Use of plant autophagy activators to improve resistance to citrus canker
By activating the autophagy pathway in citrus plants and using autophagy activators to enhance autophagy gene expression, the problem of citrus canker disease control has been solved, achieving efficient and environmentally friendly disease control that meets the requirements of green agricultural development.
Patent Information
- Application Number
- CN202510959752.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-11
- Publication Date
- 2026-05-08
- Estimated Expiration
- 2045-07-11
AI Technical Summary
In the current technology, the prevention and control of citrus canker mainly relies on chemical pesticides, which leads to pathogen resistance and environmental pollution. There is a lack of low-residue, high-efficiency and safe control strategies, and the molecular mechanism of autophagy regulating citrus resistance to canker is unclear.
Plant autophagy activators were used to enhance the resistance of citrus to bacterial canker by activating the autophagy pathway and increasing the expression of autophagy genes, especially FhATG6, FhATG7, FhATG8A and FhATG13 genes.
It significantly enhances the resistance of citrus to bacterial canker, provides an environmentally friendly control method, meets the requirements of green agriculture, expands the new applications of plant pathological control, enriches the theory of disease resistance, and provides a reference for the prevention and control of diseases in other crops.
Smart Images

Figure CN120843536B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to the application of plant autophagy activators in improving resistance to citrus canker. Background Technology
[0002] Citrus canker is one of the most serious bacterial diseases affecting the citrus industry, severely impacting fruit appearance, yield, and commercial value. To date, the control of citrus canker has primarily relied on chemical pesticides such as copper-based agents. However, long-term use easily leads to pathogen resistance and environmental pollution, which is inconsistent with the green development concept of the citrus industry. Therefore, developing new, low-residue, highly effective, and safe control agents has become an urgent need for the sustainable development of the industry.
[0003] Autophagy is a fundamental metabolic mechanism widely present in eukaryotes. Its core function is to isolate damaged components and metabolites through membrane structures and transport them to vacuoles, thereby achieving the decomposition and reuse of substances. As a conserved cellular cycling mechanism in eukaryotes, autophagy plays an important role in plant defense against pathogens. Early studies confirmed that autophagy is involved in the defense responses against gray mold in Arabidopsis thaliana and Huanglongbing (HLB) in citrus. However, the molecular mechanisms by which autophagy regulates resistance to citrus canker remain unclear, especially regarding strategies for disease control through activation of the autophagy pathway by exogenous inducers, which lack both theoretical and practical basis. Summary of the Invention
[0004] The purpose of this invention is to provide the application of plant autophagy activators in enhancing resistance to citrus canker, thereby addressing the problems existing in the prior art. This invention has found that plant autophagy activators can enhance resistance to citrus canker by promoting autophagy, thus providing important technical support for the prevention and control of citrus canker.
[0005] To achieve the above objectives, the present invention provides the following solution:
[0006] This invention provides the application of plant autophagy activators in improving resistance to citrus canker.
[0007] This invention also provides the application of plant autophagy activators in the preparation of formulations that enhance resistance to citrus canker.
[0008] Furthermore, the plant autophagy activator enhances citrus canker resistance by increasing the expression of plant autophagy genes.
[0009] Furthermore, the autophagy genes include the FhATG6 gene, FhATG7 gene, FhATG8A gene, and FhATG13 gene;
[0010] The nucleotide sequences of the FhATG6 gene, the FhATG7 gene, the FhATG8A gene, and the FhATG13 gene are shown in SEQ ID NO. 1 to 4, respectively.
[0011] The present invention also provides a FhATG7 gene that regulates the resistance of citrus to citrus canker, the nucleotide sequence of which is shown in SEQ ID NO.2.
[0012] This invention also provides the application of the above-mentioned FhATG7 gene in regulating the resistance of citrus to citrus canker.
[0013] The present invention also provides a method for the prevention and control of citrus canker, including the step of activating the autophagy pathway of citrus plants to improve their resistance to canker.
[0014] Furthermore, the autophagy pathway was activated by applying a plant autophagy activator to the citrus plants.
