown. Results showed no significant difference in phenotype-normalizing doses in HSA-LR mice. Compared to saline-treated HSA-LR mice, KIM1 levels changed significantly only after treatment with DPEP1.9, DPEP3.8, DPEP3.1, and DPEP3.1b at 30 mg / kg or 40 mg / kg, and only at 2 days post-treatment. Error bars represent SEM.

[0462] Figure 21 This study demonstrates the correction of the DM1 phenotype (myotonia) in HSA-LR mice several weeks after the first injection using various administration regimens, including: four doses of DPEP3.8-[CAG]7PMO conjugate at 5 mg / kg, four doses of DPEP3.8-[CAG]7PMO conjugate at 7.5 mg / kg, a single dose of DPEP3.8-[CAG]7PMO conjugate at 7.5 mg / kg, a single dose of DPEP3.8-[CAG]7PMO conjugate at 30 mg / kg, or a single dose of DPEP3.8-[CAG]7PMO conjugate at 40 mg / kg. Treatment with low doses of DPEP3.8-[CAG]7PMO conjugate (5–7.5 mg / kg) without any apparent toxicity reduced myotonia.

[0463] Figure 22This study demonstrates the correction of the DM1 phenotype (myotonia) in HSA-LR mice several weeks after the first injection using various administration regimens, including: four doses of DPEP1.9-[CAG]7PMO conjugate at 5 mg / kg, four doses of DPEP1.9-[CAG]7PMO conjugate at 7.5 mg / kg, a single dose of DPEP1.9-[CAG]7PMO conjugate at 7.5 mg / kg, or a single dose of DPEP1.9-[CAG]7PMO conjugate at 40 mg / kg. Treatment with low doses of DPEP1.9-[CAG]7PMO conjugate (5–7.5 mg / kg) without any apparent toxicity reduced myotonia.

[0464] Figure 23 The concentrations (pM) of PMO in various tissues after intravenous administration of the following substances to HSA-LR mice for 2 weeks are shown: naked PMO (3 doses, 200 mg / kg), 30 mg / kg of DPEP3.8-[CAG]7PMO conjugate, 30 mg / kg of DPEP3.8b-[CAG]7PMO conjugate, 7.5 mg / kg of DPEP3.8-[CAG]7PMO conjugate, and 40 mg / kg of DPEP3.8-[CAG]7PMO conjugate. Both peptides (DPEP3.8 and DPEP3.8b) successfully delivered PMO to muscle, achieving concentrations >6 nM in skeletal muscle.

[0465] Figure 24 The concentrations (pM) of PMO in various tissues after 2 weeks of IV administration of the following substances to HSA-LR mice are shown: naked PMO (3 doses, 200 mg / kg), 30 mg / kg of DPEP1.9-[CAG]7PMO conjugate, 30 mg / kg of DPEP1.9b-[CAG]7PMO conjugate, 7.5 mg / kg of DPEP1.9-[CAG]7PMO conjugate, and 40 mg / kg of DPEP1.9-[CAG]7PMO conjugate. Both peptides (DPEP1.9 and DPEP1.9b) successfully delivered PMO to muscle. DPEP1.9b-[CAG]7PMO reached the diaphragm particularly well (>15 nM after a single intravenous injection of 30 mg / kg for 2 weeks).

[0466] Figure 25The concentrations (pM) of PMO in various tissues were shown after intravenous administration of the following substances to HSA-LR mice for 2 weeks: naked PMO (3 doses, 200 mg / kg), 30 mg / kg of DPEP3.1-[CAG]7PMO conjugate, 30 mg / kg of DPEP3.1a-[CAG]7PMO conjugate, and 30 mg / kg of DPEP3.1b-[CAG]7PMO conjugate. These three peptides (DPEP3.1, DPEP3.1a, and DPEP3.1b) were able to deliver PMO to skeletal muscle and cardiac muscle (>1 nM).

