Application of zinc metalloprotease CsMep gene in regulating pathogenicity of colletotrichum gossypii

By knocking out the zinc metalloproteinase CsMep gene in *Hymenochys sorghum*, the role of this gene in regulating mycelial growth, sporulation, and aromatic amino acid metabolism was studied. This solved the problem of unclear pathogenicity of *Hymenochys sorghum*, achieved the goal of reducing pathogenicity and providing control strategies, and provided a basis for the development of novel fungicides.

CN120843557BActive Publication Date: 2026-03-17GUIZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510935871.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-07-08
Publication Date
2026-03-17
Estimated Expiration
2045-07-08

AI Technical Summary

Technical Problem

There are currently no reports on the pathogenicity or virulence of sorghum anthracnose bacteria being related to metalloproteinases, and the role of metalloproteinases secreted by the pathogen in the pathogenic process is unclear.

Method used

The zinc metalloproteinase CsMep gene in *Saccharomyces cerevisiae* was identified and knocked out. By constructing a deletion mutant of *Saccharomyces cerevisiae*, its role in regulating mycelial growth, sporulation, appressorium development, and sensitivity to zinc sulfate stress was studied, revealing the regulatory role of CsMep in aromatic amino acid metabolism.

Benefits of technology

It significantly reduced the pathogenicity of sorghum anthracnose fungus, inhibited mycelial growth, reduced sporulation capacity, and caused abnormal appressorium development. It also showed high sensitivity to zinc sulfate stress, providing a theoretical basis for a targeted metalloproteinase control strategy for sorghum anthracnose and for novel fungicides.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120843557B_ABST
    Figure CN120843557B_ABST
Patent Text Reader

Abstract

The application discloses application of a zinc metalloprotease CsMep gene in regulating pathogenicity of a highland brome anthracnose fungus, and belongs to the technical field of biotechnology.A zinc metalloprotease CsMep is identified, and the nucleotide sequence of the CsMep gene is shown in SEQ ID NO.1.The CsMep gene not only regulates zinc ion homeostasis of the highland brome anthracnose fungus, but also enhances virulence by affecting aromatic amino acid metabolism.By knocking out the CsMep gene in the highland brome anthracnose fungus, a deletion mutant type anthracnose fungus is constructed, and it is found through strain morphological observation and pathogenic fungus infection experiments that the pathogenicity of the deletion mutant type anthracnose fungus is obviously reduced, which provides a new idea for a highland brome anthracnose disease prevention and control strategy targeting metalloproteases and provides a theoretical basis for development of a new type of fungicide.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to the application of the zinc metalloproteinase CsMep gene in regulating the pathogenicity of sorghum anthracnose fungus. Background Technology

[0002] In nature, plants face numerous threats from pathogens, thus evolving a complex and precise immune system to defend against infection. In the process of this interplay between plants and pathogens, plants have gradually developed a multi-layered immune system, including PTI (pattern-triggered immunity) and ETI (effector-triggered immunity). PTI is the plant's first line of defense; plant surface receptors initiate a rapid response to potential threats by recognizing pathogen-associated molecular patterns (PAMPs). ETI, triggered by effector proteins, typically prevents infection through local hypersensitivity (HR). In the interaction between plants and pathogens, pathogens secrete effectors into plant cells, breaching the plant's first line of defense, hindering the recognition of PAMPs by plant pattern recognition receptors (PRRs), thereby interfering with the host's PTI response and promoting infection. Simultaneously, the plant initiates a secondary immune defense to combat the invasion. NLR receptors within plant cells are activated by specifically recognizing the effectors of the pathogen, triggering and amplifying the PTI response, leading to localized necrosis at the infected site and inducing immune responses in other uninfected parts of the plant, thereby minimizing pathogen infection. When a plant is initially invaded by a pathogen, its cell wall thickens and produces defensive molecules. Among these, chitinases, as defensive molecules, inhibit infection and activate the immune response by hydrolyzing chitin, a major component of the fungal cell wall. However, to suppress the chitin-mediated plant immune response, the pathogen secretes metalloproteinases and serine proteases containing Lys M domains to truncate the host chitinases, thus successfully completing the infection.

[0003] Metalloproteinases (Mep) are a class of proteolytic enzymes widely distributed in organisms, playing crucial roles in various physiological processes such as cell signaling, immune responses, protein degradation, apoptosis, and gene transcription regulation. Metalloproteinases are metal ion-dependent proteases; their active sites can bind metal cations and form specific coordination structures to facilitate substrate molecule transformation. Zinc metalloproteinases (Mep) are the most common type, possessing a zinc ion-binding motif HEXXH, with two histidine residues acting as zinc ligands. These proteins are widely distributed in animals, plants, and microorganisms. Metalloproteinases secreted by pathogenic microorganisms are often referred to as virulence factors; they achieve successful invasion by degrading proteins in host tissues and weakening the host's immune response.

