Lateolabrax japonicus vasa 3apos; application of UTR (Untranslated Region) in marking primordial germ cells of sclerobone fish
By constructing the EGFP-Lmvasa 3′UTR system of sea bass vasa 3′UTR and GFP reporter gene, and microinjecting it into fertilized eggs, the problem of labeling and visualization of sea bass PGCs was solved, and efficient isolation and transplantation of germ cells were achieved, thus improving the efficiency of sea bass germ cell research and preservation.
Patent Information
- Application Number
- CN202510902170.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-01
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2045-07-01
AI Technical Summary
Existing technologies make it difficult to effectively label and visualize primordial germ cells (PGCs) of spotted bass, affecting operations such as germ cell isolation, cryopreservation, and germ cell transplantation. Furthermore, hybridization between different species leads to significant issues of species confusion and reduced genetic diversity.
Using the vasa 3′UTR of sea bass and the GFP reporter gene construct EGFP-Lmvasa 3′UTR, the vasa 3′UTR fragment of sea bass was obtained by PCR and seamlessly cloned into a plasmid. EGFP-Lmvasa 3′UTR mRNA was synthesized and microinjected into fertilized eggs to achieve the labeling and visualization of PGCs.
It enables visualization of the migration path of spotted bass PGCs from the somitotic stage to post-hatching, has cross-species universality, can label PGCs of different model fish, and supports the isolation and transplantation of germ cells.
Smart Images

Figure CN120843594A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of fish germ cell labeling technology, specifically relating to the application of vasa 3′UTR of spotted sea bass in labeling primordial germ cells (PGCs) of bony fish. Background Technology
[0002] Fish are sexually reproducing organisms. During embryonic development, fish develop two main cell lines: the germ cell line and the somatic cell line. The germ cells that precede sexual reproduction are called primordial germ cells (PGCs). PGCs are determined by the germplasm of the oocyte and specialize from cells that acquire germplasm components during early embryonic development. Germ cells transmit genetic information to offspring, enabling species development and evolution. As the progenitor cells of the germ cell line, PGCs are particularly important for the formation of the germ line. PGCs specialize in specific locations in early embryonic development, and then, under the regulation of various influencing factors, migrate through layers of cell tissue, eventually reaching the primordial genital ridge, where they are surrounded by somatic cells to form primordial gonads.
[0003] The Vasa gene, a member of the DEAD-box family, encodes an ATP-dependent RNA helicase and has been shown to play a crucial role in the origin, migration, and maintenance of germ cells in fruit flies, mice, chickens, and fish. In fish, Vasa was first reported in zebrafish, where the formation and migration of PGCs were precisely observed using in situ hybridization. Subsequently, it has been reported in medaka, rainbow trout, turbot, tuna, goldfish, goby, loach, and other species. The origin of PGCs in bony fish, based on the localization of vasa, mainly follows two patterns: one is early localization, where vasa mRNA accumulates in the cleavage furrow in the early stages of egg formation, and then distributes to several daughter cells during cleavage, as seen in zebrafish, turbot, goldfish, goby, loach, and rare gudgeon; the other is the loss of early localization, where vasa transcripts are widely distributed in every cell from cleavage to late gastrulation and then begin to be specifically expressed in some cells (during somitosis), as seen in medaka and rainbow trout. Fish reproductive stem cells can be labeled using in situ hybridization and immunohistochemistry with fixed tissues or embryos, or through in vivo labeling using biotechnology. With technological advancements, transgenic technology using vasa promoter-regulated green fluorescent protein (GFP) and the technology of fused GFP with vasa 3′UTR have been successfully applied in fish, enabling the visualization of in vivo PGCs and providing possibilities for the isolation and in vitro culture of PGCs.
[0004] The spotted sea bass (Lateolabrax maculatus) is a key marine aquaculture species promoted in my country due to its rich nutritional value and high economic worth. In the past decade, it has become one of the most important marine aquaculture fish in my country and a preferred species for deep-sea farming in modern marine ranches. However, in recent years, hybridization of different spotted sea bass species has led to species confusion, degradation of germplasm resources, reduced genetic diversity, long growth cycles, and reproductive difficulties. Therefore, the need for protecting the superior germplasm resources of spotted sea bass and seeking new breeding models has become increasingly prominent. The emergence of fish "surrogate reproduction" technology, combined with germ cell cryopreservation technology, has opened up new avenues for the preservation and efficient development and utilization of germplasm resources, while also providing a new breeding model for fish surrogate aquaculture. Therefore, the origin and migration of fish germ cells, as well as the isolation, identification, labeling, and transplantation of reproductive stem cells (PGCs), remain important topics in current fish research. Studying the origin of germ cells in the early stages of fish embryonic development and achieving in vivo visualization of PGCs can facilitate further operations such as PGC isolation, cryopreservation, and germ cell transplantation using PGCs as donors. Summary of the Invention
[0005] This invention relates to the application of the vasa 3'′UTR of the spotted perch.