[0015] The present invention discloses the following technical effects:
[0016] This invention reveals the positive regulatory role of the autophagy pathway mediated by autophagy genes in citrus resistance to bacterial canker, and for the first time applies plant autophagy activators to enhance citrus resistance to bacterial canker. The study found that plant autophagy activators can effectively activate the autophagy pathway in citrus, thereby significantly enhancing its resistance to bacterial canker. This discovery provides a solid theoretical foundation and practical basis for developing novel and environmentally friendly plant disease resistance regulation technologies.
[0017] This invention utilizes naturally occurring compounds found in plants as autophagy activators to induce autophagy within plant cells, thereby activating the plant's own immune mechanisms and achieving effective control of bacterial canker. Compared to traditional chemical pesticides, autophagy activators are derived from natural plants, offering advantages such as wide availability, environmental friendliness, and high safety. They do not negatively impact plant growth or pose potential risks to humans, livestock, or the ecological environment, aligning with the requirements of green agriculture and sustainable development. Furthermore, this invention expands the applications of autophagy activators in plant pathology control, opening up a completely new technological direction. Research on the autophagy pathway clarifies the molecular mechanism of autophagy activators in plant disease resistance responses, enriching plant disease resistance theory and providing important insights for control strategies of other crop-related diseases. Attached Figure Description
[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0019] Figure 1 This image shows the results of quantitative and targeted needle inoculation of Xcc into leaves of wild-type (WT) and autophagy mutant FhATG7-RNAi (#2, #3) kumquats to evaluate Xcc proliferation after impaired autophagy function. A shows lesion images of WT and FhATG7-RNAi leaves inoculated with Xcc on days 1, 7, and 17. The scale bar for the first column of leaf images is 0.5 cm, and the scale bar for the second, third, and fourth columns of magnified microscopic images is 1 mm. B shows the statistical chart of lesion area in WT and FhATG7-RNAi leaves on day 17. C shows the Xcc content analysis of WT and FhATG7-RNAi leaves inoculated with Xcc on days 1, 7, and 17.
[0020] Figure 2 The figure shows the results of detecting the transcriptional levels of autophagy-related genes FhATG6(A), FhATG7(B), FhATG8A(C), and FhATG13(D) after co-injection of spermidine (Spd) and Xcc into the tangerine tree;
[0021] Figure 3 The results of co-treatment with spermidine (Spd) and Xcc in wild-type (WT) and autophagy mutant FhATG7-RNAi are shown in the figure. A shows the bright-field and GFP fluorescence images of the WT and FhATG7-RNAi leaf injection control and treatment groups. The left side of the abaxial leaf shows the treatment group (1mM Spd + Xcc-GFP), and the right side shows the control group (H2O + Xcc-GFP). B shows the Xcc content in the leaves at 1, 3, and 6 days after treatment. C shows the statistical graph of the inhibition rate in WT and FhATG7-RNAi at 1, 3, and 6 days after treatment.
[0022] Figure 4 The results of the evaluation of the inhibitory effect of different concentrations of spermidine (Spd) on Xcc in 'Newhall' navel orange leaves are shown in Figure A. Bright field and GFP fluorescence images of the control group (H2O+Xcc) and different concentration treatment groups (Spd+Xcc) injected on the back of 'Newhall' navel orange leaves are shown in Figure B. The Xcc content of the control group and treatment group leaves on the 3rd day after injection is shown in Figure B.
[0023] Figure 5The results of the evaluation of the inhibitory effect of different concentrations of spermidine (Spd) on Xcc after injection treatment of Citrus aurantium leaves are shown in Figure A. Bright field and GFP fluorescence images of the control group (H2O+Xcc) and the different concentration treatment groups (Spd+Xcc) injected on the back of Citrus aurantium leaves are shown in Figure B. The Xcc content of the control group and the treatment group was detected on the 3rd day after injection.
[0024] Figure 6 The results of the evaluation of the inhibitory effect of different concentrations of spermidine (Spd) on Xcc after injection treatment of 'Liuyang' kumquat leaves are shown in Figure A. Among them, A shows the bright field and GFP fluorescence images of the control group (H2O+Xcc) and the different concentration treatment groups (Spd+Xcc) injected on the back of 'Liuyang' kumquat leaves; B shows the Xcc content detection results of the control group and the treatment group leaves on the 3rd day after injection.