[0004] Sorghum anthracnose is caused by *Colletotrichum sublineolum*, which severely affects sorghum yield and quality. However, there are currently no reports on the pathogenicity or virulence of this pathogen being related to metalloproteinases, and the role of metalloproteinases secreted by this pathogen in the pathogenic process is unclear. Summary of the Invention

[0005] The purpose of this invention is to provide the application of the zinc metalloproteinase CsMep gene in regulating the pathogenicity of *Hydroxtrorotatory sorghum*, thereby addressing the problems existing in the prior art. This invention identifies a zinc metalloproteinase CsMep, which not only regulates zinc ion homeostasis in *Hydroxtrorotatory sorghum*, but also enhances virulence by affecting aromatic amino acid metabolism. By knocking out the CsMep gene in *Hydroxtrorotatory sorghum*, a deletion mutant anthracnose strain was constructed. Morphological observation and infection experiments showed that the pathogenicity of the deletion mutant anthracnose strain was significantly reduced, providing a new approach to the control strategy of targeting metalloproteinases in sorghum anthracnose and a theoretical basis for the development of novel fungicides.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides a zinc metalloproteinase CsMep gene of sorghum anthracnose fungus, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0008] The present invention also provides the application of knocking out the zinc metalloproteinase CsMep gene in inhibiting the pathogenicity of sorghum anthracnose fungus, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0009] The present invention also provides the application of knocking out the zinc metalloproteinase CsMep gene in inhibiting the growth of sorghum anthracnose fungus, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0010] Furthermore, the inhibition of the growth of sorghum anthracnose fungus includes inhibiting the mycelial growth of sorghum anthracnose fungus.

[0011] Furthermore, the inhibition of the growth of sorghum anthracnose fungus also includes inhibiting the production of conidia by the sorghum anthracnose fungus.

[0012] Furthermore, the inhibition of sorghum anthracnose growth also includes inhibiting the production of appressoria by sorghum anthracnose.

[0013] The present invention also provides the application of the product with the zinc metalloproteinase CsMep gene knocked out in the preparation of a fungicide for sorghum anthracnose, the nucleotide sequence of the zinc metalloproteinase CsMep gene being shown in SEQ ID NO.1.

[0014] The present invention also provides the application of the zinc metalloproteinase CsMep gene as a target in screening drugs for the prevention and treatment of sorghum anthracnose, wherein the nucleotide sequence of the zinc metalloproteinase CsMep gene is shown in SEQ ID NO.1;

[0015] The drug can reduce the expression level of the zinc metalloproteinase CsMep gene.

[0016] The present invention discloses the following technical effects:

[0017] This invention identifies for the first time a zinc-dependent metalloproteinase, CsMep, which possesses a conserved HEXXH motif and an N-terminal signal peptide, can be localized to the cell membrane and cytoplasm, and can inhibit plant programmed death (PCD). Knockout of the CsMep gene significantly reduces the pathogenicity of *Anthracnose sorghum*, manifested as inhibited hyphal growth, decreased sporulation capacity, abnormal appressorium development, and high sensitivity to zinc sulfate stress. Further analysis revealed that under zinc stress, the aromatic amino acid metabolic pathway in the CsMep gene-deleted mutant strain was significantly upregulated, suggesting that CsMep may promote pathogenicity by regulating zinc stress response and metabolic pathways. This invention elucidates the mechanism of action of CsMep as a multifunctional virulence factor, providing a new approach to the control strategy of sorghum anthracnose targeting metalloproteinases, expanding our understanding of the pathogenic mechanisms of fungal metalloproteinases, and providing a theoretical basis for the development of novel fungicides based on metalloproteinase targets. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 The results of phylogenetic analysis and structural characterization analysis of CsMep are shown below; A: Phylogenetic tree; B: CsMep protein domain composition analysis results; C: CsMep three-dimensional structure prediction and zinc ion binding site display diagram.

[0020] Figure 2 The results of the CsMep signal peptide function verification experiment are as follows: A: Growth of different transformant strains on SD / T and YPRAA media; B: Color development of each strain in the TCC colorimetric reaction.

[0021] Figure 3 The results of functional analysis of CsMep inhibiting Bax-induced programmed cell death; where A: CsMep protein, HEXXH motif point mutant (CsMep H210F,E211Q,H214F,H220F ) and truncated mutant (CsMep) Δ210-220 A: Schematic diagram of the structure of the tobacco leaf; B: Phenotypic analysis of Bax-induced PCD in Benedict's tobacco leaves;

[0022] Figure 4 The results of CsMep subcellular localization analysis;

[0023] Figure 5 The results show the phenotypic and pathogenicity of different strains of *Anthracnose sorghum*. A: Colony differences between mutant strains (ΔCsMep-123 and ΔCsMep-134), complement strains (ΔCsMep / MEP), and wild-type strains (WT); B: Mycelial growth rate of mutant, complement, and wild-type strains; C: Differences in conidia between mutant, complement, and wild-type strains (bar = 20 μm); D: Disease incidence on sorghum seedling leaves after inoculation with mutant, complement, and wild-type strains.

[0024] Figure 6 The analysis results show the regulation of nutrient metabolism by CsMep in sorghum anthracnose fungus; A: Phenotypic characteristics of mutant strains (ΔCsMep-123 and ΔCsMep-134), complemented strains (ΔCsMep / MEP), and wild-type strains (WT) on different nutrient media; B: Growth rate determination results of mutant strains, complemented strains, and wild-type strains on different nutrient media.

[0025] Figure 7 The results of the response analysis of different strains of *Anthracnose sorghum* to zinc sulfate stress are as follows: A: Colony phenotypes of mutant strains (ΔCsMep-123 and ΔCsMep-134), complement strains (ΔCsMep / MEP), and wild-type strains (WT) under different concentrations of zinc sulfate treatment; B: Mycelial growth rate of mutant, complement, and wild-type strains under different concentrations of zinc sulfate treatment; C: Differences in conidia between mutant, complement, and wild-type strains after treatment with different concentrations of zinc sulfate, bar = 20 μm.

[0026] Figure 8 The results are as follows: A: Principal component analysis (PCA) results; B: Volcano plot analysis results of differentially expressed genes (DEGs); C: KEGG pathway enrichment analysis results.