[0006] Specifically, it involves:
[0007] 1. Application of vasa 3′UTR in labeling primordial germ cells (PGCs) of bony fish.
[0008] 2. A GFP reporter gene construct containing the vasa 3′UTR of the spotted bass, EGFP-Lmvasa 3′UTR.
[0009] 3. Method for constructing a GFP reporter gene construct containing the vasa 3′UTR of the spotted perch.
[0010] The method for constructing the GFP reporter gene construct containing the Lmvasa 3′UTR of the spotted bass involves seamlessly cloning and ligating the Lmvasa 3′UTR fragment obtained by PCR into pCS. 2+ -EGFP plasmid, obtain EGFP-Lmvasa 3′UTR plasmid.
[0011] In one embodiment, the seamless cloning primers used in PCR are:
[0012] vasa 3′UTRF: atgaactatacaaactcgagAAGGAATATTAGAGAAGC,
[0013] vasa 3′UTRR: atgaactatacaaataactcgagAAACCCCATTAACCAATTTTTCT.
[0014] 4. EGFP-Lmvasa 3′UTR mRNA labeling system.
[0015] The EGFP-Lmvasa 3′UTR mRNA labeling system was obtained by transforming the EGFP-Lmvasa 3′UTR plasmid into competent DH5α cells, digesting the linearized EGFP-Lmvasa 3′UTR plasmid with the restriction endonuclease BamHI, incubating at 37℃ for 2.5 h, and then synthesizing it in vitro.
[0016] The method for constructing the EGFP-Lmvasa 3′UTR mRNA marker system involves transforming the EGFP-Lmvasa 3′UTR plasmid into competent DH5α cells, digesting the linearized EGFP-Lmvasa 3′UTR plasmid with the restriction endonuclease BamHI, incubating at 37℃ for 2.5 h, and then synthesizing it in vitro to obtain the EGFP-Lmvasa 3′UTR mRNA marker system.
[0017] 5. Application of the EGFP-Lmvasa 3′UTR mRNA labeling system in tracking colonization of transplanted cells in bony fish.
[0018] The bony fish involved in this invention include sea bass, medaka, and zebrafish.
[0019] Beneficial effects
[0020] This invention first used RACE technology to obtain the full-length cDNA of the vasa marker gene for spotted bass PGCs. Then, the obtained sequence was analyzed using bioinformatics. The expression level of vasa during embryonic development and in various tissues was identified using RT-PCR technology. The spatial distribution of vasa in gonads and embryos was studied using in situ hybridization technology. At the same time, the vasa 3′UTR fusion technique was used to visualize spotted bass PGCs in vivo, verifying its specificity as a marker gene for spotted bass germ cells. This laid the foundation for the next step of PGC labeling and isolation.
[0021] This invention involves injecting EGFP-Lmvasa 3′UTR mRNA into 1-2 cell stage fertilized eggs of sea bass, zebrafish, and medaka. Results show that the sea bass vasa 3′UTR can visualize the migration pathway of sea bass PGCs from the somial stage to post-hatching, and can also tag PGCs of two model fish species: zebrafish (early localization) and medaka (loss of early specific localization). This demonstrates that the sea bass vasa 3′UTR has a certain degree of cross-species universality. Attached Figure Description
[0022] Figure 1 The nucleic acid sequence and predicted amino acid sequence of the spotted sea bass *Vasa* are provided. The full-length *Vasa* cDNA is 2384 bp, including a 152 bp 5′ UTR, a 1905 bp ORF encoding a 635-amino acid protein, and a 327 bp 3′ UTR. The *Vasa* amino acid sequence contains eight conserved motifs of the DEAD-box family (AQTGSGKT, PTRELI, TPGRL, DEAD, SAT, MVFVET, RGLD, and HRIGRTGR) associated with ATPase-dependent binding and helicase activities, and also contains eight RG and seven RGG repeat sequences at the N-terminus.
[0023] The start cipher ATG, stop cipher TAA, and tail signal AATAA are in bold; the red area represents the 8 conservative base sequences of the DEAD-box family, the yellow area represents RG repetition, and the green area represents RGG repetition.
[0024] Figure 2 Amino acid sequence alignment and phylogenetic analysis of *vasa* (a type of perch).
[0025] A. Multiple sequence alignment and homology analysis of vasa amino acids. Boxes indicate conserved sequences and functional sites, and the sequence ends with a comparison of the similarity between the vasa protein of the spotted sea bass and other representative species. B. Vasa phylogenetic analysis. Numbers represent the confidence level of each branch.
