Low-temperature response transcription factor and application of low-temperature response transcription factor in regulation and control of starch degradation of annona squamosa fruits

Abstract

The invention belongs to the field of biology, and particularly relates to a low-temperature response transcription factor and application of the low-temperature response transcription factor to regulation and control of degradation of annona squamosa fruit starch. The transcription factor AaHATL is cloned from annona squamosa for the first time, and research shows that the transcription factor gene is positioned in a cell nucleus and is induced at low temperature in transcription and protein levels. Overexpression of the gene in tomatoes can significantly improve the starch content of fruits, facilitates improvement of the soluble solid content in mature tomato fruits, and facilitates improvement of the quality of tomatoes. The gene is transiently expressed in annona squamosa, so that the starch content in annona squamosa fruits can be remarkably increased, the after-ripening softening of annona squamosa is delayed, and the storage life of annona squamosa is The invention provides a new candidate gene for research on improvement of varieties such as tomato and annona squamosa, delay of shelf life of starch storage type fruits and the like.

Description

Technical Field

[0001] This invention belongs to the field of biology, specifically relating to a low-temperature responsive transcription factor and its application in regulating starch degradation in custard apple fruit. Background Technology

[0002] Custard apple (scientific name: Annona squamosa (Linn.) is a deciduous small tree belonging to the Annonaceae family and the Annonaceae genus. Custard apples are rich in Vitamin C, which has a blood sugar-lowering effect and is an excellent antioxidant fruit, effectively delaying skin aging and whitening the skin. Custard apples are also high in fiber, effectively promoting intestinal peristalsis and eliminating accumulated waste. Normal growth of custard apples requires a warm climate and adequate rainfall; they are intolerant of frost and cold weather. The optimal growth temperature for common custard apples averages a maximum of 25-32℃ and a minimum of 15-25℃, with an optimal average temperature of 25-30℃ for fruit ripening. Low temperatures, especially below 13℃, can cause physiological diseases in the fruit, often resulting in rust spot and delayed ripening. Therefore, temperature is crucial for the growth of custard apple plants. Developing temperature-related genes and studying their regulatory functions is of great significance for the breeding of new custard apple varieties. Summary of the Invention

[0003] This invention provides a low-temperature responsive transcription factor and its application in regulating starch degradation in custard apple fruit, providing candidate genes for custard apple variety breeding.

[0004] The technical solution of the present invention is achieved as follows: The first aspect of the present invention is to provide a low-temperature responsive transcription factor AaHATL, which is a protein encoded by a gene with a nucleotide sequence as shown in SEQ ID NO:1.

[0005] A second aspect of the present invention is to provide a transcription factor gene encoding the low-temperature response transcription factor AaHATL as described in the first aspect of the present invention, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0006] A third aspect of the present invention is to provide a recombinant vector containing the coding region gene of the transcription factor AaHATL as described in the first aspect of the present invention.

[0007] The original vector for the recombinant vector can be a vector commonly used in the field of gene recombination, such as a virus or plasmid. This invention does not limit this. In one specific embodiment of this invention, the original vector is the pET30a plasmid; however, it should be understood that other plasmids or viruses can also be used.

[0008] Preferably, the original vector of the recombinant vector is the pET30a plasmid, and the coding region of the transcription factor AaHATL gene is located between the NcoI and SpeI restriction endonuclease sites of the pCAMBIA1304 expression vector.

[0009] A fourth aspect of the invention is to provide a host bacterium containing the coding region gene of the transcription factor AaHATL as described in the second aspect.

[0010] A fifth aspect of the present invention is to provide an expression cassette containing a gene encoding the transcription factor AaHATL as described in the second aspect of the present invention.

[0011] A sixth aspect of the present invention is to provide the use of the transcription factor AaHATL as described in the first aspect of the present invention, or the transcription factor gene as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in improving the growth activity of yeast on SD / -Leu medium containing an AbA inhibitory concentration of 300 ng / mL.

[0012] The seventh aspect of the present invention is to provide the application of the transcription factor AaHATL as described in the first aspect of the present invention, or the transcription factor gene as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in increasing the starch content of plant fruits.

[0013] Overexpression of transcription factor genes increases the starch content of tomato and / or custard apple fruits.

[0014] The eighth aspect of the present invention is to provide the use of the transcription factor AaHATL as described in the first aspect of the present invention, or the transcription factor gene as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in inhibiting the expression of the custard apple AaBAM3 gene, the nucleotide sequence of which is shown in SEQ ID NO:2.

[0015] The ninth aspect of the present invention is to provide the application of the transcription factor AaHATL as described in the first aspect of the present invention, or the transcription factor gene as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in increasing the soluble sugar content of tomato fruit and / or not decreasing the soluble solids content of tomato fruit.

[0016] The tenth aspect of the present invention is to provide the use of the transcription factor AaHATL as described in the first aspect of the present invention, or the transcription factor gene as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in delaying the ripening and softening of custard apples and / or extending the shelf life of custard apples.

[0017] The eleventh aspect of the present invention is to provide a primer pair, said primer pair being F:CCATTCTTCTATGGGCTTCC and R:TGGCTTGAACTATGGTGGA.

[0018] The beneficial effects of this invention are: This invention provides the first cloned transcription factor AaHATL from custard apple. Studies show that this transcription factor gene is located in the cell nucleus and is induced by low temperature at both the transcription and protein levels. It directly binds to the promoter region of the β-amylase gene AaBAM3, inhibiting AaBAM3 gene expression, suppressing starch degradation, and thus increasing starch content. Overexpression of this gene in tomato inhibits β-amylase gene expression, significantly increasing fruit starch content, which is beneficial for increasing the soluble solids content in mature tomatoes and improving tomato quality. Transient expression of this gene in custard apple significantly increases starch content, delays ripening and softening, and extends shelf life. This can be applied to improve the quality of custard apples, such as delaying ripening and softening, which is beneficial for storage and transportation, and also helps extend shelf life, thus ensuring improved economic benefits in the production and sales of custard apples. This invention provides a new candidate gene for the improvement of tomato and custard apple varieties, as well as research on delaying the shelf life and storage period of starch-storage-promoting fruits. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 Analysis of AaHATL gene expression during storage at different temperatures.