[0027] Figure 9 Results of GO function enrichment analysis for the WT vs WT-ZnSO4 groups;

[0028] Figure 10 Results of GO function enrichment analysis for the ΔCsMep vsΔCsMep-ZnSO4 group;

[0029] Figure 11 Results of GO functional enrichment analysis for the ΔCsMep / MEP vs ΔCsMep / MEP-ZnSO4 group;

[0030] Figure 12 The results are from metabolomics analysis; where A: Principal component analysis (PCA) results; B: Volcano plot of differential metabolites in the WT vs WT-ZnSO4 group; C: Volcano plot of differential metabolites in the ΔCsMep vs ΔCsMep-ZnSO4 group; D: Volcano plot of differential metabolites in the ΔCsMep / MEP vs ΔCsMep / MEP-ZnSO4 group; red and blue represent significantly upregulated and downregulated metabolites, respectively (P<0.05 and VIP>1);

[0031] Figure 13 The results are from metabolomics pathway analysis; where A: statistical results of metabolite pathway types; B: KEGG enrichment analysis results of differentially metabolites.

[0032] Figure 14The results are from the integrated analysis of transcriptomics and metabolomics; where a: a map of the Phenylalanine, tyrosine and tryptophan biosynthesis pathway; b: a heatmap of metabolites from the Phenylalanine, tyrosine and tryptophan biosynthesis pathway. Detailed Implementation

[0033] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0034] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0035] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0036] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0037] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the instruments and equipment used in the following examples are all conventional laboratory instruments and equipment; unless otherwise specified, the experimental materials used in the following examples were all purchased from conventional biochemical reagent stores.

[0038] Example 1

[0039] 1. LC-MS / MS mass spectrometry analysis of anthrax bacteria secreted proteins

[0040] To identify the secreted proteins of *Colletotrichum sublineolum*, the causal agent of sorghum anthracnose, *Colletotrichum sublineolum* HX-5-1 (preserved and provided by the Plant Pathology Laboratory of Guizhou University) was cultured in Czapek's Liquid Medium (CDB) for 3 days, followed by centrifugation, and the culture supernatant was collected. The supernatant was filtered through a 0.22 μm filter to remove conidia and other impurities. Proteins in the culture medium were precipitated with 10% (w / v) trichloroacetic acid, and the precipitate was washed with acetone and air-dried to obtain concentrated proteins. Liquid chromatography-tandem mass spectrometry (LC-MS / MS) analysis was performed by Shanghai APTBIO Biotechnology Co., Ltd. Total secreted proteins were digested using the following method: 800 μL of sample was added to 0.1 M NH4HCO3 / 30% CAN, followed by decolorization until a supernatant appeared. The supernatant was then removed, and the original solution was retained. 100 mM NH4HCO3 was added to the sample, and the reaction was allowed to proceed for 20 min, after which the supernatant was removed. NH4HCO3 and DTT were added to the sample at the following volumes: 360 μL of 100 mM and 40 μL of 100 mM, respectively, for 30 min at 56 °C, to facilitate protein reduction. 100 μL of 100% CAN was added to a centrifuge tube, and the reaction was allowed to proceed for 5 min, after which the supernatant was removed. 200 mM... IAA and 100mM NH4HCO3 were added to the solution in volumes of 120μL and 280μL, respectively; then incubated at room temperature for 20 minutes. 100μL of NH4HCO3 was added to the solution for reaction, and after 15 minutes, the supernatant was removed. Next, 100% ACN was added, and after reacting for 5 minutes, the supernatant was removed. Third, 20ng / μL Trypsin was added to the sample, and the reaction time and temperature were controlled at 30 minutes and 4℃, respectively. 50mM NH4HCO3 buffer was added to the solution, with a sample volume of 100μL, and decomposed at room temperature. The reaction solution was separated and prepared into a new container. Simultaneously, trifluoroacetic acid was added to the gel sample, and after 15 minutes of sonication, the solution was separated. The above steps were repeated three times, followed by freezing. Then, the trypsin-digested peptides were desalted using a SepPak C18 column and vacuum dried. The resulting trypsin peptides were fractionated using high-pH reversed-phase high-performance liquid chromatography (HPLC) with an Agilent 300Extend C18 column.

[0041] The results showed that 13 putative secretory proteins were identified by LC-MS / MS analysis of the secretory proteome of *A. anthracnose*. Bioinformatics analysis revealed that these proteins all contained signal peptides and had molecular weights of <300 amino acids, consistent with the typical characteristics of fungal effector proteins. Among them, the metalloproteinase CsMep (nucleotide sequence shown in SEQ ID NO.1) was selected as the research subject due to its potential role in the pathogenic process of the fungus.

[0042] SEQ ID NO.1:

[0043] ATGAAGAGCTTCATCCTCGGAATGGCCTCATTGGGCCTCGCCAGCAGTGTACCCCTTGCCGAGCAGCCCATCCCCGTCCGGCGCGGATGTCAGGTTTCTGATGACGGCCCCATCTCTGACACCGCCGTCCAGTTCACTGGCTGGACGGCTAATCTCCAGGACTACCCCAGCAACGTCACCGTCGATGTGAACTTCCACATCGCCAGCACCGAGGCTCAAGCAGATCTCATCACTGACCAGATTGTCGATGCCCAGTGGAAAGTCCTGCATGATTCCTTTGCGAAGCACAACATCAACCTGCGGCTTAACTCGACCGAGCGCGTCGTCGATAACCTAACTGGGTCAGCGTTCTTCATCAACGAGGGGAATGGCTGGGAGAACCACGTGGATGAGTACAACGCCTACCTGAGGGACACCCGCAAAGGCGGATACGACGTCATGAACCTCTACTTCTACACCAGTTACGCGCCCGGCGCGACGGGTCGTTGCCAGTTTCCCACCGTCATCACCGACCCCGACAGCCTCGCGTTCTACACCGACTCCTGCCAGATCAGCGCCATGACCATGCCGGGCCTCACAGTCGAGCAAGGCGGCTTCGACATATGGAACCAGGGCCATATCGCTGTCCACGAGGCCGGCCACTGGTTCGGCCTCAACCATACCTTCGCCGGTGGCTGCTCGGACAACCCAGGCGACTTTGTTGCCGATACGCCCGCCCAGAGGGAAGAAGCGTACGACTGCCCTGCCGGTTTGGATACCTGCCCGAATCTCCCTGGCCTGGATCCCGTTCACAACTTCATGGGCTACGCGGCGGACGATTGGTAA。

[0044] Phylogenetic analysis showed that *CsMep* shares high homology with metalloproteinases from several species of the genus *Colletotrichum*, including *C. incanum*, *C. graminicola*, *C. somersetense*, *C. tabaci*, and *C. tamarilloi*. Figure 1 Domain analysis showed that CsMep contains a typical zinc ion metalloproteinase domain (ZnMc, IPR006026), belonging to the M43 family. Its C-terminus has a conserved HEXXH motif, and its N-terminus contains a 20-amino acid signal peptide. Figure 1 (B). Homology modeling using AlphaFold Server (https: / / www.alphafold.ebi.ac.uk / ) predicts that it can interact with zinc ions (Zn). 2+ Successful docking (pTM score > 0.5). The docking results were visualized using the PyMOL molecular graphics system. Figure 1 (C).

[0045] 2. Signal peptide function verification - yeast secretion experiment

[0046] Yeast invertase secretion was measured using the SP capture vector pSUC2. Using the gene fragment shown in SEQ ID NO.1 as a template, the primer pairs shown in SEQ ID NO.2-3 were used to amplify sequences containing the CsMep signal peptide (SP), and the primer pairs shown in SEQ ID NO.4-5 were used to amplify sequences without the signal peptide. The amplified sequences were cloned into the upstream frame of the yeast Suc2 coding sequence of the pSUC2 vector, respectively, to construct recombinant plasmids pSUC2-CsMep-FL (with SP) and pSUC2-CsMep-NS (without SP), respectively.

[0047] pSUC2-CsMep-F: CGGAATTTTAATTAAGAATTCATGAAGAGCTTCATCCT (SEQ ID NO. 2);

[0048] pSUC2-CsMep-R: CACTATAGGGAGAACCTCGAGCCAATCGTCCGCC (SEQ ID NO. 3);

[0049] pSUC2-CsMep-NS-F: CGGAATTTTAATTAAGAATTCATGGTACCCCTTGCCGAGCA (SEQ IDNO.4);

[0050] pSUC2-CsMep-NS-R: CACTATAGGGAGAACCTCGAGCCAATCGTCCGCC (SEQ ID NO. 5).

[0051] The transformants pSUC2-EV (empty vector), pSUC2-Mg87 (negative control plasmid, SP containing *Blastomyces oryzae* Mg87 protein), pSUC2-Avr1b (positive control plasmid, SP containing *Phytophthora spp.* Avr1b protein), pSUC2-CsMep-FL, and pSUC2-CsMep-NS were converted into the sucrose invertase-deficient *Saccharomyces cerevisiae* strain YTK12. Transformants were cultured on SD / T and YPRAA media (1% (w / v) yeast extract, 2% (w / v) peptone, 2% (w / v) raffinose, 2 μM antimycin A, 2% (w / v) agar) for sucrase secretion assays. Invertase activity was detected by reducing 2,3,5-triphenyltetrazolium chloride (TTC) to an insoluble red precipitate of 1,3,5-triphenylcarboxylic acid (TPF).

[0052] The results showed that yeast containing only pSUC2-CsMep-FL and the positive control pSUC2-Avr1b grew on YPRAA medium with raffinose as the sole carbon source, indicating that the signal peptide mediated the secretion of the invertase. Figure 2 Transformants secrete invertase, which is detected by reducing TTC to the red product TPF. Results showed that both pSUC2-CsMep-FL and the positive control colonies exhibited color changes, confirming that the secretion function depends on the intact signal peptide (TPF). Figure 2 (B). This yeast secretion assay showed that the CsMep signal peptide functions as a functional secretion signal, further confirming that CsMep is a secretory protein of *Bacillus anthracis*.

[0053] 3. Functional analysis of CsMep's inhibition of Bax-induced programmed cell death

[0054] To investigate the role of CsMep as an effector protein in suppressing the host immune response, the effect of CsMep on PCD induced by the mouse apoptosis protein Bax was analyzed in Nicotiana benthamiana using an Agrobacterium-mediated transient expression system.