[0026] Figure 3 Prokaryotic induction of *Vasa* expression in spotted sea bass and antibody preparation
[0027] M: Marker; A, Lane 1: Total protein from uninduced vasa-His E. coli; Lane 2: Total protein from E. coli induced with 0.6 mmol / L IPTG; Lane 3: Total protein isolated from bacterial inclusion bodies; Lane 4: Total protein isolated from the supernatant; Lane 5: Inclusion body filtrate collected during purification using Ni-TED 6FF affinity chromatography; Lane 6: Wash buffer collected during purification; Lanes 7-8: Purified vasa-His protein. B, Western blot.
[0028] Figure 4 Expression of the vasa gene in various tissues of spotted sea bass during embryonic development and adult fish.
[0029] A. Results of RT-PCR during embryonic development; B. Results of RT-PCR in different tissues; C. H&E staining of testicular paraffin sections; D. Vasa antibody hybridization of testicular paraffin sections; E. H&E staining of ovarian paraffin sections; F. Vasa antibody hybridization of ovarian paraffin sections. Sg: Spermatogonia; Sc: Spermatocytes; St: Spermatocytes; Og: Oogonia; I-II: Pre-vitiligoblastic oocytes; III: Early vitelline oocytes; IV: Mid-vitiligoblastic oocytes; V: Late vitelline oocytes. Scale bar, 50 μm.
[0030] Figure 5 Distribution of vasa mRNA during embryonic development (1-cell stage to somnolence stage).
[0031] A, 1-cell stage; B, 2-cell stage; C, 4-cell stage; D, 16-cell stage; E, blastocyst stage; F, early gastrulation stage; G, late gastrulation stage; H, somnolence stage. Black arrows represent vasa signals. Scale bar, 200 μm.
[0032] Figure 6 Verification and analysis of the vasa 3′UTR positioning function of spotted bass.
[0033] AC: Control group of uninjected spotted bass embryos; AB: Somnoid stage; C: Heartbeat stage; DG: Microinjection of EGFP-Lmvasa3'UTR mRNA into spotted bass embryos; DF: Somnoid stage; G: Heartbeat stage. White triangles represent PGCs. Scale bar, 200 μm.
[0034] Figure 7 Spotted sea bass GFP-Lmvasa 3 ′ - Visualization of PGCs after UTR mRNA injection in zebrafish and medaka.
[0035] AD: Microinjection of EGFP-Lmvasa 3'UTR mRNA into zebrafish embryos; AC, somnoid stage; C, ventral view of somnoid stage B; D, day 1 post-hatching. EF: Microinjection of EGFP-Lmvasa 3'UTR mRNA into medaka embryos; EF, organogenesis stage. White triangles indicate PGCs. Scale bar, 200 μm. Detailed Implementation
[0036] To make the objectives, technical solutions, and advantages of the embodiments of this application clearer, the technical solutions of the embodiments of this application will be fully described below with reference to the accompanying drawings, so as to fully understand the objectives, effects, and application prospects of the present invention. The following embodiments are only used to illustrate the present invention and are not intended to limit the scope of application of the present invention.
[0037] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments.
[0038] 1. Materials and Methods
[0039] 1.1 Experimental Materials
[0040] The spotted sea bass used were sourced from Changfeng Aquatic Technology Co., Ltd., Zhuhai City, Shandong Province. Adult spotted sea bass were anesthetized with 0.05% eugenol before dissection. Tissue samples (liver, spleen, brain, intestine, kidney, gills, muscle, testes, and ovaries) from 2-year-old spotted sea bass (body length: 58±2cm, weight: 2kg, 1 male and 1 female) were rapidly extracted, rinsed twice with PBS, and quickly immersed in liquid nitrogen for preservation and RNA extraction. Fertilized spotted sea bass eggs were sourced from Hongxinrong Aquatic Seedling Farm, Zhangzhou City, Fujian Province. After natural fertilization, the eggs were laid and incubated in fresh seawater at 18±1℃. Embryos at different developmental stages (1-cell, 2-cell, 8-cell, 16-cell, 32-cell, 64-cell, morula stage, blastocyst stage, early gastrulation, late gastrulation, neural stage, somnolence stage, heartbeat stage, hatching stage, and 1 day post-hatching) were collected and preserved in liquid nitrogen for RNA extraction. Samples used for in situ hybridization: Gonads and fertilized eggs at different stages were fixed in in situ hybridization fixative (G1113, Saivei) at 4°C overnight. The next day, the fixative was aspirated, and 50% methanol (prepared with DEPC-treated PBS) was added for fixation at room temperature for 2 hours. Finally, the samples were placed in 100% methanol and stored at -20°C for subsequent in situ hybridization. H&E staining and immunohistochemical experiments of gonad sections were performed by Wuhan Saivei Biotechnology Co., Ltd.
