Primer group of SSR (simple sequence repeat) molecular marker for identifying variety of herba epimedii, kit and application

Abstract

The invention relates to the technical field of biology, in particular to an SSR molecular marker primer group for identifying the variety of herba epimedii, a kit and application. The core primers of the SSR molecular marker disclosed by the invention comprise 823, 840, 841, 842, 854 and 866, and the primers can be used for identifying the herba epimedii arrow leaf No.1, the herba epimedii arrow leaf No.2 and the herba epimedii soft hair No.1. The SSR molecule can be used for researching the genetic diversity, genetic relationship and genetic distance of epimedium, and respectively establishing molecular identity cards of three new epimedium varieties, namely epimedium arrow leaf No.1, epimedium arrow leaf No.2 and epimedium soft hair No.1, so that a foundation is laid for genetic map construction, excellent character marking and the like; meanwhile, a scientific basis is provided for constructing a molecular breeding system of a new variety (line) of herba epimedii in the later period.

Description

Technical Field

[0001] This application relates to the field of biotechnology, specifically to primer sets, kits, and applications of SSR molecular markers for the identification of Epimedium varieties. Background Technology

[0002] Epimedium (Epimedii Folium), also known as Fairy Spirit, belongs to the genus Epimedium in the family Berberidaceae.

[0003] Epimedium is a perennial herb. It has a pungent and sweet taste, is warm in nature, and enters the liver and kidney meridians. It has the effects of tonifying the liver and kidneys, strengthening tendons and bones, and dispelling wind and dampness. Modern research shows that icariin in epimedium has anti-inflammatory and osteoporosis-preventing effects. Yang Ye's team and others found that icariin and icariin can inhibit the inflammatory response in the rat brain, exhibiting anti-inflammatory effects and playing a positive role in the treatment of Parkinson's disease. Furthermore, Su Xiaoqian et al. believe that the anti-inflammatory effect of epimedium can theoretically be used to treat depression. Clinically, epimedium has been used to treat symptoms such as low mood and decreased willpower. Other scholars have found that the effective components of epimedium have anti-cancer and anti-aging effects. For example, Hu Na's team, with a blank control group, treated human liver cancer cells with equal amounts of different concentrations of icariin. The concentration of icariin showed an opposite trend to the survival rate of human liver cancer cells, effectively proving that icariin has an inhibitory effect on the proliferation of human liver cancer cells.

[0004] Currently, there are more than 60 species of Epimedium in the world, most of which grow in China. The 2001 edition of the Flora of China records about 50 species of Epimedium, among which Epimedium brevicornu Maxim., Epimedium pubescens Maxim., Epimedium koreanum Nakai., and Epimedium sagittatum (Sieb. et Zucc.) Maxim. are the main original species of Epimedium medicinal materials included in the Pharmacopoeia of the People's Republic of China.

[0005] Epimedium is a traditional Chinese medicine native to Guizhou Province. As a key ingredient in the popular Guizhou traditional Chinese medicine products "Xianling Gubao Capsules" and "Gusongbao Capsules," it is currently one of Guizhou's five billion-yuan-level medicinal herb cultivation varieties. Three varieties, "Guitong Jianye No. 1 (hereinafter referred to as Jianye No. 1), Jianye No. 2, and Roumao No. 1," are cultivated varieties developed by Sinopharm Tongjitang (Guizhou) Pharmaceutical Co., Ltd., and have been widely promoted in Guizhou, Sichuan, and other regions. Due to its complex evolutionary relationships, the interspecific relationships of Epimedium are quite complicated, making classification and identification a persistent challenge. During the promotion and cultivation process, it was found that the three varieties still exhibit certain morphological variations. The practice of blindly expanding cultivation areas and introducing varieties from multiple channels has led to further mixing in cultivation and instability in the quality of the medicinal material. Therefore, establishing a specific molecular identification system is of great significance for distinguishing Epimedium varieties, providing accurate data for protecting the intellectual property rights of existing varieties, and promoting the improvement of Epimedium varieties and the breeding of superior new varieties. Summary of the Invention