[0467] Figure 26 , 27 Figures 28 and 28 show toxicological screening of KIM-1 versus creatinine levels measured in urine at different time points after systemic intravenous administration of different doses of the different peptide-[CAG]7PMO conjugates of the present invention in HSA-LR mice, compared to injection of saline, injection of naked [CAG]7PMO, and injection of the Pip peptide-[CAG]7PMO conjugate. The DPEP peptide-[CAG]7PMO conjugate of the present invention maintains low toxicity even at higher doses compared to, in particular, the Pip6a-[CAG]7PMO conjugate. Using dosage regimens capable of reversing the DM1 phenotype to healthy levels, the DPEP conjugate does not affect toxicity biomarkers.

[0468] Throughout the description and claims of this specification, the words “comprising” and “including” and variations thereof mean “including, but not limited to”, and they are not intended to (and do not) exclude other parts, additives, components, integers, or steps. Throughout the description and claims of this specification, the singular form includes the plural form unless the context requires otherwise. In particular, where indefinite articles are used, the invention should be understood to include both the plural and the singular, unless the context requires otherwise.

[0469] Features, integers, properties, compounds, chemical parts, or groups described in connection with a particular aspect, embodiment, or example of the invention should be understood to be applicable to any other aspect, embodiment, or example described herein, unless incompatible therewith. All features disclosed in this specification (including any appended claims, abstract, and drawings) and / or all steps of any method or process so disclosed may be combined in any arbitrary combination, except that at least some of these features and / or steps are mutually exclusive combinations.

[0470] This invention is not limited to the details of any of the foregoing embodiments. The invention extends to any novel one or any novel combination of features disclosed in this specification (including any appended claims, abstract, and drawings), or to any novel one or any novel combination of steps of any method or process so disclosed. Readers should note all papers and documents related to this application that were filed concurrently with or prior to this specification, and which are publicly available together with this specification, the contents of which are incorporated herein by reference.

[0471] Example

[0472] 1. Materials and Methods

[0473] Synthesis and preparation of P-PMO

[0474] 9-fluorenylmethoxycarbonyl (Fmoc) protected L-amino acids, benzotriazol-1-yl-oxy-tripyrrolidinyl phosphate (PyBOP), 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethylurea hexafluorophosphate (HBTU), and Fmoc-β-Ala-OH pre-filled Wang's resin (0.19 or 0.46 mmol g) -1 Acetonitrile (Hohenbrunn, Germany) was obtained from Merck (Hohenbrunn, Germany). 1-Hydroxy-7-azabenzotriazole (HOAt) was obtained from Sigma-Aldrich. HPLC-grade acetonitrile, methanol, and synthetic-grade N-methyl-2-pyrrolidone (NMP) were purchased from Fisher Scientific (Loughborough, UK). Peptide synthetic-grade N,N-dimethylformamide (DMF) and diethyl ether were obtained from VWR (Leicestershire, UK). Piperidine and trifluoroacetic acid (TFA) were obtained from Alfa Aesar (Heysham, UK). PMO was purchased from Gene Tools Inc. (Philomath, USA). Unless otherwise specified, all other reagents were obtained from Sigma-Aldrich (St. Louis, MO, USA). MALDI-TOF mass spectrometry analysis was performed using a Voyager DE ProBioSpectrometry workstation. 10 mg / mL of acetonitrile in 50% acetonitrile in water was used. -1 An α-cyano-4-hydroxycinnamic acid or sinapic acid stock solution was used as the matrix. The error bar is ±0.1%.