[0055] First, point mutants (H210F, E211Q, H214F, H220F) and truncated expression vectors were constructed at key amino acid sites in the active site of HEXXH metalloproteinase. Their structures are shown below. Figure 3As shown in A. The construction method is as follows: using the gene fragment of the sequence shown in SEQ ID NO.1 as a template, amplification is performed using the primer pair shown in SEQ ID NO.6-7. The amplified fragment is then ligated to the pCaMV35S-sGFP plasmid using homologous recombination to construct the pCAM35S-GFP-CsMep recombinant plasmid. Following the same method, using the gene fragment of the sequence shown in SEQ ID NO.1 as a template, amplification is performed using the primer pair shown in SEQ ID NO.8-9, and the fragment is ligated to the CaMV35S-sGFP plasmid to construct the point mutant Pcam35s-GFP-CsMep. H210F ,E211Q,H214F,H220F Recombinant plasmid. Using the gene fragment of the sequence shown in SEQ ID NO.1 as a template, amplification was performed using the primer pair shown in SEQ ID NO.10-11, and the amplified plasmid was ligated into pCaMV35S-sGFP to construct the truncated Pcam35s-GFP-CsMep plasmid. Δ210-220 Recombinant plasmids. These recombinant plasmids were transformed into Agrobacterium GV3101 for later use.

[0056] GFP-CsMep-F: AgctcgggtacccggggatccATGCCCCTTGCCGAGCAG (SEQ ID NO. 6);

[0057] GFP-CsMep-R:cttgctcaccatggtgtcgacCCAATCGTCCGCCGCGTA (SEQ ID NO.7);

[0058] GFP-CsMep HEHH -F:

[0059] CCATATCGCTGTCTTCCAGGCCGGCTTCTGGTTCGGCCTCAACTTTACCTTCCGCCGGT(SEQ IDNO.8);

[0060] GFP-CsMep HEHH -R:

[0061] ACCGGCGAAGGTAAAGTTGAGGCCGAACCAGAAGCCGGCCTGGAAGACAGCGATATGG(SEQ IDNO.9);

[0062] GFP-CsMep Δ210-220 -F:AGGGCCATATCGCTGTCACCTTCGGCCGGTGGCT(SEQ ID NO.10);

[0063] GFP-CsMep Δ210-220 -R: AGCCACCGGCGAAGGTGACAGCGATATGGCCCT (SEQ ID NO. 11).

[0064] To detect the inhibition of Bax-induced programmed cell death (PCD), tobacco leaves were first treated with pCAM35S-GFP-CsMep and pCAM35S-GFP-CsMep. H210F,E211Q,H214F,H220F Pcam35s-GFP-CsMep Δ210-220 The cells were infiltrated with Agrobacterium tumefaciens solution containing the recombinant plasmid, and after 24 hours, the same region was infiltrated with Agrobacterium tumefaciens solution carrying the pVX-Bax vector (Bax gene ligated to pVX vector). Programmed cell death was assessed after 2 days.

[0065] The results are as follows Figure 3 As shown in Figure B, co-expression of CsMep significantly inhibited Bax-induced PCD compared to Bax expression alone. Furthermore, the HEXXH motif mutant completely lost its ability to inhibit Bax-induced PCD compared to CsMep. These results indicate that CsMep may interfere with plant immune responses by inhibiting Bax-induced PCD, confirming that its HEXXH motif is a key domain for CsMep to exert its immunosuppressive function.

[0066] 4. Subcellular localization experiment

[0067] The culture of Agrobacterium strain GV3101 containing pCAM35S-GFP-CsMep was resuspended in osmotic buffer (10 mM MgCl2, 10 mM MES, 200 μM acetylacetone) until the final OD value was reached. 600 =0.8, and was infiltrated into the leaves of 4-week-old Nicotiana benthamiana. After 48 hours, the fluorescence signal in the infiltrated area was detected using an LSM 800 confocal microscope. A control group with the empty pCAM35S-GFP vector was also included.

[0068] The results showed that the CsMep-GFP fusion protein exhibited significant fluorescence signals in both the cell membrane and cytoplasm, while the GFP control group also showed fluorescence signals in both the cell membrane and cytoplasm. These results indicate that CsMep is simultaneously localized in the cell membrane and cytoplasm of plants. Figure 4 ).

[0069] 5. Experimental analysis of the regulatory effect of CsMep gene on the virulence of sorghum anthracnose fungus

[0070] 5.1 Experimental Methods

[0071] (1) Strains and culture conditions

[0072] Subsequent experiments were conducted using *H. 5-1*, the wild-type strain (WT), as the causal agent of sorghum anthracnose. All tested strains were cultured on potato dextrose agar (PDA) plates at 28°C for DNA and RNA extraction and protoplast preparation. Mycelial blocks of the strains were inoculated into the center of plates on complete medium (CM), corn flour agar (CMA), basal medium (MM), oat agar (OA), low-nutrient agar (SNA), and malt extract agar (MEA), respectively, and cultured at 28°C for 7 days. Mycelial blocks of the strains were also inoculated into the center of PDA plates supplemented with different concentrations of zinc sulfate reagent (final concentrations of 1 mM, 2 mM, 3 mM, 4 mM, 5 mM, and 6 mM), and cultured at 28°C for 7 days.

[0073] (2) Construction of mutant strains - gene knockout and complementation

[0074] The CsMep gene was knocked out using a split-PCR-mediated gene knockout assay. Using the genome of *Anthracnose sorghum* as a template, the upstream 1.5kb sequence of the CsMep gene was amplified using the CsMep-AF / AR primer set, and the downstream 1.5kb sequence was amplified using the CsMep-BF / BR primer set. The upstream and downstream 1.5kb sequences were then fused with the 3′ and 5′ ends of hygromycin (HYG), respectively (CsMep-AF2 / HYG-R1 amplification of the upstream fusion was linked to hygromycin, and CsMep-BR2 / HYG-F1 amplification of the downstream fusion was linked to hygromycin), resulting in two fusion fragments. These two fusion fragments were transformed into WT protoplasts, and candidate transformants were screened using hygromycin B (350 μM) and verified by PCR to obtain the ΔCsMep mutant. The primer sequences are as follows:

[0075] CsMep-AF: CGGTCGCTTACTTTGGCCTC (SEQ ID NO. 12);

[0076] CsMep-AF2: CGAGCTGATTGCGTGGTACGAG (SEQ ID NO. 13);

[0077] CsMep-AR: ACCTCCACTAGCTCCAGCCAAGGTCCCAGCAGTATCCACCCT (SEQ ID NO. 14);

[0078] CsMep-BF: GAATAGAGTAGATGCCGACCGGGGGGACTACGCAGCACAATG (SEQ ID NO. 15);

[0079] CsMep-BR2: CTCCAATGCACTACGGTCTGC (SEQ ID NO. 16);

[0080] CsMep-BR: CAGCTACCCAAACAACGGCTC (SEQ ID NO. 17);

[0081] HYG-F1: CGTTGCAAGACCTGCCTGAA (SEQ ID NO. 18);

[0082] HYG-R1: GGATGCCTCCGCTCGAAGTA (SEQ ID NO. 19).

[0083] The CsMep gene sequence was ligated into the pKNTG vector to construct the pKNTG-CsMep recombinant plasmid. The recombinant plasmid was transformed into the ΔCsMep mutant strain. Candidate transformants were screened by hygromycin B (350 μM) and G418 (50 μM), and PCR verification was performed to obtain the ΔCsMep / MEP complement strain.

[0084] (3) Observation of spore morphology of strains

[0085] Conidial suspensions (2×10⁻⁶) of WT strain, mutant strain (ΔCsMep), and complement strain (ΔCsMep / MEP) cultured using different methods were compared. 5 The spores ( / mL) were inoculated onto a hydrophobic coverslip. The coverslip was then placed in a black humidified incubator at 28°C. The germination rate of spores and appressoria was observed at 2h, 4h, 8h, 12h, and 24h using an Axiocam 208 Zeiss microscope (Carl Zeiss, Germany).

[0086] (4) Fungal strains and inoculation

[0087] Sorghum was inoculated using WT strains, mutant strains (ΔCsMep), and complement strains (ΔCsMep / MEP). For spray inoculation, a conidial suspension containing 0.25% (v / v) Tween 20 (5 × 10⁻⁶) was used. 4 Sorghum seedlings at the 4-leaf stage were treated with a 1 / mL solution. The inoculated seedlings were then cultured in the dark at 28℃ and full humidity for 24 hours, followed by culture under full light. Diseased plants were observed and photographed after 5 days. All inoculation experiments were repeated three times.

[0088] 5.2 Experimental Results

[0089] This invention constructed two independent deletion mutant strains (ΔCsMep-123 and ΔCsMep-134) and a complement strain (ΔCsMep / MEP) for virulence and phenotypic analysis. It was observed that on PDA medium, the ΔCsMep mutant showed significant differences compared to the wild-type and complement strains. Figure 5 A and Figure 5 (B), which does not produce spores or appressoria, and only the growth of basal hyphae can be observed. Figure 5 The C). Seven days after inoculation on the sorghum variety Hongyingzi, the wild-type strain and the replacement strain caused typical lesions, and the pathogenicity of the ΔCsMep mutant was significantly reduced (C). Figure 5 (D). The above results indicate that CsMep is essential for maintaining the complete virulence of sorghum anthracnose fungus, influencing pathogenicity by regulating mycelial development and sporulation processes.

[0090] To further analyze the function of CsMep in regulating the nutritional metabolism of pathogens, wild-type strains (WT), mutant strains (ΔCsMep-123 and ΔCsMep-134), and complement strains (ΔCsMep / MEP) were inoculated into six representative culture media (CM, CMA, MM, OA, SNA, and MEA) for systematic analysis. After 7 days of culture, no significant differences in the growth phenotypes of the strains were observed on the other five media, but on MM medium, the mutant strains showed increased aerial hyphae and significantly altered colony morphology. Figure 6 A and Figure 6 (B). Therefore, CsMep may be involved in the metabolic regulation of specific nutrients in MM medium.

[0091] To investigate the functional significance of the zinc ion binding site in CsMep, a zinc stress sensitivity test was conducted. Wild-type strain (WT), mutant strains (ΔCsMep-123 and ΔCsMep-134), and complement strain (ΔCsMep / MEP) were inoculated onto PDA plates treated with different concentrations of zinc sulfate (final concentrations of 1 mM, 2 mM, 3 mM, 4 mM, 5 mM, and 6 mM), and cultured in the dark at 28°C for 7 days before phenotypic observation. The results showed that under 3 mM ZnSO4 treatment, the growth inhibition rate of the mutant strain ΔCsMep was significantly higher than that of the wild-type and complement strains, indicating enhanced sensitivity and weakened tolerance. Figure 7 A and Figure 7 (B). To further elucidate the sensitivity of CsMep deficiency to zinc ions, the morphology of its spores and appressoria was observed. The results showed that, compared with the wild-type and complement strains, the sporulation rate of the mutant strain was significantly reduced, delayed to 12-24 hours, and its appressoria exhibited obvious malformation. Figure 7The above results indicate that CsMep, as a zinc metalloproteinase, participates in the regulation of zinc ion homeostasis, and gene deletion leads to a significant increase in sensitivity to zinc stress and a decrease in tolerance. These findings suggest that the zinc metalloproteinase CsMep may be involved in regulating the response of *Sorghum anthracnose* to external zinc sulfate stress, and may have a potential impact on its pathogenicity.