[0041] The medaka (Oryzias melastigma) and AB strain zebras used in this invention were obtained from the Wuhan Institute of Hydrobiology. The rearing water temperature was 28℃, and the photoperiod was 14h light / 10h dark. Embryo collection: 12 hours prior to the event, male and female fish were separated at a ratio of 2:1 or 4:3 and shielded from light with a black cloth. The next morning, the males and females were mixed together, and fertilized eggs were collected after the females had laid their eggs. The fertilized eggs were cultured in embryo culture water containing 0.5mg / L methylene blue at 28℃.
[0042] 1.2 RNA extraction and cDNA first-strand synthesis
[0043] Total RNA was extracted from different tissues and embryonic developmental stages according to the instructions using Trizol (15596026CN, Invitrogen) reagent. After testing the concentration, purity, and integrity of the extracted total RNA, the first strand of cDNA was synthesized using 1 μg of total RNA as a template according to the reverse transcription kit instructions (KR118, Tiangen).
[0044] 1.3 Cloning of the vasa gene
[0045] The spliced sequence of vasa was obtained from the adult sea bass gonad transcriptome database based on gene annotation information, and specific primers were designed based on the spliced sequence. Using sea bass ovarian cDNA as a template, the specific primers were used to amplify the vasa open reading frame (ORF) (1905 bp). The PCR reaction system consisted of 1 μL cDNA template, 13 μL 2×Rapid Taq Master Mix, 0.1 μL each of forward and reverse primers, and 9 μL ddH2O, for a total of 25 μL. The reaction program was: 95℃, 5 min (pre-denaturation); 95℃, 15 s (denaturation), 55℃, 15 s (annealing), 72℃, 1 min (extension), 34 cycles; 72℃, 5 min (extension). The reaction products were subjected to 1.5% agarose gel electrophoresis, stained with a non-toxic nucleic acid dye (4S Green Plus), recovered on an Omega gel, ligated into the pMD18-T vector overnight, transformed into competent E. coli DH-5α cells, and positive clones were screened by colony PCR and sequenced.
[0046] Specific primers:
[0047] vasaF: ATGGACGAATGGGAAGAAGAAGGAAC,
[0048] vasaR:CTACTCCCATTCTTCATCATCAGCTG.
[0049] 1.4 RACE to obtain the full-length vasa cDNA sequence
[0050] According to the Clonetech SMARTer RACE cDNA amplification kit instructions, 3′RACE cDNA and 5′RACE cDNA were synthesized by reverse transcription using ovarian cDNA as a template. Gene-specific primers were designed based on the vasa ORF fragment for 5′RACE and 3′RACE PCR, and the full-length gene (2311 bp) was obtained by splicing (using DNAman software).
[0051] Specific primers:
[0052] 5′RACE-vasa: TTCCGATTCTCGTCACCACC,
[0053] 3′RACE-vasa: TATTGGAAGAACTGGCCGCT.
[0054] 1.5 Sequence Analysis and Phylogenetic Tree Construction
[0055] The full-length vasa cDNA sequence was obtained, and its amino acid sequence and similarity were analyzed using BLASTn and BLASTp from the NCBI database. Multiple sequence alignment of amino acids was performed using Jalview 2.11 software and Clustal Omega (https: / / www.ebi.ac.uk / jdispatcher / msa / clustalo / ). A phylogenetic tree was constructed using MEGA v5.2 software with a neighbor-joing (NJ) method. The data in the evolutionary number represent the boostrap value (confidence level) calculated randomly 1000 times for phylogenetic analysis.
[0056] Multiple sequence alignment analysis showed that *vasa* of the spotted sea bass shared high homology with *vasa* of other species: mice (71.87%), humans (74.93%), zebrafish (83.84%), rainbow trout (87.74%), medaka (89.42%), largemouth bass (96.66%), mandarin fish (96.94%), and Japanese spotted sea bass (99.72%). Figure 2 A). The numerical values in the phylogenetic tree represent the reliability of the tree. Analysis revealed that the spotted sea bass (vasa) clustered with bony fishes, indicating that this group is more closely related to other species in terms of vasa evolution. Among them, the spotted sea bass (vasa) shows a high degree of similarity to the Japanese sea bass (vasa). Figure 2 B).
[0057] 1.6 Preparation of recombinant vasa protein and antibody from spotted sea bass
[0058] The pET28a vector was linearized by double digestion with EcoRI and XhoI, and the product was recovered via gel cloning. Following the instructions of the seamless cloning kit (639649, Takara), the terminal 15 bp sequence of the linearized vector was used as a homologous sequence and added to the 5′ end of the forward / reverse amplification primer sequences of vasa ORF. PCR amplification with the following primers yielded the insert fragment of vasa ORF containing the homologous sequence of the pET28a vector. The Omega gel-recovered product was then seamlessly cloned with the linearized vector.
[0059] 28a-vasaF:tgggtcgcggatccgaattcATGGACGAATGGGAAGAAGAAG,
[0060] 28a-vasaR:tggtggtggtggtgctcgagCTCCCATTCTTCATCATCAGCT,
[0061] The lowercase letters in the primers are homologous sequences at the ends of the vector.