[0475] Synthesis of P-PMO peptides for screening

[0476] a) Preparation of peptide variant libraries

[0477] Peptides were prepared at a scale of 10 μmol using an Intavis parallel peptide synthesizer, employing standard Fmoc chemical methods and following the manufacturer's recommendations, using pre-filled Fmoc-β-Ala-OH Wang's resin (0.19 or 0.46 mmol g⁻¹, Merck Millipore), or using CEM Liberty Blue. TM Peptides were prepared at a scale of 100 μmol using a peptide synthesizer (Buckingham, UK). When synthesizing using an Intavis parallel peptide synthesizer, the biconjugation step was performed with a PyBOP / NMM conjugation mixture, followed by acetic anhydride capping after each step. For syntheses using a CEM Liberty Blue peptide synthesizer, all amino acids were single-standard conjugated, except for arginine, which was biconjugated. The conjugation was performed at 75°C for 5 minutes at 60 W microwave power, except for arginine residues, each of which was conjugated twice. Each deprotection reaction was performed twice at 75°C, once for 30 seconds, followed by 3 minutes at 35 W microwave power. Once synthesis was complete, the resin was washed with DMF (3 x 50 mL) and the N-terminus of the conjugated peptide was acetylated with acetic anhydride in the presence of DIPEA at room temperature. After N-terminal acetylation, the peptide resin was washed with DMF (3 x 20 mL) and DCM (3 x 20 mL). The peptide was separated from the solid support by treating it with a separation mixture consisting of trifluoroacetic acid (TFA): H₂O: triisopropylsilane (TIPS) (95%: 2.5%: 2.5%: 3-10 mL) at room temperature for 3 hours. After peptide release, excess TFA was removed by purging with nitrogen. The crude peptide was precipitated by adding cold diethyl ether (15-40 mL, depending on the synthesis scale) and centrifuged at 3200 rpm for 5 minutes. The crude peptide precipitate was washed three times with cold diethyl ether (3 × 15 mL) and purified by RP-HPLC using a Varian 940-LC HPLC system equipped with a 445-LC amplification module and a 440-LC fraction collector. The peptide was purified by semi-preparative HPLC on an RP-C18 column (10 x 250 mm, Phenomenex Jupiter) using a linear gradient of CH3CN in 0.1% TFA / H2O at a flow rate of 15 mL / min. -1 Detection was performed at 220 nm and 260 nm. Fractions containing the desired peptides were combined and lyophilized to obtain peptides as white solids (yields are shown in Table 1).

[0478]

[0479]

[0480] Table 1: Synthetic peptides used in the examples, having N-terminal acetylation (Ac), N-terminal succinate linker (Succ), C-terminal β-alanine linker (B), γ-aminobutyric acid linker (Ab), and glutamate linker (E). S* is a glucosylated serine residue. Conjugates formed with DPEP5.7, Pip6a, and Pip9b2 are comparable.

[0481] b) Synthetic peptide-PMO conjugate library

[0482] The 21-mer PMO antisense sequence CAGCAGCAGCAGCAGCAGCAG (SEQ ID NO. 95), also known as [CAG]7, was used for the triplet repeat sequence. The PMO sequence targeting the repeat sequence amplified by CUG / CTG (5′-CAGCAGCAGCAGCAGCAGCAG-3′ (SEQ ID NO: 95)) was purchased from Gene Tools LLC. This is the [CAG]7PMO mentioned elsewhere in this document. The peptide is conjugated to the 3′ end of the PMO via its C-terminal carboxyl group. This was achieved using 2.5 and 2 equivalents of PyBOP and HOAt in NMP, respectively, in the presence of 2.5 equivalents of DIPEA and using 2.5-fold excess peptide of PMO dissolved in DMSO. Typically, a solution of the peptide (2500 nmol) dissolved in N-methylpyrrolidone (NMP, 80 μL) is added with PyBOP (19.2 μL of 0.3 M NMP solution), HOAt (16.7 μL of 0.3 M NMP solution), DIPEA (1.0 mL), and PMO (180 μL of 10 mM DMSO solution). The mixture is incubated at 40 °C for 2.5 h, and the reaction is quenched by adding 0.1% TFA in H2O solution (300 μL). The solution is purified by ion exchange chromatography using a modified Gilson HPLC system. The PMO-peptide conjugate is purified on an ion exchange column (Resource S 4 mL, GE Healthcare) using a linear gradient of sodium phosphate buffer (25 mM, pH 7.0) containing 20% ​​CH3CN. The conjugate is eluted from the column with sodium chloride solution (1 M) at a flow rate of 4 mL min⁻¹ or 6 mL min⁻¹. Immediately combine and desalt the fractions containing the desired compounds. By using... The fraction collected after ion exchange was filtered using an ultra-15 3K centrifugal filter to remove excess salt from the peptide-PMO conjugate. The conjugate was lyophilized and analyzed by MALDI-TOF. Before use, the conjugate was dissolved in sterile water and filtered through a 0.22 μm cellulose acetate membrane. The concentration of peptide-PMO was determined by the molar absorbance of the conjugate at 265 nm in 0.1 N HCl solution. (Yields are shown in Table 2).