[0006] To address the aforementioned technical problems in the existing technology, this application provides a primer set, kit, and application of SSR molecular markers for the identification of Epimedium varieties, specifically achieved through the following technical solution:

[0007] A primer set for SSR molecular markers used for the identification of Epimedium varieties, wherein the primer set for SSR molecular markers includes any one or more of the following SSR molecular marker primers:

[0008] (1) Sequence of SSR molecular marker primer 823: TCTCTCTCTCTCTCTCTC;

[0009] (2) Sequence of SSR molecular marker primer 840: GAGAGAGAGAGAGAGAGACTT;

[0010] (3) Sequence of SSR molecular marker primer 841: GAGAGAGAGAGAGAGAGACTC;

[0011] (4) Sequence of SSR molecular marker primer 842: GAGAGAGAGAGAGAGAGACTG;

[0012] (5) Sequence of SSR molecular marker primer 854: TCTCTCTCTCTCTCTCTCAGG;

[0013] (6) Sequence of SSR molecular marker primer 866: CTCCTCCTCCTCCTCCTC.

[0014] The application of the primer set in the identification of Epimedium varieties.

[0015] Furthermore, the Epimedium varieties include Epimedium Arrow Leaf No. 1, Epimedium Arrow Leaf No. 2, and Epimedium Soft Hair No. 1.

[0016] A method for identifying Epimedium varieties, using the aforementioned primer set for differentiation, comprises the following steps:

[0017] (1) Epimedium DNA was extracted using the CTAB method;

[0018] (2) Using the DNA obtained above as a template, add the primer set of the SSR molecular marker described in claim 1 to perform PCR amplification to obtain PCR product;

[0019] (3) The obtained PCR products were detected by electrophoresis on an agarose gel to obtain detection bands; identification was performed based on whether clear bands could be obtained and the size of the detection bands.

[0020] Furthermore, step (3) involves identification based on whether clear bands can be obtained and the size of the detection bands, as detailed below:

[0021] If the primer set is primer 866, an SSR molecular marker, and a stable, clear, non-tailed, and highly polymorphic band is obtained during amplification, then the sample is Epimedium Breast No. 1; and there are specific bands at 500bp, 750bp, and 2000bp positions.

[0022] If the primer set is primer 840 of SSR molecular marker, and there is a detection band of 2000 bp, it proves that the sample is Epimedium Arrow Leaf No. 1; if there is a detection band of 1000 bp, it proves that the sample is Epimedium Soft Hair No. 1; if there is a detection band of 250 bp, it proves that the sample is Epimedium Arrow Leaf No. 2.

[0023] If the primer set is SSR molecular marker primer 842, and there is a detection band with a size of 100 sites, then the sample is Epimedium hygroscopicum No. 1.

[0024] If the primer set is primer 854, an SSR molecular marker, and there is a detection band with a size of 500 sites, then the sample is Epimedium Arrow Leaf No. 1; if there is a detection band with a size of 1000 sites, then the sample is Epimedium Arrow Leaf No. 2.

[0025] If the primer set is SSR molecular marker primer 823, and there is a detection band with a size of 250 or 500 sites, then the sample is Epimedium Arrow Leaf No. 2.

[0026] If the primer set is SSR molecular marker primer 841, and there is a detection band with a size of 500 sites, then the sample is Epimedium Arrow Leaf No. 1.

[0027] If the primer set contains primer 823 with an SSR molecular marker, and there is a detection band of size 200, then the sample is Epimedium Arrow Leaf No. 1.

[0028] A kit for identifying Epimedium species, the kit containing the aforementioned primer set.

[0029] The primer set and kit described herein are used in the analysis of genetic diversity of Epimedium varietal resources, the construction of Epimedium varietal DNA fingerprint database, and the molecular breeding system for new Epimedium varietal varieties.

[0030] The primer set described above is used in constructing molecular DNA identification for Epimedium species. The specific method and steps are as follows:

[0031] (1) DNA templates of Epimedium Arrow Leaf No. 1, Arrow Leaf No. 2, and Soft Hair No. 1 were extracted using the CTAB method;

[0032] (2) PCR amplification was performed using the primer set of the SSR molecular marker described in claim 1. DNA samples of Arrow Leaf No. 1, Arrow Leaf No. 2 and Soft Hair No. 1 were used for PCR screening. The primers with clear target bands were screened out by electrophoresis on agarose gel with 1% TAE at 120V for 40 min.