[0021] Figure 2 Analysis of AaHATL protein expression during storage at different temperatures.

[0022] Figure 3 Subcellular localization of AaHATL protein in tobacco leaf cells.

[0023] Figure 4 Validation experiments were conducted to verify the single-hybrid interaction between AaHATL and AaBAM3 yeast. Figure 5 This study investigated the luciferase complementation of the AaHATL and AaBAM3 promoter interactions.

[0024] Figure 6 The results show the gene expression level (Figures A and B), starch content (Figure C), and soluble solids content (Figure D) of the heterologous overexpression AaHAT22 transgenic line in tomatoes.

[0025] Figure 7 The results show the starch content of custard apple fruit after transient overexpression of the AaHATL gene. Detailed Implementation

[0026] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making any creative efforts shall fall within the scope of protection of the present invention.

[0027] Example 1

[0028] Acquisition of the AaHATL gene (1) AaHATL cloning primers: Collect AP custard apples ( Annona atemoya (Horse) The fruit is about 80% ripe, at which point the custard apple peel is yellowish-green, and the scale grooves between the eyes have spread. Immediately after harvesting, the fruit is transported back to the laboratory. Fruits of similar size and color, free from mechanical damage and pests / diseases, are selected and placed in a 15℃ artificial climate chamber for 4 days. The pulp is then harvested, and total RNA is extracted according to the method described in the Huayueyang RNA Extraction Kit. Reverse transcription is performed using the TaKaRa PrimeScript™ RT reagent Kit, and then reverse transcription is performed according to the manufacturer's instructions to convert the RNA into first-strand cDNA. Cloning primers are designed to amplify the gene sequence via PCR.

[0029]

[0030] (2) PCR system Prepare two 50 μL systems and perform the amplification reaction according to the following procedure:

[0031] (3) PCR procedure

[0032] (4) Gel running and sequencing Electrophoresis was performed on a 1% agarose gel at 5 V / cm for 20 minutes. The electrophoretic fragments were then excised under UV light, and the PCR amplification products were recovered using a PCR recovery kit. After purification, the products were ligated into the pMD-19T vector, and the positive bacterial culture was sent to Guangzhou Aiji Biotechnology Co., Ltd. for sequencing. The CDS sequence of AaHATL is shown in SEQ ID NO:1.

[0033] Example 2

[0034] AaHATL gene function verification

[0035] (1) Expression analysis of AaHATL gene during fruit storage After treating custard apple fruits at 28℃ and 15℃ for 0d, 2d, 4d, 6d, and 8d, the expression patterns of the AaHATL gene at the transcriptional and protein levels were analyzed.

[0036] The results are as follows Figure 1 and Figure 2 The following analysis shows the expression of transcription factors in fruits treated at room temperature (28℃) and low temperature (15℃) for 0-6 days. It was found that the AaHATL gene was induced at both 2 and 4 days under low temperature treatment, with higher expression levels at 2 and 4 days compared to room temperature. Simultaneously, the expression of AaHATL protein was analyzed at both room temperature (28℃) and low temperature (15℃) treatments for 0-8 days. Again, the protein expression level of AaHATL at 15℃ was higher than that at the same time point under 28℃ treatment. This indicates that AaHATL is induced at both the transcriptional and protein levels under low temperature.

[0037] Method and steps: 1) RT-qPCR analysis RNA was extracted from the pulp using the Huayueyang RNA Extraction Kit and then reverse transcribed into first-strand cDNA using the TaKaRa PrimeScript™ RTreagent Kit with gDNA Eraser (for quantitative PCR) according to its instructions.

[0038] Using the SYBR Green I dye method, a pair of internal control quantitative primers, qActin-F (GACACCATCCCCAGAATCC) and qActin-R (CCCCAGAAGAACACCCTGT), were designed based on the AaActin housekeeping gene cloned in previous work. The PCR product amplification length was 189 bp. The quantitative RT-PCR reaction system consisted of 10 μL of 2×DyNAmo color Flash SYBR Green master mix, 0.5 μL of template cDNA, 0.6 μL each of forward and reverse primers (qAaHATLF2: CCATCTTGTGAGAGGATTG; qAaHATLR2: GGTTGAAGAACTGGTGAG), and dd H2O was added to a final volume of 20 μL. The PCR reaction program was as follows: 95 ℃ for 5 min; 95 ℃ for 10 s, 59 ℃ for 20 s, 72 ℃ for 25 s (real-time fluorescence acquisition), 40 cycles; 95 ℃ for 5 s, 65 ℃ for 1 min, 97 ℃ continue, 40 ℃ for 30 s Melt (melting curve). Gene expression was measured using a 2- △△Ct Method calculation.

[0039] 2) Western blot analysis Protein purification and antibody preparation: The complete coding frame of the AaHATL gene was amplified by RT-PCR. After the PCR product was recovered, the target fragment and pET30a plasmid were digested with double enzymes, ligated, and a recombinant expression vector was constructed. The vector was then transformed into E. coli BL21 (DE3) competent cells to induce protein expression. The recombinant protein was then purified and sent to a professional antibody manufacturing company. The protein was transferred to rabbits to obtain the primary antibody, and the secondary antibody, goat anti-rabbit-HRP, was selected.

[0040] Protein extraction and Western blot analysis: 1 g of fruit pulp material was weighed and added to a certain volume of extraction buffer (0.1 mol / L Tris-HCl, 25 mmol / L EDTA, pH 7.5). After homogenization, the mixture was centrifuged at 12,000 r / min for 10 min. The protein in the supernatant was first quantified. Then, an appropriate volume of protein sample was mixed with an equal volume of 2×SDS loading buffer and incubated at 100 ℃ for 5 min before SDS-PAGE electrophoresis. After electrophoresis, the protein was electrotransferred to a nitrocellulose membrane (NC) and Western blot was performed according to standard methods.