[0483] peptides Yield D-Pep 1.1 36％ D-Pep 1.7 41％ D-pep 1.8 38％ D-Pep 1.9 40％ D-Pep 1.9b 34％ D-Pep 1.9W3 43％ D-Pep 1.9W4P 23％ D-Pep 3.1 31％ D-Pep 3.1a 17％ D-Pep 3.1b 25％ D-Pep 3.1d 37％ D-Pep 3.8 36％ D-Pep 3.8b 35％ D-Pep 5.70 31％

[0484] Table 2. Yields of P-PMO conjugates used in cell culture analysis and in vivo experiments (the yields are based on the dry weight of lyophilized purified P-PMO. The purity of P-PMO is greater than 95%, as determined by normal-phase HPLC at 220 nm and 260 nm).

[0485] Animal models and ASO injections. Experiments were conducted at Oxford University or the Centre d'études fonctionnelles (Sorbonne University Medical School) in accordance with UK and French law (Ethics Committee Permit #1760-2015091512001083v6). Intravenous injections in HSA-LR or C57BL / 6 mice were performed via single or multiple administrations through the tail vein. Peptide-PMO-CAG7 at doses of 5, 7.5, 12.5, 30, or 40 mg / kg and PMO at doses of 12.5 or 200 mg / kg were diluted in 0.9% saline and administered at a volume of 5–6 μL / g body weight. Multiple injections were administered at 2-week intervals. Myotonia was assessed and tissue was harvested 2 weeks after the last injection. For long-term experiments, tissue was harvested 3 months after injection. For toxicological measurements, tissue was harvested 1 week later. Urine was tested by ELISA (R&D cat#MKM100), with samples diluted to conform to a standard curve. The values ​​were normalized to urinary creatinine levels (Harwell) to calculate urinary protein concentration.

[0486] In situ measurement of muscle rigidity / relaxation. The isometric contraction properties of the gastrocnemius muscle were investigated in situ. Mice were anesthetized with ketamine / xylan solutions (80 mg / kg and 15 mg / kg, respectively). The knee and foot were secured with clips and needles. The distal tendon of the gastrocnemius muscle was attached to a lever arm (305B, dual-mode lever) of a servo motor system. Data were recorded and analyzed using a PowerLab system (4SP, ADInstruments) and software (Figure 4, ADInstruments). The sciatic nerve (proximal crush) was stimulated with a large (10-V) square wave pulse with a duration of 0.1 ms via bipolar silver electrodes. Absolute maximum isometric rigidity (P0) was measured during isometric contraction in response to electrical stimulation (frequency from 25 to 150 Hz, stimulation sequence of 500 ms). Muscle rigidity was measured as the delay in muscle relaxation after measuring P0.

[0487] Cell Culture and Peptide-PMO Treatment. Immortalized myoblasts from healthy individuals or DM1 patients with 2600 CTG replicates were cultured in growth medium consisting of an M199:DMEM mixture (1:4 ratio, Life Technologies), supplemented with 20% FBS (Life Technologies), 50 μg / ml gentamicin (Life Technologies), 25 μg / ml fetoglobulin, 0.5 ng / ml bFGF, 5 ng / ml EGF, and 0.2 μg / ml dexamethasone (Sigma-Aldrich). For myoblasts, myogenic differentiation was induced by switching the confluent cell culture to DMEM supplemented with 5 μg / ml insulin (Sigma-Aldrich). For treatment, WT or DM1 cells were differentiated for 4 days. The medium was then replaced with fresh differentiation medium containing peptide-PMO conjugates at concentrations of 1, 2, 5, 10, 20, or 40 μM. Cells were harvested for analysis 48 hours after treatment. Cell viability was quantified two days after transfection of human hepatocytes with peptide-PMO at a concentration of 40 μM or in myoblasts at concentrations of 1, 2, 5, 10, 20, or 40 μM using a fluorescence-based assay (Promega).