[0062] Seamless cloning reaction: 2 μL of 5X In-Fusion HD Enzyme Premix, 3 μL of pET28a linear vector, 1 μL of gel recovery product, and 4 μL of ddH2O, totaling 10 μL, were reacted at 50℃ for 15 min. The recombinant plasmid pET28a-vasa was transformed into *E. coli* BL21(DE3) strain. *E. coli* BL21 cells were cultured in LB medium containing 100 μg / mL ampicillin. When the OD600 of the *E. coli* BL21 cell solution reached between 0.6 and 0.8, isopropyl-β-D-thiogalactopyranoside (IPTG) was added to the LB medium at a final concentration of 0.6 mol / L, and expression was induced for 12 h at 28℃ and 220 rpm. After induction, the cells were collected by centrifugation (8000 rpm, 10 min, 4℃) and washed twice with PBS (pH 7.5). The cells were concentrated 10 times by volume and then subjected to sonication. The ultrasonic treatment was performed at 40W power for 4 seconds, followed by a 6-second interval, for a total ultrasonic time of 15 minutes. The disrupted bacterial culture was centrifuged at 10,000 rpm for 10 minutes at 4°C to separate the inclusion body precipitate from the soluble protein. The precipitate and supernatant were collected separately. The precipitate was resuspended in 100 μL of PBS buffer. 25 μL of 5×SDS-PAGE loading buffer was added to 100 μL of the precipitate and 25 μL of SDS-PAGE loading buffer, respectively. The mixture was boiled in a water bath for 10 minutes, and then loaded for SDS-PAGE. After confirming successful induction of the vasa-His recombinant protein, the vasa-His recombinant protein was purified by Ni-TED 6FF affinity chromatography according to the instructions of the HyPur TNi-TED 6FF (His-Tag) pre-packed gravity column purification kit (C600727, Sangon Biotech). The purified protein was then sent to Hangzhou Huaan Biotechnology Co., Ltd. to prepare a vasa rabbit polyclonal antibody.
[0063] The results showed that after the vasa-His plasmid was transformed into E. coli BL21(DE3), a distinct 75 kDa band was observed after IPTG induction, and the protein size was close to the theoretical value of the recombinant protein. Western blot analysis was performed on the vasa rabbit polyclonal antibody prepared by Hangzhou Huaan Biotechnology Co., Ltd. to evaluate the specificity of the spotted bass vasa antibody. The results showed that a specific target band of 75 kDa could be detected in the extracted spotted bass ovaries. Figure 3 B).
[0064] 1.7 Semi-quantitative RT-PCR study on the expression of vasa mRNA in different tissues and embryonic development stages
[0065] Using cDNA obtained from total RNA reverse-engineered from different tissues and embryonic developmental stages as PCR templates, semi-quantitative specific primers for vasa (649 bp) were designed, with β-actin (114 bp) as an internal control. The concentrations of each template were adjusted, and the PCR conditions were optimized. The PCR reaction system was the same as above. The optimized PCR program for tissues and embryos was: 95℃, 5 min (pre-denaturation); 95℃, 15 s (denaturation); 55℃, 15 s (annealing); 72℃, 30 s (extension); vasa gene (30 cycles); β-actin (25 cycles); 72℃, 5 min (extension). The reaction products were subjected to 1.5% agarose gel electrophoresis, stained with nucleic acid dyes, and photographed using a Bio-Rad gel imaging system.
[0066] Semi-quantitative specific primers:
[0067] BvasaF:CCCACTATGAGACGGGCATC,
[0068] BvasaR:CCAAAGGCAAACTTCCTGGC.
[0069] Primers for β-actin:
[0070] β-actinF: CAACTGGGATGACATGGAGAAG,
[0071] β-actinR:TTGGCTTTGGGGTTCAGG.
[0072] The expression of the vasa gene during embryonic development was investigated using semi-quantitative RT-PCR. The results showed that vasa mRNA was highly expressed in the early stages of embryonic development, and its expression gradually decreased with embryonic development, decreasing sequentially until it was undetectable in the late gastrulation stage. Figure 4 A). Vasa mRNA is specifically expressed only in the gonads of adult sea bass and is not expressed in other tissues. Figure 4 B). To further understand the specific distribution of vasa protein during gonadal development, immunohistochemical analysis of spotted sea bass gonad sections was performed using the vasa antibody prepared in this invention. The results showed that vasa protein was strongly expressed in spermatogonia in the spotted sea bass testes, gradually weakened in spermatocytes, and was not expressed in spermatids. Figure 4 D). In the ovary, vasa mRNA is expressed at all stages of oocyte formation, but is mainly concentrated in early oocytes (stages I-III), while the expression signal is weaker in oocytes of stages VI and V. Figure 4 E).
