A method of determining the origin of tobacco constituents

Abstract

This invention relates to a method for determining the source of tobacco components, belonging to the field of molecular biology. The method includes the following steps: ① Designing primers based on the tobacco-specific SSR-1 marker; extracting DNA from the sample to be tested, performing PCR amplification on the DNA using the primers to obtain a first amplification product, and analyzing by electrophoresis to determine whether a tobacco species-specific band is present; if present, the sample to be tested contains tobacco components; ② Eluting the sample containing tobacco components, extracting the eluted DNA from the sample, performing PCR amplification on the eluted DNA using the primers to obtain a second amplification product, and analyzing by electrophoresis to determine whether a tobacco species-specific band is present; if present, the tobacco component is endogenous; the elution buffer used is a 1.0–2.0 mol / L NaCl solution. This method can both determine whether the sample to be tested is tobacco and identify the source of the component.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of molecular biology, and particularly relates to a method for determining the source of tobacco components. BACKGROUND

[0002] It is difficult to identify tobacco from appearance, and the detection of chemical components such as nitrosamine and nicotine specific to tobacco for identifying tobacco has the following limitations: first, nicotine is not unique to tobacco and is also common in other solanaceous plants; second, chemical component detection is easily interfered by illegal additives adopted by illegal persons. In addition to the above, the regulations require that the inspectors not only master the relevant raw material properties, chemical component analysis methods, sensory evaluation and smoking techniques, but also have tobacco leaf production and grading skills, which makes the training of inspectors difficult; in addition, the mold of tobacco itself and the dyeing means adopted by illegal persons also increase the difficulty of accurate identification by inspectors. Therefore, relying on the existing inspection methods to identify tobacco is prone to cause misjudgment and wrong judgment.

[0003] Chinese patent application with publication number CN104962648A discloses a method for identifying tobacco raw materials by using FMYYSSR-1 molecular marker technology. After the DNA of each sample is extracted by using cetyltrimethylammonium bromide (CTAB) method, the primer designed in the application is used for PCR amplification, and after electrophoresis analysis, the specific band position of the tobacco species is determined, and whether the sample is tobacco is determined according to whether the amplification band is generated at the corresponding position.

[0004] In the identification process of tobacco and tobacco products, it is not only necessary to identify whether the sample is tobacco, but also to determine whether the tobacco component is an exogenous addition. The exogenous addition, for example, is to add tobacco components (such as tobacco extract) to non-tobacco matrix (tea leaves, tree leaves, etc.) for mixing to serve as tobacco products. The endogenous tobacco refers to the sample itself being tobacco.

[0005] The determination of whether the tobacco component is an exogenous addition is a necessary link and a difficulty. The traditional appearance and sensory evaluation identification method is difficult to determine the source of the tobacco component, which causes difficulties in the current identification and inspection of tobacco and tobacco products.

[0006] The technical solution disclosed in the above document (CN104962648A) can only determine whether the sample contains tobacco components, and cannot further determine whether the tobacco components are endogenous or exogenous additions. SUMMARY

[0007] The purpose of the present application is to provide a method for determining the source of tobacco components, which can identify the source of tobacco components.

[0008] In order to achieve the above purpose, the technical solution adopted by the present application is:

[0009] A method for determining the source of tobacco components, comprising the following steps:

[0010] (1) Design primers according to the tobacco-specific SSR-1 marker; extract DNA from the sample to be tested, perform PCR amplification on the DNA using the primers to obtain a first amplification product, and perform electrophoresis analysis on the first amplification product to determine whether a specific band of the tobacco species exists; if the specific band exists, it indicates that the sample to be tested contains tobacco components;

[0011] (2) Perform elution on the sample to be tested containing tobacco components, extract DNA from the eluted sample to be tested, perform PCR amplification on the DNA of the eluted sample to be tested using the primers to obtain a second amplification product, and perform electrophoresis analysis on the second amplification product to determine whether a specific band of the tobacco species exists; the eluent used for the elution is a NaCl solution with a concentration of 1.0-2.0 mol / L;

[0012] If the specific band exists, it indicates that the tobacco components are endogenous; if not, it indicates that the tobacco components are exogenous.