[0025] Figure 7 The results of the evaluation of the inhibitory effect of 1mM spermidine (Spd) injection on Xcc in 'Newhall' navel orange leaves are shown in the figure. A shows the bright-field and GFP fluorescence images of the control group (H2O+Xcc) and the treatment group (1mM Spd+Xcc) injected onto the back of 'Newhall' navel orange leaves; B shows the statistical graph of viable Xcc bacteria in the leaves of the control and treatment groups at 1d, 3d, 6d, and 9d after injection; C shows the Xcc content analysis of the leaves of the control and treatment groups at 1d, 3d, 6d, and 9d after injection; D shows the ratio of viable Xcc bacteria in the leaves of the treatment and control groups at 1d, 3d, 6d, and 9d after injection; E shows the ratio of Xcc content in the leaves of the treatment and control groups at 1d, 3d, 6d, and 9d after injection.
[0026] Figure 8 The results of the evaluation of the inhibitory effect of 1 mM spermidine (Spd) injection on Xcc inhibition in Citrus aurantium leaves are shown in the figure.
[0027] In this diagram, A shows the bright-field and GFP fluorescence images of the control group (H2O+Xcc) and the treatment group (1mM Spd+Xcc) injected onto the back of Citrus auricle leaves; B shows the statistical graph of viable Xcc bacteria in the leaves of the control and treatment groups at 1d, 3d, 6d, and 9d after injection; C shows the Xcc content analysis graph of the leaves of the control and treatment groups at 1d, 3d, 6d, and 9d after injection; D shows the ratio of viable Xcc bacteria in the leaves of the treatment and control groups at 1d, 3d, 6d, and 9d after injection; and E shows the ratio of Xcc content in the leaves of the treatment and control groups at 1d, 3d, 6d, and 9d after injection.
[0028] Figure 9The results of the evaluation of the inhibitory effect of 1 mM spermidine (Spd) injection on Xcc in leaves of 'Liuyang' kumquat are shown in the figure. Among them, A is the bright field and GFP fluorescence of the control group (H2O+Xcc) and the treatment group (1 mM Spd+Xcc) injected on the back of the leaves of 'Liuyang' kumquat; B is the statistical graph of the viable Xcc in the leaves of the control group and the treatment group 1 day and 3 days after injection; C is the Xcc content analysis graph of the leaves of the control group and the treatment group 1 day and 3 days after injection; D is the ratio of viable Xcc in the leaves of the treatment group and the control group 1 day and 3 days after injection; E is the ratio of Xcc content in the leaves of the treatment group and the control group 1 day and 3 days after injection.
[0029] Figure 10 The results of the evaluation of the inhibitory effect of different concentrations of spermidine (Spd) on Xcc on leaves of 'Newhall' navel orange are shown in the figure. Among them, A is the lesion image of Xcc after needle pricking after spraying with H2O, 0.5mM Spd and 1mM Spd; the scale bar of the first column of leaf images is 0.5cm; the scale bar of the second, third and fourth columns of magnified microscopic images is 1mm; B is the statistical graph of leaf lesion area on day 14 of treatment. Detailed Implementation
[0030] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0031] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included within the scope of this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0032] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0033] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0034] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0035] The following examples illustrate the construction method of the FhATG7-RNAi autophagy mutant from *Citrus aurantiacus*:
[0036] A specific fragment of the FhATG7 gene (first 505 bp) was amplified and inserted into the pHellsgate8-KG vector. Plant transformation was performed using an Agrobacterium-mediated epicotyl transformation system. Sterilized seeds were inoculated into MT basal medium and cultured in the dark at 25°C for 20-30 days, followed by treatment in a dark environment for 7-10 days. Dedifferentiated stem segments were cut into small pieces and immersed in OD... 600 A 0.6% Agrobacterium tumefaciens suspension was used to infect the plants by shaking at 200 rpm for 15 minutes. The infecting plants were then transferred to MS medium containing 20 mg / L acetosyringone (AS) and co-cultured at 25°C in the dark for 3 days. The infected explants were rinsed three times with sterile water and transferred to regeneration medium for at least 2 months until the regenerated buds reached graftable size. The positive regenerated buds were then grafted onto pre-prepared citrus miniature rootstocks. The grafted plants were then cultured at 25°C under light for 15 days before being transplanted into soil.
