A TRV-based plant gene editing vector, kit, and gene editing method

Abstract

This invention provides the structure, sequence, construction method, and application of a plant virus gene editing vector in plant gene editing. The key point is the use of the TRV2 genome of tobacco brittle virus (TRV) to carry the expression of the small Cas gene AsCas12f and its gRNA. Preferably, AsCas12f and its gRNA are expressed in tandem using TRV2, forming an AsCas12f-tRNA-gRNA expression cassette structure. This expression cassette replaces a portion of the 2b gene sequence of TRV2 on the TRV2 genome, forming the TRV virus-based plant gene editing vector pTRV2-Cas12f-gRNA, which enables long-term stable expression and gene editing after inoculation with wild-type Nicotiana Bunsen. This invention also provides a method for gene editing in wild-type plants using plant viruses.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the structure, sequence, construction method of a plant virus gene editing vector and its application in plant gene editing. Background Technology

[0002] CRISPR / Cas gene editing technology has enormous application value in plant gene function research and germplasm improvement. Currently, plant gene editing mainly utilizes Agrobacterium infection and tissue culture-mediated genetic transformation systems, but gene editing research is difficult to conduct on most non-model plants due to the immaturity of their genetic transformation systems.

[0003] Plant viruses can be engineered into viral vectors to carry genes and express them in plants, holding immense potential for application in plant gene editing. However, due to the relatively large size of traditional Cas proteins (Cas9 gene approximately 4.2 kb, Cas12a gene approximately 3.8 kb), plant viruses struggle to carry large Cas genes for systemic infection and stable expression, which is one of the main obstacles to current plant virus gene editing research. Therefore, research on virus-mediated plant gene editing primarily involves first using transgenic methods to stably express Cas proteins in plant cells, and then using viral vectors to express gRNA in Cas-transgenic plants. However, obtaining Cas9-transgenic plants is currently difficult for many plants, and Cas9 transgenic plants are not conducive to the commercial application of varieties. To address this problem, this invention utilizes the TRV2 genome of tobacco brittle virus to carry and express the small Cas gene AsCas12f and its gRNA. By exploring the expression mode of AsCas12f and its gRNA and the structure of the viral vector, long-term stable gene editing in wild-type plants is achieved. Summary of the Invention

[0004] The purpose of this invention is to develop a novel plant gene editing technology and effectively apply it to plant genome editing, overcoming the shortcomings of existing plant genome editing technologies in achieving systematic infection and stable expression through a single transfection. Furthermore, some vectors of this invention can also achieve specific, instantaneous, and highly efficient editing effects.

[0005] The first aspect of the present invention provides a gene editing vector based on a plant virus, characterized in that the plant virus is tobacco brittle virus (TRV), and the gene editing vector utilizes the RNA2 (TRV2) of TRV to tandemly express the gene editing element AsCas12f and its gRNA, forming an AsCas12f-tRNA-gRNA expression cassette structure.

[0006] In some embodiments, AsCas12f-tRNA-gRNA is abbreviated as AsCas12f-gRNA. Based on the description of the embodiments and the accompanying drawings, those skilled in the art will understand that the two have the same structure.

[0007] In a preferred embodiment of the present invention, the sequence of the AsCas12f-tRNA-gRNA expression cassette is shown in SEQ ID NO.7, wherein N is the editing site sequence of the target gene, and the number of bases in N ranges from 15 to 25.

[0008] In a preferred embodiment of the present invention, the carrier is obtained through the following steps:

[0009] The AsCas12f-tRNA-gRNA expression cassette and the pNC-TRV2 vector were subjected to a Nimble Cloning reaction. The molar ratio of the pNC-TRV2 vector to the AsCas12f-tRNA-gRNA expression cassette in the cloning reaction system was 1:2 to 1:10, preferably 1:3 to 1:7, and more preferably 1:4 to 1:6.

[0010] Preferably, the cloning reaction system contains 60 ng of pNC-TRV2 vector, 30-50 ng of AsCas12f-tRNA-gRNA expression cassette, 5 μL of Nimble Mix reaction solution, and a total system volume of 10 μL. The reaction conditions are 50°C for 30 minutes.