[0013] The method for determining the source of tobacco components of the present application extracts DNA from a sample, performs PCR amplification on the DNA using the primers designed by the present application, determines the position of the specific band of the tobacco species after electrophoresis analysis, performs elution on the sample using a NaCl solution, and extracts DNA from the sample after elution for PCR amplification, so as to determine whether the tobacco components are endogenous or exogenous by whether a specific band of tobacco exists.

[0014] DNA is a significant marker for distinguishing between species, and thus the source of tobacco DNA can be determined to determine the source of tobacco components. The SSR markers developed and published in tobacco at present serve as the basis for screening and filtering. The specific analysis steps are as follows: 1. Take Arabidopsis thaliana, Nicotiana benthamiana (a model tobacco species commonly used internationally and having a close genetic relationship with common tobacco), cultivated tobacco, tomato, and potato as reference sequences, and compare the candidate markers; 2. Filter out the SSR markers that can be compared with Arabidopsis thaliana, tomato, and potato; 3. Select the SSR markers that can be compared with Nicotiana benthamiana and cultivated tobacco and have a single amplification sequence; 4. Screen the markers to scan all species gene sequence information in the National Center for Biotechnology Information (NCBI) database to verify the specificity of the primers in tobacco. After screening, it is found that the SSR-1 marker can identify tobacco samples.

[0015] Further, in the step (1) and the step (2), the upstream primer for the PCR amplification is shown as SEQ ID NO: 1, and the downstream primer is shown as SEQ ID NO: 2. The primers have specificity in tobacco and can identify whether the sample to be tested is tobacco. The DNA molecular marker identification and elution means determine the source of tobacco components, which has the advantages of more objectivity, more accuracy and more reliability compared with the traditional appearance identification method and smoking identification method.

[0016] Further, the NaCl solution is used to elute the sample to be tested for 3-5 times.

[0017] Further, 2 mL of the NaCl solution is used for every 0.1 g of the sample to be tested.

[0018] Further, the DNA extraction of the sample to be tested includes the following steps: (a) grinding the sample to be tested into fine powder and placing it in a 2 mL centrifuge tube; (b) adding 600-800 μL of CTAB extraction buffer at 65°C to the centrifuge tube, mixing, gently shaking for 5-7 times every 3-5 min, and centrifuging at 12000 r / min for 10-15 min after 20 min; (c) aspirating 400 μL of supernatant, adding an equal volume of phenol and chloroform to the supernatant, mixing, and centrifuging at 12000 r / min at 4°C for 10-15 min; (d) aspirating the supernatant, adding an equal volume of chloroform to the supernatant, mixing, and centrifuging at 12000 r / min at 4°C for 10-15 min, repeating 2-3 times until no protein layer appears; (e) taking the supernatant, precipitating at -20°C for 1-2 h, and centrifuging at 12000 r / min at 4°C for 10-15 min; (f) discarding the supernatant, washing the precipitate with 50%-70% ethanol twice; drying at room temperature for 10-15 min, and storing at -20°C or -70°C for standby use. The steps of extracting and eluting the DNA of the sample to be tested are the same as the steps described above.

[0019] The CTAB extraction buffer is a 2% aqueous solution of cetyltrimethylammonium bromide.

[0020] Further, the reaction system of the PCR amplification includes 20.8 μL of H2O, 3 μL of 10× PCR buffer, 1 μL of 5'-primer, 1 μL of 3'-primer, 2 μL of dNTPs, 0.2 μL of Taq enzyme and 2 μL of template.

[0021] Further, the concentration of the 5'-primer is 20M. The concentration of the 3'-primer is 20M. The concentration of the dNTPs is 2.5 mM.

[0022] Further, the reaction procedure of the PCR amplification is as follows: denaturation at 94℃ for 50s, annealing at 55℃ for 30s, extension at 72℃ for 30s, and repeating for 35 cycles.