[0037] The citrus canker pathogen used in the following examples is the citrus canker pathogen (Xcc-GFP) of Xanthomonascitri subsp. Citri, Xcc, which was GFP-labeled and provided by Professor Deng Ziniu's research group at Hunan Agricultural University.
[0038] The nucleotide sequences of genes FhATG6, FhATG7, FhATG8A and FhATG13 appearing in the following examples are shown in SEQ ID NO.1 to 4, respectively.
[0039] SEQ ID NO.1:
[0040]
[0041] SEQ ID NO.2:
[0042]
[0043] SEQ ID NO.3:
[0044] ATGATGTTCATCTGTTTCAAATTTGCAGAGAGTCATCGTAGCGTCAGTTTCGCCATGGCCAAAAGTTCATTCAAGCTCGAGCATCCATTGGAGAGGAGGCTGGCAGAATCTGCTCGCATTAGAGAGAAGTATCCTGACAGGATTCCGGTGATTGTGGAGAAGGCTGAGAAGACTGATGTTCCTGACATTGACAAGAAAAAATACCTTGTCCCAGCGGATTTATCTGTGGGACAATTTGTTTATGTTGTCCGTAAAAGGATTAAGCTCAGTGCAGAAAAGGCCATATTTGTTTTTGTTAAGAATACTTTACCTCCAACCGGTGCCTTGATGTCTGCTATATATGAGGAAAACAAGGATGAAGATGGTTTTCTTTACATGACTTACAGTGGAGAGAATACCTTCGGTTGGTCATTTTAA。
[0045] SEQ ID NO.4:
[0046] ATGAATCTTTTGATCAACAGGGACCTTTGAGTGAGCCACTTGAGCCTGGAGGATTGTTTCCAATCAGGAAATCCCAAGATGCTGCTGTTGGTGCTCTTGTGTGCATGTTAAAGAAAGCTCCACCACTTCGTCAAGACTTGTCCAAGCTCAATAAATTCATCAGACGCCACCAGACCTGAGATATGGAGAAATAGCAACCAAGAGTCTAGTCAGATATCTGAGGCACCTTCAGGTCAGCATGCTGCTTCATTGAGTGTTGCATCTTCAAGTCTTGTTGCATCTTCAAGTCTTGTTGCATCAAAGACTACAGCTGAATGCATTAGAAGAACTCCGGGGATACAAAGAGATGAAAAACTTGTTGCTTAGTCAAGAATTCAACAGAACGCCTCAGTTTTGGACTCAAGTGGGGTC AGATACACATGTTACCTTAGCAGAGGTAATGACTCTCCTACAACACCAAAATCAGAATGCGCAAGATATGAAATATTCTCTTCTACCCCCATGTCTAGAAGAGATCAAGCATAAGCCTTATCTCGAAAGCTACCGCTGTTCACAATTTATCTTGTTCGAGGTGTGGAAGGGCAACCCCAGAGAACATATCAGCCATTACATTGACACTCTTGGCCAATATGCTATTGACCCCAAAGCTTCGATTGCGAGAATATTCCAAATCTCTCAGTGGTCATGCTTATACTTGGTCCATCAATTTGAAAGTTGGGAGGGAACAAGATATAGATATGAACCTACTACCTCACTATGGTGATCGAGTAGCTACGATGATTATTGCTGAGTCTATTACAAATAATGATGATTCAATGACAAATGTTATTATCGAGAAGCAGAAGGCTGAACATGAAATCCTACCTGATAATGATCTTACAGGGTTTCTACGATACGGACCAGAGTGCTATGCTGCGGAAACAGAAGTCAATCGAGCTTATCTCAAATCTACCAAAGCAGTCATCTTTTCTGATAAAGATATTGAGGTAATAAATCCTAATTACGGACGACCATTATTTCTAGAAGTTGAGATCAATGGAGTTTCGGTCAGCAGAGCTTTAGTGGATATAGGCCTGTTGATGCCGAAATCCGAACCAGTTGGTGATCTGCTCAAGCTCATACCACCTAATCGAGGTCATCTGCTCAAGCTCATACCACCTGGTCGAGGTGATCTGCTCAAGCTCATAGCACCTGGTCGAGGTGCTCTCTTCAAGCTCATGGCACATGGTCAAGGTGATCTCCTCAAGCTCATAGCGAATGGTCGAGGTGGTCTGCTCAAGCTCATAGCACCTAGTCGAGGTAGTCTGCTCAACCATTTGCTCACTTTCACTTGGAGGAGATCATGGTCGCTCTATTTAATTCCTCAAACAAGGCCCTACTCAAATAAACACAAGATAATCGGAATGAAACCAATCCGCATTGCTGCCAATCTTACCCCATTCCATTATGAAGAAAGTCATATGGTAGAGGCTCGATTCTACGTATTATCCACTGAAGGAGAAGGAACGATTGCTGCCATGCTGCAACGGCTGAAGCTTTTGAAAAACACGCAAAAAGCCAAAAAACTAATCACAAAAGCTTATCGAAACAAAACGCAAGCTGGATTTCTTAAAAAGTGCTCATTCCGACAACTAAAAACAAAAACTCAAGTTACTTTAGTTTGTGGGAAGTAA。
[0047] Example 1
[0048] The citrus varieties used in the experiment were wild-type Shanjingan and the autophagy mutant FhATG7-RNAi. The plants were placed in an artificial climate incubator at 26℃ and 80% humidity for 16h / 8h (light / dark) conditions. Leaves aged 28-40 days with good growth, mild leatheriness, and not yet dark green were selected for needle-pricking inoculation with citrus canker pathogen.