[0073] 1.8 Whole embryo in situ hybridization
[0074] Primers were designed to amplify the vasa (1017 bp) fragment from the ovarian cDNA of the spotted bass, and the fragment was recovered by agarose gel electrophoresis. The pGEM-T Easy vector (A1360, Promega) kit was used according to the manufacturer's instructions.
[0075] Primers:
[0076] WISH-vasaF: GCAGCTGACTTTCTCAAGACGGA,
[0077] WISH-vasaR:AATTTTTCTTTTTTATTGGTGATC.
[0078] The Dig RNAlabeling kit SP6 / T7 was used to synthesize vasa antisense and sense probes using T7 and SP6 RNA transcriptases, respectively. The reaction steps are as follows:
[0079] 1.8.1 Probe Linearization
[0080] 1) Reaction system
[0081]
[0082] 2) Mix thoroughly by pipetting and incubate overnight at 4°C;
[0083] 3) Transform E. coli competent cells, select positive clones and sequence them;
[0084] 4) Select single clones with the correct insertion direction and extract plasmids in a moderate amount;
[0085] 5) The linearized pGEM-vasa antisense and sense probe plasmids were digested with restriction endonucleases Nco I and Sac II, respectively. After incubation at 37°C for 2.5 h, the linearized fragments were purified using a gel extraction kit and dissolved in DEPC water as templates for probe synthesis. The fragments were stored at -20°C.
[0086] 1.8.2 Vasa probe synthesis
[0087] 1) Reaction system
[0088]
[0089]
[0090] 2) Mix well, centrifuge briefly, and incubate at 37°C for 2 hours;
[0091] 3) After the reaction is complete, add 2 μL of DNase I and incubate at 37°C for 15 min;
[0092] 4) After the reaction is complete, add 2 μL of 0.2M EDTA solution (pH 8) to terminate the reaction;
[0093] 5) Add 1 μL of TURBO DNase I, incubate at 37°C for 15 min;
[0094] 6) Add 30 μL of LiCl to a 20 μL reaction mixture, mix well, and incubate at -20°C overnight to allow precipitation.
[0095] 7) Centrifuge at 4℃ and 12000 rpm for 15 min;
[0096] 8) Discard the supernatant, add 200 μL of 75% anhydrous ethanol (prepared with DEPC water) and wash twice, centrifuge at 12000 rpm for 6 min at 4℃;
[0097] 9) Discard the supernatant, dissolve in 10 μL of DEPC water, detect mRNA quality by agarose gel electrophoresis, and store at -80℃ in aliquots.
[0098] 1.8.3 In situ hybridization
[0099] The specific operation follows the method previously described by Rachna Narayanan and Andrew C. Oates (2019), with some modifications.
[0100] 1) Gradient rehydration: After removing the dehydrated embryos from -20℃ and allowing them to return to room temperature, rehydrate them in a gradient of methanol (75%, 50%, 25%) (diluted with PBST) for 5 minutes each time. PBST contains 0.1% Tween-20.
[0101] 2) Washing: Wash 3 times with 1×PBST, 5 min each time;
[0102] 3) Shell removal: The shell membrane of all embryos is carefully removed with tweezers under a stereoscope;
[0103] 4) Decolorization: After the segmentation stage of the spotted sea bass, decolorization is required. Add the decolorization solution, which is a premixed mixture of 3% H2O2 and 2% KOH in a 1:1 ratio, to the embryo for decolorization. After observing the disappearance of pigment under a stereomicroscope, add PBST to wash and stop the reaction.
[0104] 5) Digestion: Embryo digestion was performed using proteinase K (10 μg / mL) (diluted with PBST). Digestion was performed for 30 seconds from the blastocyst to the gastrula stage, 5 minutes from the somites stage, and 15 minutes from the embryo hatching stage.
[0105] 6) Fixation: The proteinase K digestion reaction was terminated with PBST solution and the embryos were rinsed. Then, the original fixative was added and the embryos were fixed at room temperature for 20 min to inactivate the proteinase. The embryos were then washed four times with PBST, 5 min each time.
[0106] 7) Prehybridization: Remove PBST, add preheated hybridization solution (B548203, Sangon Biotech) (without probe) to the centrifuge tube, and prehybridize in a metal bath at 65°C for 3 hours;
[0107] 8) Hybridization: Add the hybridization solution containing 2 ng / μL of RNA probe, which has been preheated to 65℃ (before use, the hybridization solution needs to be incubated in a metal bath at 72℃ for 5 min to destroy the secondary structure of RNA, and then quickly placed on ice) to the pre-hybridized embryos and let them stand in a metal bath at 65℃ for 16 h.
[0108] 9) Cleaning the probe: Wash in a 65℃ metal bath, sequentially with Wash1 solution (50% formamide (A600211, Sangon Biotech) + 2xSSC (B548110, Sangon Biotech) + 0.1% Tween-20, diluted with distilled water) twice, 30 min each time; Wash2 solution (2xSSC + 0.1% Tween-20, diluted with distilled water) once, 15 min; Wash3 solution (0.2xSSC + 0.1% Tween-20, diluted with distilled water) twice, 30 min each time.