[0041] (2) Subcellular localization analysis of AaHATL protein The subcellular localization of AaHATL protein was studied using a transient expression system in tobacco, and the results are as follows: Figure 3 As shown, the red fluorescent protein (mKATE) is widely dispersed in cells when it is not fused with other proteins. The fluorescent signal of mKATE fused to the N-terminus of AaHATL protein is localized to the cell nucleus, indicating that AaHATL is localized to the cell nucleus.

[0042] Method and steps: Construction and identification of expression vector: Primers were designed based on the CDS region of AaHATL (D5035_0S1(+): AACACGGGGGACTTTGCAACatgggcttccaagacttgtcctgc; D5035_0S1(-): CCTGAAGCGGCCGCTGTACAgcactttgtgggtgaacgattgaagg). After PCR amplification, the DNA was recovered by gel electrophoresis on a 1% agarose gel (the recovered product was labeled as: rDNAH1). After verification, the DNA was recombined with the vector.

[0043] Vector digestion and ligation: The pBWA(V)HS-CCDB-LK-mKATE vector (purchased from Wuhan Boyuan Biotechnology Co., Ltd.) was digested with BsaI / Eco31I. The digested vector was purified using a PCR purification kit. rDNA H1 was ligated into the pBWA(V)HS-CCDB-LK-mKATE vector using EasyClone Mix. The obtained ligation product was transformed into DH5α competent cells. After PCR amplification, enzyme digestion screening, and sequencing verification, positive clones were screened and plasmids were extracted to obtain the fusion expression vector pBWA(V)HS-AaHATL-LK-mKATE of mKATE and the target gene.

[0044] Transient transformation of tobacco leaves and observation by laser confocal microscopy: The constructed vector plasmid was electroporated into Agrobacterium EHA105 and cultured at 30 ℃ for 2 days; Agrobacterium was inoculated from solid culture medium into 10 mL YEB liquid medium and cultured in suspension. The suspension was resuspended and the OD was adjusted to about 0.6. The bacteria were injected into the lower epidermis of tobacco leaves and cultured under low light for 2 days. The tobacco leaves injected with labeled Agrobacterium were used to prepare slides and observed and photographed using a Nikon C2-ER laser confocal microscope.

[0045] The construction process of the [pBWA(V)HS-AaHATL-LK-mKATE] subcellular localization vector is as follows: 1) Synthesize the following target gene amplification primers. D5035_0S1 primer D5035_0S1(+): AACACGGGGGACTTTGCAACatgggcttccaagacttgtcctgc D5035_0S1(-): CCTGAAGCGGCCGCTGTACAgcactttgtgggtgaacgattgaagg 2) PCR system and procedure Prepare a 50 μL system and perform the amplification reaction according to the following procedure:

[0046] PCR program

[0047] The AaHATL electrophoresis fragment was extracted under UV light using 1% agarose gel electrophoresis at 5V / cm for 20 minutes. The fragment was then placed in a system for sol-gel recovery, following the instructions of the specific manufacturer's kit. The DNA was dissolved and recovered using 40µL of water (the recovered product was labeled as rDNAH1). After verification, the DNA was recombined with the vector.

[0048] 3) Vector enzyme digestion Enzyme ligation system and reaction conditions

[0049] The vector digests were purified using a PCR purification kit (the purified product was labeled pBWA(V)HS-CCDB-LK-mKATE(D)) for use in the next in vitro or in vivo recombination reaction.

[0050] 4) Recombination reaction

[0051] The ligation product was transformed into competent cells.

[0052] 5) Transformation Transform 5-10 μL of the ligation product into competent E. coli cells, plate the transformed cells onto Kans resistant plates, incubate at 37°C for 12 hours, and then perform plaque PCR identification.

[0053] 6) Plaque PCR identification Ten bacterial colonies were selected and simultaneously inoculated into 1.5 mL EP tubes for PCR identification. Primers: pBWA(V)HS-CCDB-LK-mKATE identification primers: Pbw2+:GCAACGCTCTGTCATCGTTACAAT (10236bp); D5035 (405C):caaggtcttgagctcatgcaa (3503bp). PCR system Perform 10 PCR reactions in 25 μL systems: PCR system

[0054] PCR program

[0055] The target band is a fragment of approximately 6753 bp. Take 100 μL of bacterial culture corresponding to 1-3 positive bands for sequencing, and inoculate the remaining 400 μL of bacterial culture into a tube containing 5-10 ml of Kan-resistant LB. Shake the tubes and wait for the sequencing results. Take the tube corresponding to the correct sequencing and extract the plasmid.

[0056] (3) Verification of single-hybrid interaction between AaHATL and AaBAM3 yeast The AaBAM3 gene promoter segment pAaBAM3-B (nucleotide sequence shown in SEQ ID NO:3), predicted to contain a cold-response cis-acting element, was synthesized using gene synthesis methods. The segment, 146 bp in length, was then ligated to pAaBAM3-B using the ClonExpress II One Step Cloning Kit homologous recombinase to construct the bait vector pAbAi-BAM3-B. The pGADT7-AaHATL plasmid was derived from a positive clone after single-hybrid screening. Furthermore, yeast was co-transformed with the plasmid containing pGADT7-AaHATL and the plasmid containing pAbAi-BAM3-B, and cultured on SD / -Leu / AbA 300 ng / ml plates for selective culture. Growth on the plate indicated that the transcription factor recognized and bound the target gene promoter sequence.

[0057] Results Analysis: Using yeast one-hybrid technology, the transformation products of various combinations were plated on SD / -Leu auxotrophic medium (SD medium lacking leucine) and SD / -Leu auxotrophic medium containing 300 ng / mL aureobasidin A (also known as short-stemmycin A, AbA). Yeast growth was observed after incubation at 30 ℃ for 3 days. Single colonies were randomly picked from each plate, diluted to different concentrations, and 5 μL were spotted onto yeast auxotrophic medium (SD / -Leu) and SD / -Leu medium containing an inhibitory concentration of 300 ng / mL AbA. The results are as follows: Figure 4As shown. Except for the negative control, the positive control and the combination of transcription factor and AaBAM3 promoter can grow normally on SD / -Leu medium containing 300 ng / mL AbA inhibitory concentration, indicating that transcription factor AaHATL interacts with the promoter of AaBAM3 (whose nucleotide sequence is shown in SEQ ID NO:3).