[0049] The following steps should be taken for needle-based, targeted, and quantitative inoculation of citrus canker pathogens:
[0050] (1) Take the GFP-tagged Xcc-GFP citrus canker pathogen stored in a -80℃ ultra-low temperature freezer, and streak 10 μL onto LB solid medium. Incubate at 28℃ for 24-48 h. Pick single colonies and place them in liquid LB medium. Shake at 180 rpm for 18 h at 28℃. After the bacterial suspension becomes fully turbid, centrifuge at 5000 rpm for 5 min, resuspend in sterile water, and measure the absorbance (OD) using a CO8000 cell density meter. 600 Adjust to 0.6, which is 10. 8 CFU / mL. Using a tenfold serial dilution method, concentrations of 10 were obtained sequentially. 6 -10 8 CFU / mL Xcc-GFP bacterial suspension.
[0051] (2) Make three symmetrical inoculation points on each side of the main vein on the back of the leaf, ensuring that the inoculation points are punctured but not completely broken. The inoculation needle used consists of three embroidery needles (0.60 mm in diameter).
[0052] (3) Use a pipette to draw 10 ml of the liquid. 8 CFU / mL Xcc-GFP bacterial suspension, 5 μL of bacterial suspension was inoculated at each inoculation site.
[0053] (4) After the bacterial solution has completely dried, place the plant material in an artificial climate chamber and cultivate it in an environment of 28°C and 80% humidity to promote the occurrence of ulcer disease.
[0054] The results are as follows Figure 1 As shown, the lesion area was statistically analyzed, with FhATG7-RNAi#3 > FhATG7-RNAi#2 > WT. The average lesion area at the acupuncture site for the three groups was 2.49 mm. 2 1.54mm 2 1.07mm 2 Furthermore, analysis of Xcc content revealed that at 1, 7, and 17 days post-inoculation, the Xcc content in FhATG7-RNAi leaves was higher than that in WT leaves. These results indicate that decreased FhATG7 expression levels increase the susceptibility of Sempervivum tectorum plants to Xcc, making them more susceptible to Xcc infection.
[0055] Example 2
[0056] The citrus varieties used in the experiment were wild-type Sempervivum and the autophagy mutant FhATG7-RNAi. The plants were placed in an artificial climate incubator at 26℃ and 80% humidity for 16h / 8h (light / dark) conditions. Leaves aged 28-40 days with good growth, mild leatheriness, and no dark green color were selected for co-injection of spermidine and Xcc.
[0057] The co-injection of spermidine and Xcc was performed according to the following steps:
[0058] (1) Dissolve 36.3 μL of Spd reagent in 25 mL of sterile water to prepare a 10 mM Spd stock solution. The preparation of the Xcc-GFP bacterial suspension was carried out according to the method in Example 1. Preparation of the spermidine and Xcc co-injection treatment solution: Add 4.5 mL of Xcc-GFP bacterial suspension (10... 6 Add 500 μL of 10 mM Spd to a solution containing CFU / mL to prepare a 1 mM Spd + Xcc treatment solution. Add 4.5 mL of Xcc-GFP bacterial suspension (10... 6 Add 500 μL of sterile water to the solution (CFU / mL) to prepare a pathogen control solution, and use 5 mL of sterile water as a blank control solution.