[0488] RNA isolation, RT-PCR, and qPCR analysis. For mouse tissue: muscle was disrupted using the Fastprep system and Lysing Matrix D tubes (MP biomedicals) in TriReagent (Sigma-Aldrich) prior to RNA extraction. For human cells: cells were lysed at 55°C for 45 min prior to RNA extraction in proteinase K buffer (500 mM NaCl, 10 mM Tris-HCl, pH 7.2, 1.5 mM MgCl2, 10 mM EDTA, 2% SDS, and 0.5 mg / ml proteinase K). Total RNA was isolated using TriReagent according to the manufacturer's protocol. One microgram of RNA was reverse transcribed using the M-MLV first-strand synthesis system (Life Technologies) according to the manufacturer's instructions, for a total volume of 20 μL. Subsequently, one microliter of cDNA preparation was used for semi-quantitative PCR analysis according to a standard protocol (ReddyMix, Thermo Scientific). Primers are shown in Table 3 below:

[0489] Table 3

[0490]

[0491]

[0492] Within the linear amplification range for each gene, PCR amplification was performed for 25–35 cycles. PCR products were separated on 1.5–2% agarose gels, stained with ethidium bromide, and quantified using ImageJ software. The exon inclusion ratio was quantified as the percentage of inclusion relative to the total isoform signal intensity. To quantify mRNA expression, real-time PCR was performed according to the manufacturer's instructions. PCR cycles consisted of a 15-minute denaturation step followed by 50 cycles of denaturation at 94°C for 15 seconds, annealing at 58°C for 20 seconds, and extension at 72°C for 20 seconds.

[0493] Fluorescence in situ hybridization / immunofluorescence. As previously described, fluorescence in situ hybridization (FISH) experiments were performed using a Cy3-labeled 2'OMe(CAG)7 probe (Eurogentec). For combined FISH-immunofluorescence experiments, immunofluorescence staining was performed after the final FISH wash with rabbit polyclonal anti-MBNL1 antibody, followed by secondary Alexa Fluor 488 conjugated with goat anti-rabbit (1:500, Life Technologies) antibody.

[0494] Measurement of oligonucleotide concentrations in tissues based on ELISA. A custom hybridization-based ELISA was developed to determine the concentration of PMO oligonucleotides using a digoxigenin and biotin-labeled phosphate thioester probe with a phosphate thioester bond (sequence (5'->3')[DIG]C*T*G*C*T*G*C*TGCTGCT*G*C*T*G*C*T*G[BIO](SEQ ID NO:96)). The assay had a linear detection range of 5–250 pM (R²>0.99) in mouse serum and tissue lysates. The probe was used to detect peptide-PMO or naked PMO concentrations in eight different tissues (brain, kidney, liver, lung, heart, diaphragm, gastrocnemius, and quadriceps femoris) from treated HSA-LR mice.