[0011] Optionally, the cloning reaction system can be scaled up or down proportionally according to the aforementioned reaction system.

[0012] In a preferred embodiment of the present invention, the nucleotide sequence of the plant virus-based gene editing vector is shown in SEQ ID NO.1, wherein N is the editing site sequence of the target gene, and the number of bases in N ranges from 15 to 25.

[0013] Preferably, the number of bases in N ranges from 18 to 20.

[0014] Preferably, the number of bases in N is in the range of 20.

[0015] Another aspect of the present invention provides a method for constructing a plant virus gene editing vector, characterized in that the method involves cloning the gene editing element AsCas12f and its gRNA into the genome of tobacco brittle virus TRV, and using TRV RNA2 (TRV2) to tandemly express the gene editing element AsCas12f and its gRNA to form an AsCas12f-tRNA-gRNA expression cassette structure.

[0016] Preferably, the sequence of the AsCas12f-tRNA-gRNA expression cassette is shown in SEQ ID NO.6, where N is the editing site sequence of the target gene, and the number of bases in N ranges from 15 to 25.

[0017] Preferably, the number of bases in N ranges from 18 to 20.

[0018] Preferably, the number of bases in N is in the range of 20.

[0019] Preferably, the carrier construction method includes the following steps:

[0020] The AsCas12f-tRNA-gRNA expression cassette and the pNC-TRV2 vector were subjected to a Nimble Cloning reaction. The ratio of the pNC-TRV2 vector to the AsCas12f-tRNA-gRNA expression cassette in the cloning reaction system was 1:2 to 1:10, preferably 1:3 to 1:7, and more preferably 1:4 to 1:6.

[0021] Preferably, the cloning reaction system contains 60 ng of pNC-TRV2 vector, 30-50 ng of AsCas12f-tRNA-gRNA expression cassette, 5 μL of Nimble Mix reaction solution, and a total system volume of 10 μL. The reaction conditions are 50°C for 30 minutes.

[0022] Optionally, the cloning reaction system can be scaled up or down proportionally according to the aforementioned reaction system.

[0023] In a preferred embodiment of the present invention, the nucleotide sequence of the plant virus-based gene editing vector is shown in SEQ ID NO.1, wherein N is the editing site sequence of the target gene, and the number of bases in N ranges from 15 to 25.

[0024] Preferably, the number of bases in N ranges from 18 to 20.

[0025] Preferably, the number of bases in N is in the range of 20.

[0026] Another aspect of the present invention provides a plant virus-mediated gene editing method, the specific steps of which are as follows:

[0027] 1) Transform Agrobacterium using any of the aforementioned vectors, or vectors obtained by any of the methods described above;

[0028] 2) Infect the target plant with the Agrobacterium containing the carrier obtained in step 1), preferably by injection or immersion.

[0029] The present invention also provides a kit, characterized in that the kit comprises a pNC-TRV2 vector and an AsCas12f-tRNA-gRNA expression cassette structure, and further comprises a reaction solution for constructing the vector, wherein the sequence of the AsCas12f-tRNA-gRNA expression cassette is shown in SEQ ID NO.7, wherein N is the editing site sequence of the target gene, and the number of bases of N ranges from 15 to 25, and the reaction solution is Nimble Mix reaction solution.

[0030] The present invention also provides the application of the vector described in any of the foregoing claims, or the vector obtained by any of the methods described, or the kit described herein, in plant gene editing.

[0031] Compared with the prior art, the technical solution provided by this invention has the following advantages:

[0032] First, by tandemly expressing the gene-editing element AsCas12f and gRNA and optimizing their position in the TRV2 genome, the constructed plant virus gene-editing vector can be stably expressed and used for gene editing in wild-type plants for a long time.