[0058] Method and steps:

[0059] Construction of the decoy carrier (pAbAi-pBAM3-B) 1) Carrier construction process 2) Linearize 2 μg of pBait-AbAi recombinant plasmid using BstBI or BbsI restriction endonucleases, following the enzyme digestion system below:

[0060] 3) Integrate 1 μg of linearized pBait-AbAi plasmid into the Y1HGold strain, plate it on SD / -Ura plates, and incubate for 3-5 days; 4) Select 4-5 single clones from the SD / -Ura plate and identify them using a Matchmaker® Insert Check PCRMix 1. Electrophoresis is used to determine if the insert band size is correct, i.e., whether the vector has been correctly integrated into the yeast genome. Correctly identified clones can then be preserved.

[0061] Prey carrier construction (pGADT7-AaHATL) The plasmid was derived from pGADT7-AaHATL, a positive clone after single-hybrid screening.

[0062] 1) Select PCR-positive clones, inoculate them into 2 ml of liquid SD / -Leu medium, and culture them in a shaker at 30°C for 2 days. Extract yeast plasmids using a yeast plasmid extraction kit. 2) Take 1-5 ml of yeast culture, centrifuge at 12000 rpm for 1 min, and remove as much supernatant as possible; 3) Add 300 μl of sorbitol buffer and 50 U of cell lysin to the bacterial cells, mix thoroughly, and treat with shaking at 200 rpm for 1 h at 30°C; centrifuge at 4000 rpm for 10 min, discard the supernatant, collect the precipitate; add 250 μl of solution YP1; 4) Add 250 μl of YP2 solution to the tube, gently invert 6-8 times to thoroughly mix the bacteria, and incubate at room temperature for 5-10 min; Note: Mix gently, do not shake violently to avoid contaminating the genomic DNA; at this point, the bacterial culture should become clear and viscous; 5) Add 350 μl of YP3 solution to the tube and immediately gently invert it 6-8 times to mix thoroughly. A white flocculent precipitate will appear at this time. Centrifuge at 12000 rpm for 20 min. Note: Mix immediately after adding YP3 to avoid local precipitation. If there is still a small white precipitate in the supernatant, centrifuge again and take the supernatant. 6) Carefully add the supernatant to the adsorption column CP2, centrifuge at 12000 rpm for 1 min, discard the waste liquid, and place the adsorption column into the collection tube; 7) Add 500 μl of buffer PD to the adsorption column, centrifuge at 12000 rpm for 1 min, and discard the waste liquid; 8) Add 600 μl of PW washing solution to the adsorption column, centrifuge at 12000 rpm for 1 min, discard the waste liquid, and place the adsorption column into the collection tube. 9) Repeat step 8). 10) Place the adsorption column into the collection tube and centrifuge at 12,000 rpm for 2 minutes to remove residual washing solution from the adsorption column. Note: Residual ethanol in the washing solution will affect subsequent enzyme reaction experiments. It is recommended to open the adsorption column and let it stand at room temperature for several minutes. 11) Place the adsorption column CP2 in a clean centrifuge tube, add 50-100 μl of elution buffer EB to the center of the adsorption membrane, incubate at room temperature for 2 min, centrifuge at 12000 rpm for 2 min to collect the plasmid solution into the centrifuge tube; Note: Too little elution buffer will affect the recovery efficiency; a pH value of elution buffer below 7.0 will reduce the elution efficiency; 12) Obtain plasmids for amplification.

[0063] One-to-one interaction verification between plasmid (pGADT7-AaHATL) and plasmid (pAbAi-pBAM3-B): 1) Streak the Y1HGold (pAbAi-BAM3-B) yeast strain on SD / -Ura solid medium and incubate upside down in a 30°C incubator for 2-3 days; 2) Pick single clones with a diameter of 2-3 mm and place them in 3 ml of YPDA culture medium, and culture them at 30°C and 250 rpm for 8 h. 3) Pipette 2-5 μl into 50 ml of YPDA (250 ml Erlenmeyer flask), and incubate at 30°C with shaking at 230-250 rpm for 16-20 h until OD600 = 0.15-0.3; 4) Centrifuge at 700 g for 5 min at room temperature, remove the supernatant, and resuspend the bacterial cells in 100 ml of fresh culture medium; incubate at 30°C with shaking at 230-250 rpm for 3-5 h until OD600 = 0.4-0.5; 5) Centrifuge at 700 g for 5 min at room temperature to collect the cells, discard the supernatant and resuspend the yeast in 60 ml of sterile deionized water; 6) Centrifuge at 700 g for 5 min at room temperature to collect the cells, discard the supernatant and resuspend the yeast in 3 ml of 1.1 x TE / LiAc solution; at the same time, pre-denature the carrier DNA twice; 7) Centrifuge at high speed for 15 s, remove the supernatant, add 600 μl of 1.1 x TE / LiAC solution and mix well by pipetting, then set aside. 8) Take 50 μl of yeast resuspension from step 7, add 10 μl of pre-denatured carrier DNA and 200 ng of Prey plasmid pGADT7-AaHATL to the bacterial culture, and mix gently. 9) Add 300 μl of 1x PEG / LiAc and mix well; 10) Heat in a 30°C water bath for 30 minutes, shaking well every 10 minutes; 11) Add 20 μl of DMSO to each tube and mix gently; 12) Heat shock in a 42°C water bath for 15 minutes, inverting the container every 5 minutes to mix thoroughly; 13) Centrifuge at high speed for 15 seconds, discard the supernatant; resuspend the bacterial cells in 1 ml YPD Plus, and revive at 30°C with shaking at 250 rpm for 1 h; 14) Centrifuge at high speed for 15 seconds, then discard the supernatant; 15) 100 μl 0.9% NaCl; 16) Incubate at 30°C. Resuspend the bacterial cells and spread them on SD / -Leu / 300 ng / mL AbA plates for 3-5 days. Positive clones are expected to grow.