[0092] 6. Transcriptomics and metabolomics analysis

[0093] 6.1 Transcriptome Analysis

[0094] To further investigate the differences in gene expression among wild-type (WT), mutant strain (ΔCsMep-134), and complement strain (ΔCsMep / MEP) under zinc sulfate stress, transcriptome sequencing was performed on six samples, including: stress group: C1 (WT-ZnSO4), C2 (ΔCsMep-ZnSO4), C3 (ΔCsMep / MEP-ZnSO4), with ZnSO4 concentration of 3 mM, treated in the same manner as in "5. Analysis of the effect of CsMep on the virulence of sorghum anthracnose fungus"; control group: CK1 (WT), CK2 (ΔCsMep), CK3 (ΔCsMep / MEP).

[0095] Total RNA was extracted from strains under different treatments using the TRIzol method (Tiangen, DP424). RNA integrity was ensured by agarose gel electrophoresis and spectrophotometry (260 / 280 = 1.8-2.2). PolyAmRNA was enriched using oligo(dT) magnetic beads, fragmented, and synthesized into double-stranded cDNA, which was then purified using AMPure XP magnetic beads (Beckman-Coulter, Beverly, USA). Libraries were constructed using the Illumina TruSeq library construction kit, and library quality was assessed using an Agilent 4200 (fragment size 350-550 bp). Sequencing was performed on the Illumina NovaSeq 6000 platform (PE150 mode). Raw data were filtered for low-quality reads (Q20 > 95%) and adapter sequences using FastP. High-quality reads were aligned to the reference genome using HISAT2, and transcript assembly and FPKM quantification were performed using StringTie. Differentially expressed genes (DEGs) were analyzed using DEseq2 (log2|foldchange|>1, p-adjust<0.05). GO functional annotation and KEGG pathway enrichment analysis were performed using clusterProfiler (p<0.05), and the distribution trend of gene sets in phenotypes was analyzed using GSEA.

[0096] Principal component analysis (PCA) results showed high clustering of the three biological replicates for each sample, indicating good experimental reproducibility and significant differences between groups, demonstrating the stability and reliability of the experimental protocol and analytical methods of this invention. Figure 8 A). Differentially expressed genes (DEGs) were screened using |log2FoldChange|≥1 and P-value<0.05 as criteria. Volcano plots of differentially expressed genes showed significant differences in the number of DEGs among groups under zinc sulfate stress. Figure 8 In the B group, CK1 vs C1, CK2 vs C2, and CK3 vs C3 were screened and found to have 2127, 3911, and 1655 differentially expressed genes, respectively, including 839, 3262, and 1197 upregulated genes and 776, 858, and 940 downregulated genes. KEGG enrichment results showed that ( Figure 8 Under ZnSO4 stress, DEGs were significantly enriched in the following pathways: amino acid metabolism (tryptophan metabolism, phenylalanine metabolism, tyrosine metabolism), carbohydrate metabolism (starch and sucrose metabolism, pentose and glucuronate interconversions), and amino sugar and nucleotide sugar metabolism. GO enrichment describes the function of differentially expressed genes at three levels: biological process (BP), cellular component (CC), and molecular function (MF). GO enrichment analysis of CK1 vs C1 showed that ( Figure 9Biological processes mainly focus on pathways such as carbohydrate metabolic process, monocarboxylic acid metabolic process, and carbohydrate catabolic process. Cellular components are mainly enriched in pathways such as extracellular region, cell surface, vacuum, and plasma membrane. Differentially expressed genes involved in molecular function are mainly enriched in pathways such as transmembrane transporter activity, hydrolase activity, hydrolyzing O-glycosyl compounds, and acting on glycosyl bonds. GO enrichment analysis of the CK2 vsC2 group showed that ( Figure 10 Biological processes were mainly enriched in pathways such as carbohydrate metabolic process, small molecule catabolic process, and polysaccharide catabolic process. Cellular components were mainly enriched in pathways such as plasmamembrane, extracellular region, and lytic vacuole. Differentially expressed genes were mainly enriched in pathways such as transmembrane transporter activity, hydrolase activity, hydrolyzing O-glycosyl compounds, and organic molecular entity transmembrane transporter activity. GO enrichment analysis of CK3 vs C3 showed that ( Figure 11 Biological processes mainly focus on pathways such as the carbohydrate metabolic process and the polysaccharide catabolic process. Cellular components are mainly enriched in pathways such as the plasma membrane, cell surface, and external encapsulating structures.

[0097] 6.2 Metabolomics Analysis

[0098] 100 μL of the bacterial sample (same as 6.1) was added to 400 μL of pre-cooled extraction buffer (methanol:acetonitrile = 3:1, -40℃), vortexed, and sonicated for 15 min, then incubated at 4℃ for 1 h. After centrifugation at 12000 rpm for 15 min, the supernatant was collected and concentrated under vacuum, then reconstituted with 50% methanol. LC-MS / MS analysis was performed using a Thermo Vanquish UHPLC system coupled with an Orbitrap Q Exactive HF-X mass spectrometer. Chromatographic conditions: HSST3 column (2.1 × 100 mm), column temperature 40℃, flow rate 0.3 mL / min, mobile phase: 0.1% formic acid, water, and methanol. Mass spectrometry parameters: ESI source, positive and negative ion mode, scan range m / z 70-1050, resolution 120,000. Peak extraction and metabolite identification were performed using XCMS, and multivariate statistical analysis was performed using MetaboAnalyst 5.0. Differential metabolite screening criteria: VIP>1, p<0.05 (t-test), |log2FC|≥0.5. KEGG pathway enrichment was performed using clusterProfiler (p<0.05). QC samples were inserted throughout the experiment to monitor data quality.