[0033] Second, while tobacco brittle virus (TRV) has a wide host range and great application potential, it is difficult to carry Cas9 for systemic infection and stable expression. This invention successfully utilized TRV to carry Cas12f for systemic infection and stable expression, achieving long-term stable gene editing. Attached Figure Description

[0034] The beneficial effects of the present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0035] Figure 1 This is an electrophoresis diagram of the target fragment amplified by the vector construction; M: DL2000 Marker; 1: AsCas12f-tRNA-gRNA; 2: AsCas12f; 3: gRNA.

[0036] Figure 2 This is a schematic diagram of the vector structure for tandem and independent expression of AsCas12f and its gRNA; ΔCP: CP removal gene; 2X35S: promoter; Nos: terminator.

[0037] Figure 3 This is a plasmid map of pTRV2-Cas12f-gRNA; 2b: part of the 2b gene of TRV2 (5' end).

[0038] Figure 4 This indicates the gene editing type of pTRV2-Cas12f-gRNA in plants; red indicates the PAM sequence; underline indicates the target gene sequence.

[0039] Figure 5 The gene editing efficiency of AsCas12f and its gRNA tandem and independent expression is represented by A, B, and C, indicating highly significant differences between groups.

[0040] Figure 6 This is a schematic diagram of the structure of TRV2 gene editing vectors with different AsCas12f-gRNA carrying locations and different viral structures.

[0041] Figure 7 The gene editing efficiency of TRV2 gene editing vectors with different carrying positions and different viral structures of AsCas12f-gRNA is shown; L0: injection leaf 7 days after inoculation; L1-L6: 6 consecutive systematic leaves above the injection leaf 40 days after inoculation; F: flower 40 days after inoculation.

[0042] Figure 8 This is an RT-PCR detection 40 days after pTRV2-Cas12f-gRNA inoculation; A: vector primers; B: Cas12f gene primers.

[0043] Figure 9 These are symptoms in plants 45 days after pTRV2-Cas12f-gRNA inoculation. Detailed Implementation

[0044] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0045] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0046] The nucleotide sequence of the pTRV2-Cas12f-gRNA vector involved in this invention is shown in SEQ ID NO.1:

[0047] SEQ ID NO.1

[0048] agtggtctctgtccagt cctatggctccgaagaagaagag aggcgaagaagaagaagtgaa acaaagcaccagtggtctagtggtagaatagtaccctgccacggtacagacccgggttcgattcccggctggtgca ggattcgtcggttc agcgac gataagccgagaagtgccaataaaactgttaagtggtttggtaacgctcggtaaggtccgaaaggagaaccactgaacN tttttttacttgtggtctgctgagacc

[0049] SEQ ID NO.2

[0050] agtggtctctgtccagtcctatggctccgaagaagaagag

[0051] SEQ ID NO.3

[0052] ggtctcagcagaccacaagtaaaaaaatcgctactaccaa

[0053] SEQ ID NO.4

[0054] ggtctcagcagaccacaagttcacttcttcttcttcgcct

[0055] SEQ ID NO.5

[0056] agtggtctctgtccagtcctggattcgtcggttcagcgac

[0057] SEQ ID NO.6

[0058] ttatgttttggtagtagcga

[0059] SEQ ID NO.7

[0060] N tttttttacttgtggtctgctgagacc

[0061] Example 1: Construction of TRV viral vectors with different expression modes of AsCas12f and its gRNA and their gene editing efficiency

[0062] (1) Design primers for tandem and independent expression of AsCas12f and its gRNA and amplify the target fragment.

[0063] Based on the nucleic acid sequences of AsCas12f and its gRNA, a pair of primers was designed to amplify the tandem expression structure of AsCas12f-gRNA. The upstream primer (SEQ ID NO.2) is: agtggtctctgtccagtcctatggctccgaagaagaagag, and the downstream primer (SEQ ID NO.3) is: ggtctcagcagaccacaagtaaaaaaatcgctactaccaa. A pair of primers was also designed to amplify the fragment expressed by AsCas12f alone. The upstream primer is the same as SEQ ID NO.2, and the downstream primer (SEQ ID NO.4) is: ggtctcagcagaccacaagttcacttcttcttcttcgcct. A pair of primers was also designed to amplify the fragment expressed by gRNA (including tRNA) alone. The upstream primer (SEQ ID NO.5) is: agtggtctctgtccagtcctggattcgtcggttcagcgac, and the downstream primer is the same as SEQ ID NO.3. The gRNA sequences were all designed to contain the editing target sequence of the Nicotiana sambac PDS gene (SEQ ID NO.6): ttatgttttggtagtagcga.