[0023] Further, the volume of the first and second amplification products required for the electrophoretic analysis is 25 μL.

[0024] Further, the electrophoretic analysis is gel electrophoresis analysis. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 The electrophoretic results in the experimental examples of the present application are shown in the figure, wherein the arrow points to the specific band. DETAILED DESCRIPTION

[0026] The present application is further described below in conjunction with examples. The PCR buffer used in the examples of the present application is purchased from ROCHE Company, with the item number of 11699121001.

[0027] I. Examples of the method for determining the source of tobacco components

[0028] Example 1

[0029] The method for determining the source of tobacco components in the present example comprises the following steps:

[0030] 1. DNA extraction of the sample 1 to be tested: (1) grinding the sample tissue into fine powder and placing into a 2 mL centrifuge tube; (2) adding 600 μL of CTAB extraction buffer at 65℃, mixing, gently shaking for 5 times every 3 min, and centrifuging at 12000 r / min for 10 min after 20 min; (3) carefully pipetting 400 μL of supernatant, adding an equal volume of phenol and chloroform, mixing, and centrifuging at 12000 r / min for 10 min at 4℃; (4) carefully pipetting the supernatant, adding an equal volume of chloroform, mixing, and centrifuging at 12000 r / min for 10 min at 4℃, repeating for 2 times until no protein layer appears; (5) taking the supernatant, precipitating at -20℃ for 1 h, and centrifuging at 12000 r / min for 10 min at 4℃; (6) discarding the supernatant, washing the precipitate with 50% ethanol for 2 times; drying at room temperature for 10 min, and storing at -20℃ for standby;

[0031] 2. Eluting the sample 1 (0.1 g) to be tested with 2 mL of NaCl solution with a concentration of 1.0 mol / L for 3 times;

[0032] 3. DNA extraction of the eluted sample 1 to be tested, with the same extraction steps as step 1;

[0033] 4. The DNA of the to-be-tested sample 1 before and after elution is respectively subjected to PCR amplification to obtain first and second amplification products; the PCR amplification reaction system is as follows: 20.8 μL of H2O, 3 μL of 10x PCR buffer, 1 μL of 5'-primer (20M), 1 μL of 3'-primer (20M), 2 μL of dNTPs (2.5 mM), 0.2 μL of Taq enzyme, and 2 μL of template; the upstream primer of PCR amplification is GCAAGAAGATCTGAAAGTGAAAGAG, and the downstream primer is CCATACTTTCAGTTTGGCCC; the total volume of the PCR amplification reaction system is 30 μL; the PCR amplification reaction procedure is as follows: denaturation at 94°C for 50 s, recombination at 55°C for 30 s, extension at 72°C for 30 s, and repeating 35 cycles;

[0034] 5. 25 μL of the first and second amplification products are respectively taken for gel electrophoresis analysis, and observation shows that the electrophoresis results of the to-be-tested sample 1 before and after elution both contain tobacco-specific bands, indicating that the tobacco component of the to-be-tested sample 1 is endogenous.

[0035] Example 2

[0036] The method for determining the source of the tobacco component in this example comprises the following steps:

[0037] 1. DNA extraction is performed on the to-be-tested sample 2: (1) the sample tissue is ground into fine powder and placed in a 2 mL centrifuge tube; (2) 700 μL of 65°C CTAB extraction buffer is added, mixed, gently shaken for 6 times every 4 min, and centrifuged at 12000 r / min for 12 min after 20 min; (3) 400 μL of supernatant is carefully taken, an equal volume of phenol and chloroform is added, mixed, and centrifuged at 12000 r / min for 12 min at 4°C; (4) the supernatant is carefully taken, an equal volume of chloroform is added, mixed, and centrifuged at 12000 r / min for 12 min at 4°C, which is repeated for 3 times until no protein layer appears; (5) the supernatant is taken, precipitated at -20°C for 2 h, and centrifuged at 12000 r / min for 12 min at 4°C; (6) the supernatant is discarded, and the precipitate is washed with 60% ethanol for 2 times; after drying at room temperature for 12 min, it is stored at -70°C for standby use.