[0099] The metabolic responses of wild-type (WT), mutant (ΔCsMep), and complemented (ΔCsMep / MEP) strains to ZnSO4 stress were analyzed, with three biological replicates for each group. Metabolomics analysis was performed using non-targeted liquid chromatography-mass spectrometry (LC-MS). Principal component analysis (PCA) showed good reproducibility within groups and significant separation between groups, indicating that the data are reliable and suitable for subsequent experiments and analyses. Figure 12 A). Metabolites with significant differences were screened using P < 0.05 and VIP > 1 as criteria. Figure 12In the BD (Brown-White) classification, 886, 790, and 234 metabolites were significantly upregulated in CK1 vs C1, CK2 vs C2, and CK3 vs C3, respectively, while 797, 924, and 436 metabolites were significantly downregulated. The compounds annotated in the database were of various types, mainly belonging to the following six categories: Carboxylic acids and derivatives, FattyAcyls, Benzene and substitutedderivatives, Organooxygen compounds, Steroids and steroid derivatives, and Prenolipids metabolites, accounting for 27.9%, 15.6%, 10.7%, 9.8%, 4.8%, and 4.2% of the total identified metabolite types, respectively. The types of metabolite pathways enriched at the four levels of Metabolism, Environmental Information Processing, Organismal Systems, and Human Diseases are as follows: At the Metabolism level, enrichment is mainly concentrated in pathways such as Global and Overview Maps, Amino Acid Metabolism, Biosynthesis of Other Secondary Metabolites, and Chemical Structure Transformation Maps; at the Environmental Information Processing level, enrichment is mainly concentrated in pathways such as Membrane Transport and Signal Transduction; at the Organismal Systems level, enrichment is mainly concentrated in pathways such as the Digestive System and Endocrine System; and at the Human Diseases level, enrichment is concentrated in pathways such as Cancer:Overview. Figure 13 A). KEGG enrichment analysis of its differential metabolites showed ( ) Figure 13 The pathways of B), Biosynthesis of amino acids, Nucleotide metabolism, ABC transporters, Purine metabolism, and Protein digestion and absorption were significantly enriched.

[0100] 6.3 Integrated Analysis

[0101] By integrating transcriptomic and metabolomic data, the effects of zinc sulfate stress on wild-type, mutant, and complement strains were systematically analyzed. Seventeen KEGG pathways were co-enriched in the three comparison groups (CK1 vs C1, CK2 vs C2, CK3 vs C3), mainly enriched in ABC transporters, cutin, suberine and wax biosynthesis, fattyacid metabolism, phenylalanine, tyrosine and tryptophan biosynthesis, and tyrosine metabolism. The number of differentially expressed genes and metabolites detected in the enriched pathways for each sample was counted. Significant changes in differentially expressed genes and metabolites were observed in the phenylalanine, tyrosine, and tryptophan biosynthesis pathway. Secondary metabolites from this pathway can directly chelate heavy metals, reducing toxicity and preventing the accumulation of reactive oxygen species, playing a crucial role in antioxidant defense. The key genes encoding this pathway, namely Aromatic aminoacid biosynthesis multifunctional enzyme 1 (ARO1), Shikimate kinase I (aroK), Tryptophan synthase alpha subunit (trpA), Tryptophan synthase beta subunit (trpB), Probable proline racemase A (preA), and Tyrosine aminotransferase (TAT), all showed varying degrees of differential expression. Figure 14 (a). Notably, the genes encoding ARO1 (CSUB01_00269) and trpB (CSUB01_01215) were significantly upregulated in the mutant strain, indicating that zinc metalloproteinases play an important role in alleviating zinc toxicity. Major differentially expressed metabolites included L-Phenylalanine, Indole, L-Tryptophan, 4-Hydroxyphenylpyruvic acid, and Protocatechuic acid, among which Indole and Protocatechuic acid were significantly downregulated in the mutant strain. Figure 14b) further confirms the key role of the Phenylalanine, tyrosine and tryptophan biosynthesis pathway in heavy metal stress response, providing new molecular insights into the understanding of microbial heavy metal tolerance mechanisms.

[0102] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of knocking out the zinc metalloproteinase CsMep gene in inhibiting the pathogenicity of Colletotrichum siccinnense, characterized in that, The nucleotide sequence of the zinc metalloprotease CsMep gene is shown as SEQ ID NO.

1.

2. The application of knocking out the zinc metalloproteinase CsMep gene in inhibiting the growth of Colletotrichum gossypii, characterized in that, The nucleotide sequence of the zinc metalloprotease CsMep gene is shown as SEQ ID NO.

1.

3. Use according to claim 2, characterized in that, The inhibiting the growth of the Colletotrichum gossypii includes inhibiting the hypha growth of the Colletotrichum gossypii.

4. Use according to claim 2, characterized in that, The inhibiting the growth of the Colletotrichum gossypii also includes inhibiting the conidium production of the Colletotrichum gossypii.

5. Use according to claim 2, characterized in that, The inhibiting the growth of the Colletotrichum gossypii also includes inhibiting the appressorium production of the Colletotrichum gossypii.

6. The use of the product of knocking out the zinc metalloproteinase CsMep gene in the preparation of a colletotrichum gossypii fungicide, characterized in that, The nucleotide sequence of the zinc metalloprotease CsMep gene is shown as SEQ ID NO.

1. The nucleotide sequence of the zinc metalloprotease CsMep gene is shown as SEQ ID NO. 1.