[0064] Using artificially synthesized AsCas12f-tRNA-gRNA (Shanghai Sangon Biotech) as a template, PCR amplification was performed using the three pairs of primers mentioned above and Prime STAR high-fidelity polymerase (Takara). The PCR amplification program was: 98℃ for 30 seconds; 98℃ for 10 seconds, 55℃ for 20 seconds, 72℃ for 30 seconds, for 28 cycles; and a final extension at 72℃ for 1 minute. The PCR products were detected by agarose gel electrophoresis, and the target bands AsCas12f-tRNA-gRNA, AsCas12f, and gRNA (including tRNA) were recovered by gel excision. Figure 1 ).

[0065] (2) The recovered fragments were cloned into the pNC-TRV2-OE and pNC-TRV2 vectors.

[0066] The three recovered fragments were subjected to Nimble Cloning reactions with the pNC-TRV2-OE (patent publication number: CN116064647B) and pNC-TRV2 (https: / / www.addgene.org / 193402 / ) vectors, respectively. The pNC-TRV2-OE vector was constructed with the target gene replacing the TRV2 CP gene (ΔCP), and the pNC-TRV2 vector was constructed with the target gene replacing a portion of the TRV2 2b gene. The cloning reaction system consisted of 60 ng of vector, 30-50 ng of recovered fragments, and 5 μL of Nimble Mix (Nixing Biotechnology, catalog number NC001), for a total volume of 10 μL. The reaction conditions were 50°C for 30 minutes. 5 μL of the ligation product was transformed into competent *E. coli* cells. After overnight culture, the resulting single clones were identified by PCR and sequencing, yielding six plant virus gene-editing vectors containing gene-editing elements with correct sequences. These vectors were named pTRV2-ΔCP-Cas12f-gRNA (pNC-TRV2-OE and AsCas12f-tRNA-gRNA nimble cloning reaction), pTRV2-ΔCP-Cas12f (pNC-TRV2-OE and AsCas12f nimble cloning reaction), pTRV2-ΔCP-gRNA (pNC-TRV2-OE and gRNA nimble cloning reaction), and pTRV2-Cas12f-gRNA (pNC-TRV2 and AsCas12f-tRNA-gRNA nimble cloning reaction).

[0067] pTRV2-Cas12f (pNC-TRV2 undergoes a nimble cloning reaction with AsCas12f) and pTRV2-gRNA (pNC-TRV2 undergoes a nimble cloning reaction with gRNA), their structural diagrams are shown below. Figure 2 The sequence of pTRV2-Cas12f-gRNA is shown in SEQ ID NO.1, where the N base is ttatgttttggtagtagcga. Its plasmid map is shown below. Figure 3 .