[0038] 2. The to-be-tested sample 2 (0.1 g) is eluted with 2 mL of 1.5 mol / L NaCl solution for 4 times;

[0039] 3. DNA extraction is performed on the to-be-tested sample 2 after elution, and the extraction steps are the same as those in step 1;

[0040] 4. The PCR amplification reaction system is as follows: 20.8 μL of H2O, 3 μL of 10x PCR buffer, 1 μL of 5'-primer (20M), 1 μL of 3'-primer (20M), 2 μL of dNTPs (2.5 mM), 0.2 μL of Taq enzyme, 2 μL of template; the upstream primer of PCR amplification is GCAAGAAGATCTGAAAGTGAAAGAG, and the downstream primer is CCATACTTTCAGTTTGGCCC; the total volume of the PCR amplification reaction system is 30 μL; the PCR amplification reaction procedure is: 94°C denaturation for 50 s, 55°C recombination for 30 s, 72°C extension for 30 s, and repeating 35 cycles;

[0041] 5. 25 μL of the first amplification product and the second amplification product are taken respectively for gel electrophoresis analysis, and it is found through observation that the electrophoresis result of the tobacco-specific band of the to-be-tested sample 2 before elution has the tobacco-specific band, and the electrophoresis result of the to-be-tested sample 2 after elution does not have the tobacco-specific band, which indicates that the tobacco component of the to-be-tested sample 2 is exogenous.

[0042] Example 3

[0043] The method for determining the source of the tobacco component in the embodiment comprises the following steps:

[0044] 1. DNA extraction is performed on the to-be-tested sample 3: (1) the sample tissue is ground into fine powder and placed in a 2 mL centrifuge tube; (2) 800 μL of 65°C CTAB extraction buffer is added, and the mixture is uniformly shaken and shaken gently for 7 times every 5 min, and then centrifuged at 12000 r / min for 15 min after 20 min; (3) 400 μL of supernatant is carefully taken, and an equal volume of phenol and chloroform is added to the supernatant, and the mixture is uniformly shaken and centrifuged at 12000 r / min for 15 min at 4°C; (4) the supernatant is carefully taken, and an equal volume of chloroform is added to the supernatant, and the mixture is uniformly shaken and centrifuged at 12000 r / min for 15 min at 4°C, and the operation is repeated for 3 times until no protein layer appears; (5) the supernatant is taken, and the precipitate is precipitated at -20°C for 2 h, and then centrifuged at 12000 r / min for 15 min at 4°C; (6) the supernatant is discarded, and the precipitate is washed with 70% ethanol for 2 times; after drying at room temperature for 15 min, the precipitate is stored at -20°C for standby use.

[0045] 2. The to-be-tested sample 3 (0.1 g) is eluted with 2 mL of 2.0 mol / L NaCl solution for 5 times;

[0046] 3. DNA extraction is performed on the eluted to-be-tested sample 3, and the extraction steps are the same as those in step 1;

[0047] 4. The PCR amplification reaction system is as follows: 20.8 μL of H2O, 3 μL of 10x PCR buffer, 1 μL of 5'-primer (20M), 1 μL of 3'-primer (20M), 2 μL of dNTPs (2.5 mM), 0.2 μL of Taq enzyme, 2 μL of template; the upstream primer of PCR amplification is GCAAGAAGATCTGAAAGTGAAAGAG, and the downstream primer is CCATACTTTCAGTTTGGCCC; the total volume of the PCR amplification reaction system is 30 μL; and the PCR amplification reaction procedure is: 94 ℃ denaturation for 50 s, 55 ℃ recombination for 30 s, 72 ℃ extension for 30 s, and repeating 35 cycles.

[0048] 5. 25 μL of the first amplification product and the second amplification product are respectively taken for gel electrophoresis analysis, and it is found that the electrophoresis result of the tobacco-specific band of the to-be-tested sample 3 before elution is observed, and the electrophoresis result of the tobacco-specific band of the to-be-tested sample 3 after elution is not observed, which indicates that the tobacco component of the to-be-tested sample 3 is exogenous.