[0064] (4) Dual-luciferase assay (LUC assay) The transcription factor gene AaHATL was constructed into the expression vector pGreenII-62-SK to obtain the [pGreenII-62-SK-AaHATL] vector. AaBAM3The promoter (pAaBAM3-J3) was constructed into the pGreenⅡ080-LUC vector to obtain the vector [pGreenⅡ0800-LUC-pAaBAM3-J3 (723bp)]. The pGreenⅡ0800 vector contains a 35S::REN and a LUC fluorescent tag driven by the target promoter. The nucleotide sequence of pAaBAM3-J3 is shown in SEQ ID NO:4. The two successfully constructed vectors were co-transformed into Agrobacterium GV3101 strain. Tobacco plants with good growth were selected, and the injection was performed from the lower epidermis of tobacco leaves using a 1mL syringe without the pipette tip, and the plants were labeled. The injected tobacco plants were cultured under low light for 2 days, injected with 1mM fluorophore, and placed in the dark for 7 minutes before detection. Collect the injected tobacco leaves, freeze-mill them in liquid nitrogen, add an appropriate amount (100 μL) of 1×Cell Lysis Buffer, let them stand or shake at room temperature for 5 min to lyse, pipette and aspirate the cell lysate into a 1.5 mL centrifuge tube, centrifuge at 12000 g at room temperature for 2 min, and take the supernatant for subsequent detection to determine the LUC fluorescence and REN fluorescence luminescence signals of the tobacco leaves.

[0065] Results analysis: From Figure 5 It can be seen that AaHATL can negatively regulate the activity of the AaBAM3 promoter and inhibit the expression of AaBAM3.

[0066] The construction process of the [pGreenII0800-LUC-pAaBAM3-J3 (723bp)] vector is as follows: 1. Synthesize the following pair of primers. 1:BAM3-J3 primers BAM3-J3(+):ggccccccctcgaggtcgacggtatcgatagatagccattaaccaatctaggtag BAM3-J3(-):tatgtttttggcgtcttccatggtcccccgttttcctgagcaatgaagtaaaaat 2. PCR system Prepare a 50 μL system and perform the amplification reaction according to the following procedure:

[0067] PCR system

[0068] PCR program

[0069] The BAM3-J3 (723bp) fragment was extracted by 1% agarose gel electrophoresis at 5V / cm for 20 minutes under UV light and placed in a system for sol-gel recovery. The recovery procedure is shown in the kit instructions of the specific manufacturer. The recovered DNA was dissolved and recovered in 40μL of water (the recovered product was labeled as: rDNAG1). After verification, it was recombined with the vector.

[0070] 3. Vector enzyme digestion Enzyme digestion and ligation system:

[0071] Reaction conditions: temperature 37℃, time 1 h The vector digests were purified using a PCR purification kit (the purified product was labeled pGreenII 0800-LUC-ccdb(D)) for use in the next in vitro or in vivo recombination reaction.

[0072] Recombination reaction system

[0073] Recombination reaction procedure: temperature 37℃, time 30 h The ligation product was transformed into competent cells.

[0074] Transformation Transform 5-10 μL of the ligation product into competent E. coli cells, then into kanamycin-resistant agar plates, incubate at 37°C for 12 hours, and perform plaque PCR identification.

[0075] 6. Plaque PCR identification Ten plaques were selected and simultaneously inoculated into 1.5 ml EP tubes for PCR identification; primers: pGreenII 0800-LUC-ccdb identification primers P1 (F:gttgtaaaacgacggccagt), P2 (R:caattgttccaggaaccagg).

[0076] PCR system Perform 10 PCR reactions in 25 μL volumes each:

[0077] PCR system

[0078] PCR program

[0079] The target band is a fragment of approximately 823 bp. Take 100 μL of bacterial culture corresponding to 1-3 positive bands for sequencing, and inoculate the remaining 400 μL of bacterial culture into 5-10 ml of kanamycin-resistant LB. Shake the test tubes and wait for the sequencing results. Take the tube corresponding to the correct sequencing and extract the plasmid.

[0080] The construction process for the [pGreenII-62-SK-AaHATL] vector is as follows: 1. Synthesize the following pair of primers. 1: HATL primers HATL(+):cagtTTTCGCAGCATCTAACGAGCTCTTCGcaccgtagagtgacatgcggataa HATL(-):cagtTTTCGCAGCATCTAACGAGCTCTTCGagcgggcttgaactatggtggatc 2. PCR system Prepare a 50 μL system and perform the amplification reaction according to the following procedure:

[0081] PCR system

[0082] Using 1% agarose gel electrophoresis at 5V / cm for 20 minutes, the AaHATL (965bp) fragment was excised under UV light and placed in a system for sol-gel recovery. The recovery procedure is detailed in the manufacturer's kit instructions. The recovered DNA was dissolved and recovered in 30μL of water (the recovered product was labeled as rDNAH1). After verification, it was ligated into the vector.

[0083] 3. Vector enzyme digestion Enzyme digestion and ligation system and reaction conditions:

[0084] 4. rDNAH1 restriction enzyme digestion Enzyme digestion and ligation system and reaction conditions:

[0085] The vector digest and the recovered fragment digest were combined and purified using a PCR purification kit (the purified product was labeled as P-rDNAH1) for use in the next ligation reaction.

[0086] 5. Connection reaction DNA ligation system and reaction conditions:

[0087] The ligation product was transformed into competent cells.

[0088] 6. Transformation Transform 5-10 μL of the ligation product into competent E. coli cells (see standard method for transformation of competent E. coli cells), transform into kanamycin-resistant plates, incubate at 37°C for 12 hours, and perform plaque PCR identification.