[0495] 2. Results

[0496] In this work, we used a cell-penetrating peptide rich in arginine with a specific structure and demonstrated that, compared with unconjugated PMO and other peptide carrier conjugate strategies, this peptide conjugated with [CAG]7 morpholinophosphodiamid oligomer (PMO) significantly enhanced ASO delivery into the skeletal muscle of DM1 model HSA-LR mice after systemic administration. Therefore, low-dose treatment with the claimed peptide-[CAG]7PMO conjugate targeting pathologically amplified muscle was sufficient to reverse splicing defects and myotonia in DM1 mice (HSA-LR) and normalize the overall disease transcriptome. Furthermore, treated DM1 patient-derived muscle cells (myoblasts) showed that the claimed peptide-[CAG]7PMO conjugate specifically targeted the mutant CUGexp-DMPK transcript, thereby eliminating the detrimental isolation of the nuclear RNA aggregation site to the MBNL1 splicing factor and the resulting loss of MBNL1 function, which caused splicing defects and muscle dysfunction. Our results demonstrate that the claimed peptide-[CAG]7PMO conjugates, as described in this paper, induce efficient and durable correction of DM1-related phenotypes at both the molecular and functional levels, and strongly support the use of these peptide conjugates for systemic corrective therapy of DM1.

[0497] We have generated data on conjugates containing peptide carriers free of artificial amino acids (e.g., X residues), which exhibit a wider therapeutic window and safer toxicological profiles compared to previous cell-penetrating peptides, thus constituting more promising candidates for testing in DM1 patients. When conjugated with the CAG7 repeat antisense oligonucleotide PMO, these next-generation so-called "DPEP1 and DPEP3" peptides show a reduction in the number of pathogenic aggregation sites in vitro. Figure 1It showed high efficiency in both ) and correction of splicing defects (Figs. 2, 3, 4, and 19). None of the tested concentrations resulted in decreased cell viability in human hepatocytes (1–40 μM), contrary to similar comparable conjugates formed from known “Pip” carrier peptides; Pip6a-PMO and Pip9b2-PMO induced significant cell death (>50%) at 40 μM. Figure 7 Many of the tested concentrations did not result in decreased cell viability in human myoblasts and performed better than similar comparative conjugates formed from known “Pip” carrier peptides Pip6a-PMO and Pip9b2-PMO, which induce cell death at lower doses. Figure 5 and 6 ).

[0498] Subsequently, we tested whether these novel peptides could also effectively correct myotonia and splicing changes in HSA-LR mice. To this end, we tested the major peptide carriers DPEP1.9 and DPEP3.8 of the DPEP 1 and 3 series and compared them with the existing peptide carrier DPEP5.70. We were able to demonstrate that after two weeks of treatment with a conjugate formed from DPEP3.8 and DPEP1.9 at 30 mg / kg, splicing defects (…) were effectively corrected. Figure 4 ) and muscle rigidity ( Figure 8 , 9 10) were corrected to wild-type level.

[0499] The biodistribution of naked PMO and the biodistribution of conjugates formed with the carrier peptides DPEP1.9 and DPEP3.8 were assessed by ELISA to quantify the delivery of the peptide-[CAG]7PMO conjugate. Detection of PMO in tissues severely affected by DM1 (e.g., heart and brain) is important for drug delivery development. HAS-LR mice were administered a single intravenous injection of 30 mg / kg of the peptide-[CAG]7PMO conjugate or three injections of 200 mg / kg of naked PMO (total 600 mg / kg). PMO detection in the gastrocnemius, quadriceps, diaphragm, heart, and brain was analyzed 2 weeks post-administration. Unconjugated naked [CAG]7PMO was found to be at levels as low as undetectable in all tested tissues; however, [CAG]7PMO conjugated with the peptide carriers DPEP1.9 and DPEP3.8 was detected at higher levels (>20-fold molar concentration) despite lower injection doses. Generally, two weeks after an injection of 30 mg / kg, the peptide-[CAG]7PMO conjugate was detected at 1 nM-4 nM in the quadriceps femoris, gastrocnemius, and diaphragm, and at 1 nM in the heart. Figure 17 ).

[0500] Table 4

[0501]

[0502] We also investigated the pharmacokinetic properties of the peptide-[CAG]7PMO conjugate of the present invention, measured in serum after administration of a low dose (5 mg / kg), including the peptide-[CAG]7PMO conjugate. We quantified the serum concentrations, which reached 500–800 nM 5 minutes after intravenous injection, decreased to 100 nM after 1 hour, and further decreased to 10 nM after 3 hours. The concentration was approximately 1 nM 6 hours post-treatment, indicating that most of the compound had been cleared or delivered to the tissue of interest (Figure 18).