[0109] 10) Washing: Rinse 5 times at room temperature with MABT (100mM maleic acid (ST1492, Beyotime) + 150mM NaCl diluted with distilled water, adjust pH to 7.5 with NaOH, then add 0.1% Tween-20), 10 minutes each time.
[0110] 11) Blocking: Add 2% blocking solution (11096176001, Roche) (10% blocking agent diluted 1:5 in MABT), and incubate at room temperature in the dark for 3 hours;
[0111] 12) Antibody incubation: Remove the blocking solution, dilute the anti-digoxin-AP antibody (11093274910, Roche) with 2% blocking reagent at a ratio of 1:2000, and incubate overnight at 4°C;
[0112] 13) Washing: Wash with MABT at room temperature for 2 hours, 20 minutes each time, and change at least 6 times;
[0113] 14) Color development: Perform color development according to the BCIP / NBT alkaline phosphatase colorimetric kit (C510032-0005, Sangon Biotech). First, equilibrate the embryos twice in freshly prepared alkaline phosphatase staining buffer, 5 min each time. Prepare the staining solution and add it to the embryos. Stain at room temperature in the dark. Control the staining reaction with the naked eye under a stereomicroscope. Then monitor every 10-15 min until the staining is saturated or the required contrast is reached. The result is a blue-purple precipitate.
[0114] 15) Stop the staining reaction by rinsing three times in PBST for 5 minutes each time.
[0115] 16) Dehydration preservation: Add 25%, 50%, and 100% glycerol diluted with PBST in sequence. After the embryo sinks, make the embryo permeable and transfer it to a glass slide for easy photography and observation. Store at 4°C in the dark.
[0116] Whole-cell in situ hybridization results of spotted bass embryos showed that vasa mRNA could not be detected at the 1-cell stage. Figure 5 A). During the 2-cell stage, the vasa signal is distributed in the first cleavage groove ( Figure 5 B). At the 4-cell stage, four signals were found in the first and second cleavage furrows. Figure 5 C). At the 16-cell stage, eight vasa-positive signals were detected, located in the cleavage groove ( Figure 5 D). As the embryo develops to the blastocyst stage, vasa mRNA has migrated into the cell interior and is distributed in four clusters at the edge of the embryonic body. Figure 5 E). In the early gastrulation stage, vasa-positive cells (PGCs) are mainly found at the edge of the blastodisc, with some weak signals also present at the top of the blastodisc. Figure 5 F). During the late gastrulation stage, PGCs move dorsally towards the embryo with converging movements; the white box represents a magnified area in Figure G. Figure 5 G). During somnogenesis, PGCs move outward along the body axis and are distributed on both sides of the trunk. Figure 5 H).
[0117] Construction of 1.9EGFP-Lmvasa 3′UTR mRNA synthesis plasmid
[0118] Seamless cloning primers were designed to amplify the 3′UTR (327bp) fragment of *vasa* var. ...
[0119] Seamless cloning primers:
[0120] vasa 3′UTRF: atgaactatacaaactcgagAAGGAATATTAGAGAAGC,
[0121] vasa 3′UTRR: atgaactatacaaataactcgagAAACCCCATTAACCAATTTTTCT.
[0122] pCS double digested with Xho I and Xba I 2+ -EGFP plasmid, the Lmvasa 3′UTR fragment obtained by PCR was ligated into pCS using a seamless cloning kit. 2+The EGFP plasmid was named EGFP-Lmvasa 3′UTR. The EGFP-Lmvasa 3′UTR plasmid was transformed into competent DH5α cells, and positive clones were selected and sequenced. A medium-volume amount of plasmid was extracted, and the EGFP-Lmvasa 3′UTR plasmid was linearized by single digestion with the restriction endonuclease BamHI. After incubation at 37℃ for 2.5 h, purification was performed using an Omega gel extraction kit. The linearization results were detected by gel electrophoresis, and the concentration of the linearized plasmid was determined. Finally, mMESSAGE was used. The SP6 Transcription Kit is used to synthesize EGFP-Lmvasa 3′'UTR in vitro. The specific steps are as follows:
[0123] 1) In vitro transcription reaction system:
[0124]
[0125] 2) Mix well: Gently tap, centrifuge; incubate at 37℃ for 3.5h;
[0126] 3) Add 1 μL of TURBO DNase I, incubate at 37°C for 15 min;
[0127] 4) Add 30 μL of LiCl to a 20 μL reaction system, mix well, and incubate at -20°C overnight to precipitate;
[0128] 5) Centrifuge at 4℃ and 12000 rpm for 15 min;
[0129] 6) Discard the supernatant, add 200 μL of 75% anhydrous ethanol (prepared with DEPC water) and wash twice, centrifuge at 12000 rpm for 6 min at 4℃;
[0130] 7) Discard the supernatant, dissolve in 10 μL of DEPC water, detect mRNA quality by agarose gel electrophoresis, and store at -80℃ in aliquots.