[0049] II. Experimental examples

[0050] The tobacco DNA extract and the non-tobacco matrix (tea) mixture with different mass ratios (1:1, 1:9 and 1:99) are prepared, and after natural air drying, the mixture is eluted by using a NaCl solution (the concentration is 2.0 mol / L), and then steps 3, 4 and 5 in the embodiment 1 are performed, and the electrophoresis result is as shown in Figure 1 Figure 1 , wherein M: Marker; 1: K326; 2: Honghua Dajinyuan; 3: tobacco sample extract; 4: tobacco sample extract and non-tobacco matrix mixture (mass ratio 1:1); 5: tobacco sample extract and non-tobacco matrix mixture (mass ratio 1:9); 6: tobacco sample extract and non-tobacco matrix mixture (mass ratio 1:99); 7: NaCl solution; 8: non-tobacco matrix; 9: eluted tobacco sample extract and non-tobacco matrix mixture (mass ratio 1:1); 10: eluted tobacco sample extract and non-tobacco matrix mixture (mass ratio 1:9); 11: eluted tobacco sample extract and non-tobacco matrix mixture (mass ratio 1:99).

[0051] It can be known from the electrophoresis result of Figure 1 that the tobacco-specific band of the sample after elution no longer appears, which indicates that the elution method designed in the present application is effective. <110> National Tobacco Quality Supervision and Inspection Center <120> A method for judging the source of tobacco components <160> 2 <170> PatentIn version 3.5 <211> 25 ​<212> DNA <213> SEQUENCE <221> UPSTREAM PRIMER <222> (1)..(25) <400> 1 gcaagaagat ctgaaagtga aagag 25 <211> 20 <212> DNA <213> SEQUENCE <221> DOWNSTREAM PRIMER <222> (1)..(20) <400> 2 ccatactttc agtttggccc 20

Claims

1. A method of determining the origin of a tobacco constituent, characterized by, The method comprises the following steps: (1) designing primers according to tobacco-specific SSR-1 markers; DNA of a sample to be tested is extracted, and the DNA is subjected to PCR amplification by using the primers to obtain a first amplification product, and electrophoretic analysis is performed on the first amplification product to determine whether a specific band of the tobacco species exists; if the specific band exists, it is indicated that the sample to be tested contains tobacco components; (2) eluting the sample to be tested containing tobacco components, extracting DNA of the eluted sample to be tested, and subjecting the DNA of the eluted sample to be tested to PCR amplification by using the primers to obtain a second amplification product, and electrophoretic analysis is performed on the second amplification product to determine whether a specific band of the tobacco species exists; the eluent used for the elution is a NaCl solution with a concentration of 1.0-2.0 mol / L; if the specific band exists, it is indicated that the tobacco components are endogenous; and if the specific band does not exist, it is indicated that the tobacco components are exogenous; in steps (1) and (2), an upstream primer used for the PCR amplification is shown in SEQ ID NO: 1, and a downstream primer is shown in SEQ ID NO:

2.

2. The method of determining the origin of a tobacco constituent according to claim 1, wherein, The NaCl solution is used to elute the sample to be tested for 3-5 times.

3. The method of determining the origin of a tobacco constituent according to claim 2, wherein, 2 mL of the NaCl solution is used for every 0.1 g of the sample to be tested.

4. The method of determining the origin of a tobacco component according to claim 1, wherein, A reaction system of the PCR amplification comprises 20.8 μL of H2O, 3 μL of 10×PCR buffer, 1 μL of an upstream primer, 1 μL of a downstream primer, 2 μL of dNTPs, 0.2 μL of Taq enzyme, and 2 μL of a template.

5. The method of determining the origin of a tobacco constituent according to claim 1, wherein, A reaction procedure of the PCR amplification is as follows: denaturation at 94℃ for 50 s, recombination at 55℃ for 30 s, extension at 72℃ for 30 s, and repeating for 35 cycles.

Images