[0059] (2) Using the main vein as the boundary, select three areas on each side that are similar in size and relatively symmetrical between the veins.
[0060] (3) Make several small holes on the back of the leaf using a disposable syringe needle with a specification of 1mL, and inject 1mM Spd+Xcc treatment solution, H2O+Xcc pathogen control solution, and H2O blank control solution respectively.
[0061] (4) Place the inoculated plant material in an artificial climate incubator at 28°C and 80% humidity, and observe the leaf symptoms regularly.
[0062] Experiment 1: Three treatments were set up: injection of H2O (blank control), injection of H2O+Xcc (pathogen control), and injection of 1mM Spd+Xcc (treatment group). After injecting the leaves of the kumquat according to the above steps, samples were taken on the 3rd day to detect the expression of autophagy-related genes.
[0063] The results are as follows Figure 2 As shown, compared with the blank control group (injected with H2O), the expression of autophagy-related genes was significantly upregulated after injection of H2O+Xcc. The upregulation of autophagy gene expression was the greatest after injection of 1mM Spd+Xcc, with the expression of FhATG6, FhATG7, FhATG8A and FhATG13 being upregulated by about 1.4-2 times.
[0064] Experiment 2: Two treatments were set up in wild-type and autophagy mutant FhATG7-RNAi of Citrus aurantiacus. 1mM Spd+Xcc was injected into the left side of the back of the leaf (treatment group), and H2O+Xcc was injected into the right side (pathogen control group). Observations were conducted at 1, 3, and 6 days.
[0065] The results are as follows Figure 3 As shown, the antibacterial effect of FhATG7-RNAi leaves inoculated on day 3 and day 6 was significantly lower than that of wild-type kumquat, at 35% and 63% of that of wild-type kumquat, respectively.
[0066] The experimental results of this embodiment show that spermidine exerts its anti-ulcer effect through the autophagy pathway.
[0067] Example 3
[0068] Evaluation of the inhibitory effect of spermidine on Xcc in leaves of different citrus varieties:
[0069] The citrus varieties used in the experiment were 'Newhall' navel orange, 'Four Seasons' mandarin orange, and 'Liuyang' kumquat. The plants were placed in an artificial climate incubator at 26℃ and 80% humidity, under 16h / 8h (light / dark) conditions. Leaves aged 28-40 days, with good growth, mild leatheriness, and not yet dark green in color, were selected for co-injection of spermidine and Xcc. 10 [units of something] were prepared according to the method in Example 1. 6 -10 8 CFU / mL Xcc-GFP bacterial suspension (10 8 CFU / mL bacterial suspension was used for injection inoculation of leaves of 'Newhall' navel oranges and mandarins. 6 CFU / mL bacterial suspension was used for injection inoculation of 'Liuyang' kumquat leaves. Treatment solutions of 1mM Spd+Xcc, 0.5mM Spd+Xcc, 0.1mM Spd+Xcc, and 0.05mM Spd+Xcc were prepared according to the method in Example 2 and injected into the three varieties respectively.
[0070] The results on day 3 after processing are as follows Figures 4-6 As shown, treatments with 0.05mM, 0.1mM, 0.5mM, and 1mM Spd significantly inhibited the proliferation of Xcc, with the 1mM Spd treatment showing the best inhibitory effect.
[0071] Further, 1 mM Spd and Xcc were co-inoculated onto the leaves of three citrus varieties, and observation was conducted for 9 days. Results are as follows: Figures 7-9As shown, in 'Newhall' navel oranges, no live Xcc bacteria were detected in the Spd treatment group on day 1 after inoculation. On days 3, 6, and 9 after inoculation, the live bacteria counts in the Spd treatment group were 11%, 14%, and 44% of the control group, respectively, and the Xcc content was 17%, 9%, and 7% of the control group, respectively. In 'Four Seasons Oranges', the live bacteria counts in the Spd treatment group on days 1, 3, 6, and 9 after inoculation were 1.1%, 2.4%, 5.7%, and 5.6% of the control group, respectively, and the Xcc content was 22%, 6%, 18%, and 35% of the control group, respectively. In 'Liuyang' kumquats, no live Xcc bacteria were detected in either the Spd treatment group or the control group on day 1 after inoculation. On day 3 after inoculation, the live bacteria count in the Spd treatment group was 8.6% of the control group, and the Xcc content was 11% of the control group.