[0089] 7. Plaque PCR identification Ten plaques were selected and simultaneously inoculated into 1.5ml EP tubes for PCR identification. Primers: pGreenII-62-SK-ccdb identification primers 62sk-F (tctccactgacgtaagggat), 62sk-R (caacacatgagcgaaaccc).

[0090] PCR system Perform 10 PCR reactions in 25 μL volumes each:

[0091]

[0092] The target band is a fragment of approximately 1065 bp. Take 100 μL of bacterial culture corresponding to 1-3 positive bands for sequencing, and inoculate the remaining 400 μL of bacterial culture into LB culture containing kanamycin resistance. Shake the test tubes to allow the bacteria to mature. After the sequencing results are obtained, extract the plasmid from the tube corresponding to the correct sequencing.

[0093] Steps of the instantaneous conversion method for tobacco: 1. Tobacco Cultivation: Sow a number of tobacco seeds, cultivate under 12 hours of light, and the culture can be used for experiments after one month; 2. Agrobacterium culture: The constructed vector plasmid was electroporated into Agrobacterium (GV3101) and cultured at 30℃ for 2 days; 3. Suspended Agrobacterium: Use an inoculation loop to scrape Agrobacterium from the solid culture dish and inoculate it into 10 mL of YEB liquid medium, and incubate at 170 rpm / min for 1 h; 4. Collect bacterial cells: Centrifuge at 4000 rpm / min for 4 min, and discard the supernatant; 5. Resuspension: Resuspend the bacterial cells in 10 mM MgCl2 (containing 120 uM AS) suspension and adjust the OD to about 0.6 from 600. 6. Injection: Select tobacco plants in good condition, use a 1mL syringe (without the nozzle) to inject the tobacco leaves from the lower epidermis, and make a label. 7. Culture: Culture the injected tobacco plants in low light for 2 days, then inject 1mM fluorescein and place them in the dark for 7 minutes before detection. 8. Fluorescence value detection (1) Cell lysis: Collect tobacco leaves, freeze and grind them with liquid nitrogen, add an appropriate amount (100 μL) of 1×Cell Lysis Buffer, let stand or shake at room temperature for 5 min to lyse, pipette and aspirate the cell lysis products into a 1.5 mL centrifuge tube, centrifuge at 12000 g at room temperature for 2 min, and take the supernatant for subsequent detection.

[0094] (2) Firefly luciferase reaction detection: Add 100 μL of Luciferase Substrate equilibrated to room temperature into the detection tube or microplate, carefully aspirate 20 μL of cell lysis supernatant into the detection tube or microplate well, mix quickly, and immediately detect the Firefly luciferase reporter gene activity in a fluorescence detector (Luminometer) or microplate reader.

[0095] (3) Renilla luciferase reaction detection: Add 100 μL of freshly prepared Renilla substrate working solution to the above reaction solution, mix quickly and immediately detect the activity of Renilla luciferase reporter gene in a fluorescence detector or microplate reader. Each detection is performed in 3 replicates.

[0096] (5) Genetically modified tomatoes 1) Construction of AaHATL overexpression vector: according to AaHATL Primers containing homologous recombination sequences were designed for the CDS region (40547_0(+):aacacgggggactttgcaacatgggcttccaagacttgtcctgc; 40547_0(-):gatctaccatgcactttgtgggtgaacgattgaagg). After PCR amplification, the DNA was recovered by gel electrophoresis on a 1% agarose gel (the recovered product was labeled as: rDNAHG2). After verification, the DNA was recombined with the vector.

[0097] Vector digestion and ligation: pBWA(V)HS vector (pBWA(V)HS-ccdB) was digested with BsaI / Eco31I. The digested vector was purified using a PCR purification kit. rDNAHG2 was ligated into pBWA(V)HS vector using 2*EasyClone Mix. The ligation product was transformed into DH5α competent cells. After PCR amplification, enzyme digestion screening, and sequencing verification, positive clones were screened and plasmids were extracted to obtain the fusion expression vector pBWA(V)HS-AaHATL of AaHATL and the target gene.

[0098] 2) Agrobacterium-mediated genetic transformation: Sterilized seeds were evenly sown on MS solid medium and placed in a light incubator to await germination. Pre-cultured cotyledons were then immersed in Agrobacterium-containing bacterial suspension resuspended in MS liquid medium and co-cultured for 2 days. The cotyledons were then transferred to differentiation solid medium. The medium was incubated at 25°C (16 h) under light and 20°C (8 h in darkness). The medium was changed every three weeks until callus formation. After callus formation, it was transferred to growth solid medium to induce budding and seedling development. Once the callus differentiated into growth points, the callus tissue around the growth points was removed, and the seedlings were transferred to MS solid medium for root selection.

[0099] 3) Screening of positive transgenic tomato seedlings: The genome was extracted by SDS method, and the extracted genome was identified by PCR. Positive plants were screened using antibiotic markers.

[0100] (I) The construction process of the [pBWA(V)HS-AaHATL overexpression-GUS fusion] vector is as follows: 1. Synthesize the following primers. 40547_0(+):aacacgggggactttgcaacatgggcttccaagacttgtcctgc 40547_0(-):gatctaccatgcactttgtgggtgaacgattgaagg 2. PCR system Prepare two 50 μL systems and perform the amplification reaction according to the following procedure:

[0101]

[0102] Using 1% agarose gel electrophoresis at 5V / cm for 20 minutes, the electrophoretic fragment of AaHATL (810bp)GUS (2053bp) was excised under UV light and placed in a system for sol-gel recovery. The recovery procedure is detailed in the manufacturer's kit instructions. The recovered DNA was dissolved and recovered in 40μL of water (the recovered product was labeled as rDNAHG2). After verification, it was recombined with the vector.

[0103] 3. Vector digestion Enzyme digestion ligation system and reaction conditions

[0104] The vector digests were purified using a PCR purification kit (the purified product was labeled as pBWA(V)HS-ccdB(D)) for use in the next in vitro or in vivo recombination reaction.