[0503] Preliminary toxicological evaluation of conjugates formed from DPEP3.8 and DPEP1.9 carrier peptides in wild-type mice showed that ALP, ALT, AST, KIM-1, creatinine, BUN, and NGAL levels were similar to those of the control group after saline injection, contrary to the exponential increases typically induced by currently available peptide carriers from the Pip series. With these preliminary data, we demonstrate that the conjugates formed from DPEP peptides and [CAG]7PMO in vivo are as active as Pip6a, but with a wider therapeutic window. Figure 11 , 12 and 21).

[0504] Furthermore, compared with the five HSA-LR mice injected with saline, the five HSA-LR mice injected with a single dose of 30 mg / kg of the conjugate formed by DPEP3.8-[CAG]7 showed no significant trend in body weight. Figure 16 ).

[0505] Furthermore, the recovery time of HSA-LR mice after injection of DPEP-based [CAG]7PMO conjugates was shorter than that after injection of conjugates formed from existing peptide carriers (such as Pip6a) (Table 5).

[0506] Table 5

[0507]

[0508] In a more detailed evaluation of the efficacy of the conjugates of this invention, we also found that, at least 3 months after administration of the DPEP peptide-[CAG]7PMO conjugate, splicing defects and myotonia were corrected to wild-type levels (respectively). Figure 19 and 20 We also measured a 50% reduction in missplicing and muscle rigidity after administration of a dose of 7.5 mg / kg.

[0509] It is noteworthy that conjugates formed using existing peptide carriers (such as Pip6a-[CAG]7PMO) could not be tested at concentrations >20 mg / kg without causing high mortality in mice, unlike the conjugates of this invention, whose concentrations could be increased more than 5-fold without causing any mortality. Furthermore, in toxicity screening, we only detected changes in Kim1 levels compared to saline levels at doses exceeding 30 mg / kg two days post-treatment. Figure 21 ).

[0510] Efficacy and toxicology data indicate that the claimed conjugates with the DPEP1 and DPEP3 series carrier peptides are particularly effective in blocking the chelation of MBNL1 by amplified CTG repeats in individuals affected by DM1 and inducing low toxicity. These conjugates are able to completely correct the DM1 phenotype at the molecular level through splicing normalization and at the muscle level by correcting myotonia to wild-type levels. These novel conjugates also have a wider therapeutic window than existing peptide carrier-formed conjugates, thus bringing them closer to clinical realization.

[0511] In summary, we present strong evidence supporting (1) that peptide-[CAG]7PMO blocks the pathological interaction between MBNL1 and the nuclear mutant CUGexp-RNA and rescues downstream effects on RNA splicing; (2) the peptide-conjugated antisense oligonucleotide approach allows for therapeutic delivery to inaccessible tissues, such as the heart in the diaphragm; and (3) the potent effect of [CAG]7PMO in directly targeting disease mutations, combined with the ability of peptide delivery technology to provide highly effective treatment in vivo, together strongly reversed the DM1 phenotype in skeletal muscle DM1 mice (HSA-LR) to wild-type levels, even months after treatment cessation. This evidence strongly suggests that peptide-[CAG]7 conjugates may have a potent disease-modifying effect in DM1.

[0512] In fact, our experiments demonstrate that the effects we observed in HSA-LR mice not only prevented the progression of DM1 pathology but also actually led to a reversal of the disease phenotype. The amplified CUG transcript was expressed in pups, and HSA-LR mice exhibited significant myotonia at 1 month of age. The animals we used to produce results supporting this application were treated at least 2 months, even up to 7 months, well beyond the timeframe for the development of the molecular and functional phenotypes of DM1.