[0068] (3) Gene editing efficiency test

[0069] Plasmids from six vectors were extracted and transformed into Agrobacterium GV3101. Single colonies of Agrobacterium were picked for PCR identification. Single colonies containing the target vector were inoculated into 5 ml of LB liquid medium and cultured at 200 rpm and 28°C with shaking until the OD600 reached 1.0-1.5. The bacterial culture was centrifuged at 5000 rpm for 5 minutes, and the supernatant was discarded. 5 ml of injection buffer (50 mM MES pH 5.6, 10 mM MgCl2, 100 uM acetosyringone) was added, and the culture was gently resuspended. The culture was centrifuged at 5000 rpm for 5 minutes, and the supernatant was discarded. Injection buffer was added again until the OD600 reached 0.3-0.6. After incubation at room temperature in the dark for 1-2 hours, different combinations of Agrobacterium were injected into tobacco leaves (with TRV1 injection solution mixed in equal proportions). Agrobacterium injection was performed using a 1 ml syringe without the needle, injected into the lower epidermis of the tobacco leaves. Seven days post-injection, DNA was extracted from the injected area of ​​the leaves using the TransDirect® Plant Tissue PCR Kit (Beijing TransGen), and the target sequence was amplified by PCR. The primers were: upstream primer: ggagtgagtacggtgtgcgaggtcttcgttggg; downstream primer: gagtggatgctggatggcctttgtcaatcttcgggtc. The PCR products were subjected to HI-TOM high-throughput sequencing, with three replicates tested, and the sequencing results were analyzed and compared. Sequencing results showed that gene editing could be achieved using pNC-TRV2-OE and pNC-TRV2 vectors to express AsCas12f and gRNA, with the main gene editing type being the deletion of 8-20 bases. Figure 4 Furthermore, the gene editing efficiency mediated by AsCas12f-gRNA tandem expression was higher than that mediated by AsCas12f and gRNA independent expression. Figure 5 (p<0.01).

[0070] Example 2: Vector construction of AsCas12f-tRNA-gRNA at different locations in the TRV2 genome and its gene editing efficiency

[0071] (1) Design and construct TRV2 gene editing vectors with different AsCas12f-tRNA-gRNA carrying sites and different viral structures.

[0072] To obtain TRV2 vectors that can stably express AsCas12f-tRNA-gRNA, six TRV2 gene editing vectors with different AsCas12f-tRNA-gRNA carrying locations and different viral structures were constructed, two of which are pTRV2-ΔCP-Cas12f-gRNA and pTRV2-Cas12f-gRNA from Example 1. The other four are: pTRV2-2bP-Cas12f-gRNA, where Cas12f-tRNA-gRNA replaces the entire 2b gene of TRV2, retaining only the 2b gene promoter (2bP); pTRV2-PEBV-Cas12f-gRNA, where Cas12f-tRNA-gRNA replaces the entire 2b gene of TRV2 and its promoter, with a PEBV promoter added before Cas12f-gRNA; pTRV2-2b-Cas12f-gRNA, where Cas12f-tRNA-gRNA is cloned after the 2b gene of TRV2, retaining the complete 2b gene; and pTRV2-Cas12f-gRNA-2b, where Cas12f-tRNA-gRNA is cloned before the 2b gene of TRV2, retaining the complete 2b gene. The latter four vectors were constructed using a seamless cloning method. Schematic diagrams of the structures of the six TRV2 gene editing vectors with different AsCas12f-gRNA carrying locations and different viral structures are shown below. Figure 6 .