[0105] 4. Recombination reaction

[0106] The ligation product was transformed into competent cells.

[0107] 5. Transformation Transform 5-10 μL of the ligation product into competent E. coli cells, then transform them into kanamycin-resistant plates, incubate at 37°C for 12 hours, and perform plaque PCR identification.

[0108] 6. Plaque PCR identification Ten bacterial plaques were selected and simultaneously inoculated into 1.5 mL EP tubes for PCR identification. Primers: pBWA(V)HS-ccdB identification primers: HS)35seq:tTCATTTGGAGAGAACACGGGggac(2861bp) M40547(573C):gtgagggtggctgcagga(3553bp). PCR system Perform 10 PCR reactions in 25 μL volumes each:

[0109] The target band is a fragment of approximately 712 bp. Take 100 μL of bacterial culture corresponding to 1-3 positive bands for sequencing, and inoculate the remaining 400 μL of bacterial culture into LB containing 5-10 mL of kanamycin-resistant culture. Shake the tubes and wait for the sequencing results. Take the tube corresponding to the correct sequencing and extract the plasmid.

[0110] (II) The steps for Agrobacterium-mediated transformation are as follows: 1. Preparation of Agrobacterium 1.1 Plasmid Transformation Add 1 µL of plasmid to 50 µL of GV3101 Agrobacterium competent cells, mix thoroughly, and then transfer to an electroporation cuvette. After electroporation, add 1 mL of LB liquid medium, mix thoroughly, and then transfer to a 1.5 mL centrifuge tube. Incubate in a shaker at 30 °C and 180 rpm for 30 min. Inoculate 50 µL of the activated Agrobacterium culture onto LB solid medium and incubate in the dark at 30 °C for 48 h.

[0111] 1.2 Agrobacterium detection 1.2.1 Synthesize the corresponding detection primers; 1.2.2 As shown in the table below, prepare the PCR amplification system. After preparation, mix thoroughly and use a PCR instrument for amplification. The amplification program should be set according to the primer information, etc.

[0112] 1.2.3 Gel electrophoresis detection: Prepare a 1% agarose gel (weigh 1.5g of agarose powder and dissolve it in 150mL of 1×TAE buffer, microwave for about 3 minutes until the liquid becomes transparent. Add EB to the gel casting plate, pour the dissolved agarose liquid into the plate, mix well, insert the comb, and let it stand for 40 minutes until the gel turns milky white), spot the sample, and complete the electrophoresis process.

[0113] 1.2.4 Check the PCR amplification results. If the electrophoresis bands of the positive control and the sample are clear and the correct size, and the negative control has no band, it indicates that the sample can proceed to the next step.

[0114] 2. Genetic transformation of tomatoes 2.1 Seed disinfection Rinse with sterile water for 2 minutes, disinfect with 75% alcohol for 40 seconds, rinse with 84 disinfectant for 7 minutes, rinse with sterile water 3 times, and soak in sterile water for 1 hour.

[0115] 2.2 Sowing After sterilization, tomato seeds were sown on germination medium and cultured in the dark for 3-4 days. Once the seeds showed signs of germination, they were placed in a light-lit tissue culture box for 4-5 days.

[0116] 2.3 Preparation and pre-culture of explants Once the tomato seedlings have fully expanded their cotyledons, use a scalpel to remove the cotyledon petioles and tips, leaving the middle portion. Cut the petioles into 2-3 segments and inoculate them into a pre-culture medium. Pre-culture at 23±2 ℃ for 2-3 days.

[0117] 2.4 Agrobacterium infection and co-culture Agrobacterium was picked and placed in the infection solution to prepare an Agrobacterium resuspension with OD600 = 0.1; after infecting for 10-15 min, the dried explants were inoculated into a co-culture medium and cultured in the dark at 23±2 ℃ for 2 days.

[0118] 2.5 Screening and Differentiation Rooting The recovered callus was inoculated onto selection medium and cultured at 23°C under 16h / 8h light / dark conditions for 15-30 days. The selected callus was then inoculated onto differentiation medium and cultured at 23°C under 16h / 8h light / dark conditions for 30-40 days. When the seedlings to be differentiated grew to about 2-3cm, they were removed from the callus and inoculated onto rooting medium, and cultured at 23°C under 16h / 8h light / dark conditions for 10-15 days.

[0119] 2.6 Detection Genomic DNA was extracted from tomatoes using the CTAB method and then detected by PCR.

[0120] (6) Instantaneous transformation of custard apple fruit Select mature 'AP' custard apples that are 120 days after flowering, free from pests, diseases, and mechanical damage, and pick them for later use. Transform Agrobacterium tumefaciens (GV3101-pSoup-p19 strain) with the empty vector and pGreenII-62-SK-AaHATL plasmid. Spread the transformed material on LB agar plates (containing 50 mg / L kanamycin and 34 mg / L rifampin) and incubate at 28°C for 2 days. Select single colonies for PCR identification. Pick positive clones and incubate them in 3 mL of LB medium (containing 50 mg / L kanamycin and 34 mg / L rifampin) overnight at 28°C and 200 rpm. Take 1 mL of the bacterial culture and transfer it to 20 mL of the same medium. Shake the culture at 28°C and 200 rpm for 6-8 hours until OD600 ≈ 0.8. Resuspend the culture in an equal volume of infection solution (10 mM MES (2-morpholinoethanesulfonic acid), 10 mM MgCl2, 150 μM AS (acetylsyl syringone)) and incubate in the dark at 28°C for 1-3 hours.

[0121] Inject 0.2 mL of pGreenII-62-SK-AaHATL into each custard apple fruit using a 1 mL syringe. Five injection sites are made on each fruit, one for the empty control and five for pGreenII-62-SK-AaHATL, with each site containing 0.2 mL. Inject 5-10 fruits, place them in a 28℃ incubator for 5 days, and then cut the pulp for starch content determination.