[0072] 'Newhall' navel oranges are extremely susceptible to citrus canker, while the Four Seasons mandarin orange, an intergeneric hybrid of the genera *Citrus* and *Citrus*, exhibits moderate resistance to citrus canker. 'Liuyang' kumquats, belonging to the *Citrus* cultivar *Golden Bullet*, are extremely resistant to citrus canker. Test results show that spermidine exhibits significant canker control effects in both susceptible and resistant citrus varieties, demonstrating broad-spectrum control of citrus canker.
[0073] Example 4
[0074] Application of spermidine in the prevention and control of canker in 'Newhall' navel oranges:
[0075] The citrus variety used in the experiment was 'Newhall' navel orange. The plants were placed in an artificial climate incubator at 26℃ and 80% humidity, and cultured under 16h / 8h (light / dark) conditions. Leaves aged 28-40 days with good growth, mild leatheriness, and not yet dark green color were selected, treated with spermidine spray, and then inoculated with Xcc.
[0076] After spermidine spraying treatment, Xcc inoculation should be carried out according to the following steps:
[0077] (1) Prepare 50 mL of 0.5 mM and 1 mM Spd as treatment groups and 50 mL of H2O as control group, and add 50 μL of Tween-20 to each group and mix well for later use.
[0078] (2) Five 1-year-old grafted seedlings were selected for the treatment group and the control group respectively. Three to five branches with uniform growth were selected from each seedling. The leaves of the plants in the treatment group and the control group were sprayed every day from 9 to 11 am until there were droplets on both sides of the leaves but they did not fall off. The spraying treatment was carried out continuously for 3 days.
[0079] (3) Three days after spraying, 10 doses were inoculated at fixed points using needle acupuncture. 85 μL of CFU / mL Xcc-GFP was placed in an artificial climate incubator at 28℃ and 80% humidity. The occurrence of ulcer lesions was observed on day 1, day 7, and day 14 after Xcc inoculation, and the lesion area was counted on day 14.
[0080] The experiment included three treatments: 0.5 mM and 1 mM Spd in the treatment groups and water in the control group.
[0081] The results are as follows Figure 10 As shown, no obvious lesions were observed in either the control group or the treatment group on day 1 after inoculation; on day 7, obvious water-soaked lesions appeared at the needle prick sites in the control group, while only weak water-soaked lesions were observed in the treatment group; on day 14, a large number of callus protrusions had formed in the control group, while only a small number of water-soaked lesions and callus protrusions were observed in the treatment group. Statistical analysis of the lesion area at the inoculation sites revealed that the average lesion area after spraying with H2O, 0.5 mM Spd, and 1 mM Spd followed by Xcc inoculation was 0.016 cm². 2 0.012cm 2 0.011cm 2 The lesion area in the treatment group was significantly smaller than that in the control group, confirming that spraying spermidine can inhibit the proliferation of Xcc in the leaves of 'Newhall' navel orange.
[0082] Example 5
[0083] A plant autophagy activator comprising 0.5 mM spermidine and 1.5 mL / L Tween-20 (surfactant).
[0084] Example 6
[0085] A plant autophagy activator comprising 0.75 mM spermidine and 0.5 mL / L Tween-20 (surfactant).
[0086] Example 7
[0087] A plant autophagy activator comprising spermidine 1 mM and Tween-20 (surfactant) 1 mL / L.
[0088] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A method for regulating resistance of citrus to citrus canker. FhATG7 Genes, characterized by, The FhATG7 The nucleotide sequence of the gene is shown in SEQ ID NO.2; the regulation of citrus resistance to citrus canker refers to inhibiting the above-mentioned... FhATG7 Gene expression is used to increase the susceptibility of citrus fruits to canker disease.
2. A device as described in claim 1 FhATG7 The application of genes in regulating citrus resistance to citrus canker is characterized by, The application is to suppress the FhATG7 Gene expression is used to increase the susceptibility of citrus fruits to canker disease.