[0073] (2) Gene editing efficiency test

[0074] Plasmids from six vectors were extracted and transformed into Agrobacterium GV3101. Single colonies of Agrobacterium were picked for PCR identification. Single colonies containing the target vector were inoculated into 5 ml of LB liquid medium and cultured at 200 rpm and 28°C with shaking until the OD600 reached 1.0-1.5. The bacterial culture was centrifuged at 5000 rpm for 5 minutes, and the supernatant was discarded. 5 ml of injection buffer (50 mM MES pH 5.6, 10 mM MgCl2, 100 uM acetosyringone) was added, and the culture was gently resuspended. The culture was centrifuged at 5000 rpm for 5 minutes, and the supernatant was discarded. Injection buffer was added again until the OD600 reached 0.3-0.6. After incubation at room temperature in the dark for 1-2 hours, the injection solutions of the six TRV2 vectors were mixed 1:1 with the TRV1 injection solution and injected into the tobacco leaves. Agrobacterium injection was performed using a 1 ml syringe without the needle, injected into the lower epidermis of the tobacco leaves. Seven days post-injection, DNA was extracted from the injection region of the leaves using the TransDirect® Plant Tissue PCR Kit (Beijing TransGen), and the target sequence was amplified by PCR. Forty days post-injection, DNA was extracted from six consecutive systematic leaves above the injected leaf and from the flower for amplification of the target gene sequence to detect gene editing efficiency. The amplification primers were: upstream primer: ggagtgagtacggtgtgcgaggtcttcgttggg; downstream primer: gagtggatgctggatggcctttgtcaatcttcgggtc. PCR products were subjected to HI-TOM high-throughput sequencing, with three replicates tested, and the sequencing results were analyzed and compared. Sequencing results showed that all six vectors could perform gene editing with high efficiency in the injection region of the inoculated leaves, with pTRV2-ΔCP-Cas12f-gRNA exhibiting the highest gene editing efficiency, but gene editing was not detected in the systematic leaves. Of the six vectors, only pTRV2-Cas12f-gRNA showed gene editing in all six systematic leaves and flowers, indicating that this vector can perform stable gene editing over a long period of time. Figure 7 To further verify the stable expression of pTRV2-Cas12f-gRNA, RNA was extracted from six consecutive systematic leaves above the injected leaf 40 days after injection. RT-PCR was performed using Cas12f gene primers and viral vector primers at both ends to analyze Cas12f expression and the stability of Cas12f carried by the virus. The results showed that the target band was amplified from all six systematic leaves using both Cas12f gene primers and vector primers. Figure 8 This indicates that pTRV2-Cas12f-gRNA can be stably expressed in Nicotiana Bunsenata. Plants inoculated with pTRV2-Cas12f-gRNA for 45 days showed good growth, exhibiting only mild viral symptoms such as leaf wrinkling, and were able to flower normally. Figure 9This indicates that the vector does not cause fatal damage to the plant, and combined with its ability to perform stable gene editing, it is suitable for virus-mediated plant gene editing.

[0075] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-disclosed technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. A plant virus-based gene editing vector, characterized in that, The nucleotide sequence of the gene editing vector is shown in SEQ ID NO. 1, wherein N is an editing site sequence of a target gene, and the base number of N ranges from 15 to 25.

2. A method for constructing a plant virus-based gene editing vector, characterized by, The method is to clone the gene editing element AsCas12f and its gRNA to the tobacco rattle virus (TRV) genome, utilize the RNA2 of TRV to express the gene editing element AsCas12f and its gRNA in series, form an AsCas12f-tRNA-gRNA expression frame structure, and the sequence of the AsCas12f-tRNA-gRNA expression frame is shown in SEQ ID NO. 7, wherein N is an editing site sequence of a target gene, and the base number of N ranges from 15 to 25, and the gene editing vector is obtained by Nimble Cloning cloning reaction of the AsCas12f-tRNA-gRNA expression frame and the pNC-TRV2 vector.

3. The method of claim 2, wherein the method further comprises: (a) introducing a first donor template into the cell; (b) introducing a second donor template into the cell; and (c) introducing a third donor template into the cell. The method comprises the following steps: The Nimble Cloning cloning reaction is performed on the AsCas12f-tRNA-gRNA expression frame and the pNC-TRV2 vector, and the molar ratio of the pNC-TRV2 vector to the AsCas12f-tRNA-gRNA expression frame in the cloning reaction system is 1:2-1:

10.

4. A method of plant virus-mediated gene editing, characterized in that, The specific steps are: 1) transforming Agrobacterium with the gene editing vector of claim 1, or the gene editing vector obtained by the method of any one of claims 2-3; 2) using the Agrobacterium containing the vector obtained in step 1) to infect a target plant, and the plant is tobacco.

5. A kit characterized in that, The kit comprises a pNC-TRV2 vector and an AsCas12f-tRNA-gRNA expression frame structure, and further comprises a reaction solution for constructing the vector, and the sequence of the AsCas12f-tRNA-gRNA expression frame is shown in SEQ ID NO. 7, wherein N is an editing site sequence of a target gene, and the base number of N ranges from 15 to 25, and the reaction solution is Nimble Mix reaction solution.

6. The gene editing vector of claim 1, or the gene editing vector obtained by the method of any one of claims 2-3, or the kit of claim 5, in the application of plant gene editing, and the plant is tobacco.

Images