[0513] 3. Conclusion

[0514] * The conjugate containing the DPEP carrier peptide and [CAG]7PMO (10 μM) reduced the number of nuclear lesions in myoblasts of DM1 patients and controls by >50% (at doses that did not reduce cell viability). In contrast to comparative conjugates formed with other carrier peptides that induced significant cell death (>50%) at concentrations of 20 μM or higher, none of the tested concentrations (1–40 μM) resulted in a reduction in cell viability.

[0515] * The conjugate containing the DPEP carrier peptide and [CAG]7PMO exhibited positive pharmacokinetics, and biodistribution assessments revealed optimal delivery to severely affected tissues in DM1.

[0516] *Conjugates containing the DPEP carrier peptide and [CAG]7PMO induced 50%–90% splicing correction in HSA-LR mice at a dose (30 mg / kg, intravenously) in exon 7a of Clcn1, exon 22 of Serca, exon 5 of Mbnl1, and exon 11 of Ldb3, with lower toxicity than comparative conjugates formed with other carrier peptides at 12.5 mg / kg. RT-PCR analysis also showed that conjugates containing DPEP1.9 and DPEP3.8 at 30 and 40 mg / kg normalized splicing to wild-type levels. Splicing correction persisted for at least 3 months post-treatment and was also significant after a single low dose (5 and 7.5 mg / kg).

[0517] *Based on qualitative observation of myotonia and electromyographic measurement of myotonia, conjugates containing DPEP carrier peptides and [CAG]7PMO reduced myotonia to wild-type levels after a single injection of 40 mg / kg or 30 mg / kg (IV). Moderate correction of myotonia was also observed after four injections of conjugates containing DPEP3.8 or DPEP1.9 at 7.5 mg / kg.

[0518] *The duration of drowsiness induced in wild-type mice by a conjugate containing the DPEP carrier peptide and [CAG]7PMO, administered intravenously at 30 mg / kg, was shorter (>1 hour) than that induced by a single injection of 12.5 mg / kg with other carrier peptides. Urinary biochemistry tests for renal function and hematologic analysis showed no changes compared to saline in wild-type mice; however, slight changes in Kim1 levels and urinary protein were observed in HSA-LR mice after doses >30 mg / kg.

Claims

1. A conjugate comprising: a peptide carrier covalently linked to a therapeutic molecule; The total length of the peptide carrier is 40 or fewer amino acids, and includes: two or more cationic domains, each containing at least 4 amino acid residues, and one or more hydrophobic domains, each containing at least 3 amino acid residues, wherein the peptide carrier does not contain artificial amino acid residues. Furthermore, the therapeutic molecule comprises a nucleic acid, wherein the nucleic acid comprises multiple trinucleotide repeats.

2. The conjugate according to claim 1, wherein the nucleic acid comprises a plurality of trinucleotide repeats selected from GTC, CAG, GCC, GGC, CTT and CCG repeats.

3. The conjugate according to claim 1 or 2, wherein the nucleic acid comprises a plurality of CAG repeats.

4. The conjugate according to any of the preceding claims, wherein the nucleic acid comprises 5-20 trinucleotide repeats, preferably 5-10 trinucleotide repeats, and more preferably 7 trinucleotide repeats.

5. The conjugate according to any of the preceding claims, wherein the nucleic acid is bound to a trinucleotide repeat amplification.

6. The conjugate according to any of the preceding claims, wherein the peptide carrier is composed of natural amino acid residues.

7. The conjugate according to any of the preceding claims, wherein each cationic domain has a length of 4 to 12 amino acid residues, preferably 4 to 7 amino acid residues.

8. The conjugate according to any of the preceding claims, wherein each cationic domain comprises at least 40%, at least 45%, or at least 50% cationic amino acids.

9. The conjugate according to any of the preceding claims, wherein each cationic domain comprises arginine, histidine, β-alanine, hydroxyproline and / or serine residues, preferably wherein each cationic domain is composed of arginine, histidine, β-alanine, hydroxyproline and / or serine residues.

10. The conjugate according to any of the preceding claims, wherein the peptide carrier comprises two cationic domains.

Images