[0122] (7) Expression analysis of AaHATL and SIBAM genes in fruits of transgenic tomato lines The expression levels of AaHATL and SIBAM in transgenic fruit lines were analyzed using the RT-qPCR method described in "(1) Expression Analysis of AaHATL Gene during Fruit Storage". Internal references SITUA-F: ATGAGATTTGCCATCAGGG, SITUA-R: ATTGCATGACAAGGACCG. Primers for SIBAM1-1260, SIBAM3-3650, and SIBAM3-5160 are shown in Table 1.

[0123] Table 1 Primer sequences

[0124]

[0125] Three overexpressing transgenic tomato lines (OE#1, OE#2, and OE#3) and one wild-type line (WT) were selected as controls. Fruits were sampled 35 days after flowering (the color-breaking stage, when the fruit begins to turn red), with 10 fruits taken from each line. Starch content and soluble solids content (soluble sugar content) were determined. Starch content was determined using the anthrone colorimetric method (using a kit from Suzhou Gres Biotech Co., Ltd., catalog number: G0507W). Soluble solids content was directly determined using a handheld refractometer (portable saccharimeter).

[0126] The results are as follows Figure 6 As shown in Figure A, the AaHAL gene could not be amplified in wild-type tomatoes. The three transgenic lines showed varying degrees of high expression of AaHAL, indicating that overexpression of the AaHAL gene in tomatoes was effective. One SIBAM1 gene and two SIBAM3 genes were identified in the tomato genome. Analysis of their expression in the fruits of the three transgenic lines revealed that the expression of all three β-amylase genes (BAM) was inhibited to varying degrees in the fruits of the transgenic lines compared to the wild type. Figure 6 (B in the text). This indicates that overexpression of the AaHAL gene can suppress the expression of the BAM gene.

[0127] Results of starch content determination in tomato fruit ( Figure 6 The results (C) show that the starch content of all three transgenic lines was significantly higher than that of the wild type, while the soluble solids content not only did not decrease, but actually increased to some extent. Figure 6 (D in the text). This indicates that by inhibiting BAM expression, the transgenic tomato line effectively increased the starch content in tomato fruit without reducing the soluble solids content (soluble sugar content).

[0128] (8) Determination of starch content in instantaneously converted custard apple fruit like Figure 7 As shown, transient overexpression of the AaHATL gene in custard apple fruit significantly increased the starch content of the fruit.

[0129] Starch content gradually accumulates during fruit growth and development, and is degraded into soluble sugars during ripening, increasing the fruit's sweetness. The fruit ripening process is divided into three stages: cell division, starch accumulation, and fruit ripening. Starch accumulation begins after cell division, and degradation begins during ripening, until the fruit is fully ripe, at which point almost all of the starch has been converted into soluble sugars. Before ripening, the large amount of starch in the fruit is crucial for maintaining the firmness of the flesh. Starch provides support to cells, maintaining overall turgor pressure, and post-harvest softening is related to starch degradation. Therefore, early starch accumulation in the fruit is more conducive to increasing sugar content, while regulating starch degradation in the later stages helps maintain fruit firmness, which is beneficial for post-harvest transportation and storage.

[0130] Tomato fruit ripening generally occurs in four stages: green ripening, color breaking (color changing), ripening, and full ripening. During the green ripening stage, starch in the tomato fruit begins to degrade, until the fruit is fully ripe, at which point all starch is converted into soluble sugars. In this invention, overexpression of the AaHATL gene can increase the starch content in unripe tomato fruit, while the soluble solids content (soluble sugar content) does not decrease but rather increases to varying degrees. Therefore, overexpression of the AaHATL gene can increase starch accumulation in tomato fruit without affecting the soluble solids content (soluble sugar content), providing more starch for conversion into soluble sugars during the subsequent ripening process, thus increasing the sugar content of ripe tomatoes and improving their taste and quality. For ripe custard apples, the increased starch content after harvest can delay the softening process, extending the shelf life and making post-harvest transportation and storage more beneficial.

[0131] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A low-temperature responsive transcription factor AaHATL, characterized in that, It is a protein encoded by a gene with a nucleotide sequence as shown in SEQ ID NO:

1.

2. A transcription factor gene encoding the low-temperature response transcription factor AaHATL as described in claim 1, characterized in that, Its nucleotide sequence is shown in SEQ ID NO:

1.

3. A recombinant vector, host bacterium, or expression cassette containing the AaHATL coding region gene of claim 1.

4. The use of the transcription factor AaHATL as described in claim 1, or the transcription factor gene as described in claim 2, or the recombinant vector, host bacterium, or expression cassette as described in claim 3 in improving the growth activity of yeast on SD / -Leu medium containing an AbA inhibitory concentration of 300 ng / mL.

5. The application of the transcription factor AaHATL as described in claim 1, or the transcription factor gene as described in claim 2, or the recombinant vector, host bacterium, or expression cassette as described in claim 3, in increasing the starch content of plant fruits, characterized in that... Overexpression of the aforementioned transcription factor gene increases the starch content of plant fruits, wherein the plant is tomato and / or custard apple.

6. The application of the transcription factor AaHATL as described in claim 1, or the transcription factor gene as described in claim 2, or the recombinant vector, host bacterium, or expression cassette as described in claim 3 in inhibiting the expression of the custard apple AaBAM3 gene, wherein the nucleotide sequence of the custard apple AaBAM3 gene is shown in SEQ ID NO:

2.

7. The application of the transcription factor AaHATL as described in claim 1, or the transcription factor gene as described in claim 2, or the recombinant vector, host bacterium, or expression cassette as described in claim 3 in increasing the soluble sugar content of tomato fruit and / or not decreasing the soluble solids content of tomato fruit.

8. The application of the transcription factor AaHATL as described in claim 1, or the transcription factor gene as described in claim 2, or the recombinant vector, host bacterium, or expression cassette as described in claim 3 in delaying the ripening and softening of custard apples and / or extending the shelf life of custard apples.

9. A primer pair, characterized in that, The primer pairs are F: CCATTCTTCTATGGGCTTCC and R: TGGCTTGAACTATGGTGGA.

Images