[0131] 1.10 Microinjection and fluorescence observation
[0132] EGFP-Lmvasa 3′UTR mRNA was diluted to 300 ng / μL with RNase-free water, and 0.02% phenol red was added. This diluted mRNA was then injected into 1-2 cell stage fertilized eggs of sea bass, zebrafish, and medaka to investigate the labeling ability of sea bass vasa 3′UTR on PGCs in these fish. The microinjected sea bass, zebrafish, and medaka embryos were returned to their culture tanks for further rearing. Uninjected fertilized eggs served as a control group and were cultured under the same conditions. The expression of green fluorescent protein at different developmental stages of the embryos was observed and photographed using a Leica DMi8 fluorescence inverted microscope.
[0133] EGFP-Lmvasa 3′UTR mRNA was injected into 1-2 cell stage fertilized eggs of spotted bass, zebrafish, and medaka. After microinjection: In spotted bass, green fluorescent signals were observed clustering on both sides of the embryonic body during the somial stage, but PGCs could not be distinguished from somatic cells. Figure 6 DG). During the heartbeat phase, PGCs migrate axially and aggregate below the trunk; these large, round fluorescent cells are PGCs. No fluorescent signal was observed in the uninjected control group. Figure 6 AC). In zebrafish, during the somnogenesis stage, fluorescent signals accumulate on both sides of the embryonic body (AC). Figure 7 AB), as embryogenesis progresses, the fluorescent signal shifts towards the dorsal side of the embryo. Figure 7 C), ultimately, PGCs settle on the dorsal side of the intestine and the ventral side of the mesonephrium one day after hatching. Figure 7 D). In medaka, during organogenesis, green fluorescent protein can also be found to be localized in PGCs (…). Figure 7 The above results indicate that the vasa 3′UTR of the spotted bass can also tag PGCs of two model fish species, zebrafish (early localization) and medaka (loss of early specific localization), demonstrating a certain degree of cross-species universality.
[0134] The above-described embodiments are merely one implementation of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.
Claims
1. Application of vasa 3'UTR in labeling primordial germ cells of bony fish.
2. The application according to claim 1, characterized in that, The bony fish mentioned are sea bass, medaka, or zebrafish.
3. A GFP reporter gene construct containing the vasa 3'UTR of the spotted sea bass, EGFP-Lmvasa 3'UTR.
4. A method for constructing a GFP reporter gene construct containing the 3'UTR of *Vasa scabra*, characterized in that, The Lmvasa 3'UTR fragment obtained by PCR was seamlessly cloned and ligated into pCS. 2+ -EGFP plasmid, obtain EGFP-Lmvasa 3'UTR plasmid.
5. The method for constructing a GFP reporter gene construct containing the 3'UTR of *vasa* according to claim 4, characterized in that, The seamless cloning primers used in the PCR were: vasa 3'UTRF:atgaactatacaaactcgagAAGGAATATTAGAGAAGC, vasa 3'UTRR:atgaactatacaaataactcgagAAACCCCATTAACCAATTTTTCT.
6. The EGFP-Lmvasa 3'UTR mRNA labeling system, characterized by, The EGFP-Lmvasa 3'UTR plasmid was transformed into competent DH5α cells. The linearized EGFP-Lmvasa 3'UTR plasmid was digested with the restriction endonuclease BamHI and incubated at 37°C for 2.5 h before being synthesized in vitro.
7. A method for constructing the EGFP-Lmvasa 3'UTR mRNA marker system, characterized by: The EGFP-Lmvasa 3'UTR plasmid was transformed into competent DH5α cells. The linearized EGFP-Lmvasa 3'UTR plasmid was digested with the restriction endonuclease BamHI and incubated at 37℃ for 2.5 h. The EGFP-Lmvasa 3'UTR mRNA labeling system was then synthesized in vitro.
8. Application of the EGFP-Lmvasa 3'UTR mRNA labeling system in tracking colonization of transplanted cells in bony fish.
9. The application according to claim 8, characterized in that, The bony fish mentioned include sea bass, medaka, and zebrafish.
Citation Information
Patent Citations
Method for remarkably improving fish genome editing efficiency
CN104195177A
3'UTR (untranslated region) sequence of specific expression gene in fish germ-line cell and application of 3'UTR sequence
CN106399314A
GFP-Addnd 3'UTR recombinant expression vector and constructing method and application thereof
CN106591362A
Marking method of primordial germ cells of sepiella maindroni
CN110117618A
Method for differentiation and induction to germ line by transplantation of separated primordial germ cell
JP2003235558A