[0033] (3) The bands were read manually. Clear and reproducible bands were included in the statistics, while those that were not were excluded. A 0-1 matrix table was established. Popgene32 was used to analyze the observed alleles (Na), effective alleles (Ne), Shannon's information index (I), Nei's genetic diversity (h), and Nei's genetic similarity coefficient and genetic distance for each variety and each Epimedium plant of the three new Epimedium varieties. Cluster analysis was performed using NTsys to create a UPGMA clustering tree and to determine the correlation between the genetic distance matrix and the geographical distance matrix. For the same locus, a band was marked as "1" and no band was marked as "0". The electrophoresis pattern was converted into a fingerprint pattern. A barcode generator was used to create the molecular ID card of the above three Epimedium varieties according to the CODE128 code.

[0034] Furthermore, the PCR amplification system consisted of: 20 μL, 1 μL template DNA, 2 μL primers, 8.4 μL 2×taqsupermix, and 8.6 μL dd H2O; the amplification program was: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 1 min, 53℃ annealing for 1 min, 72℃ extension for 1 min, 35 cycles, 72℃ extension for 10 min, and cooling to 4℃.

[0035] Compared with the prior art, the technical effects created by this application are reflected in:

[0036] (1) The core primers 823, 840, 841, 842, 854 and 866 of the SSR molecular markers screened by this invention can identify Epimedium Arrow Leaf No. 1, Arrow Leaf No. 2 and Soft Hair No. 1. The amplification experiments showed the following results: 1) Primer 866 did not produce clear bands in the amplification of Arrow Leaf 1 and Arrow Leaf 2, but produced stable, clear, non-tailed, and highly polymorphic bands in the amplification of Soft Hair 1. This indicates that primer 866 can accurately and quickly identify Soft Hair 1 and can be used as the core primer for identifying Soft Hair 1. It has specific bands at 500bp, 750bp, and 2000bp, which can be used as a reference for identification. 2) The amplification results of primer 840 showed that, compared with the three varieties, only Arrow Leaf 1 had a band at the 2000bp site, only Soft Hair 1 had a band at the 1000bp site, and only Arrow Leaf 2 had a band at the 250bp site. 3) Primer 842 can also directly identify the three varieties. Compared with primer 840, it requires reference to two sites to distinguish between Arrow Leaf 1 and Arrow Leaf 2. Only Soft Hair 1 has a band at the 100bp site.

[0037] (2) This invention utilizes SSR molecular marker technology to study the genetic diversity, kinship, and genetic distance of Epimedium, and establishes molecular identification cards for three new Epimedium varieties: Arrow Leaf No. 1, Arrow Leaf No. 2, and Soft Hair No. 1, laying the foundation for genetic map construction and markers of superior traits. At the same time, the established specific molecular identification cards provide accurate data for distinguishing Epimedium varieties, protecting the intellectual property rights of existing varieties, and are of great significance for promoting the improvement of Epimedium varieties and the breeding of superior new varieties.

[0038] (3) The core primers 823, 840, 841, 842, 854 and 866 selected by this invention can be applied to related fields such as Epimedium variety identification and genetic resource analysis. Attached Figure Description

[0039] Figure 1 : Picture of Epimedium plant (where ①: represents Arrow Leaf No. 1 (Luoyang Village, Ceheng County); ②: represents Arrow Leaf No. 2 (Hejiaba Village, Jiangkou County); ③: represents Soft Hair No. 1 (Pingrui Village, Congjiang County)).

[0040] Figure 2 Amplification patterns (A: Amplification pattern of primer 854 in 10 samples of Arrow Leaf No. 1; B: Amplification pattern of primer 857 in 10 samples of Arrow Leaf No. 2; C: Amplification pattern of primer 842 in 10 samples of Soft Hair No. 1).

[0041] Figure 3 UPGMA clustering results of three Epimedium varieties based on ISSR molecular markers.

[0042] Figure 4 Correlation analysis of geographical location and genetic distance of three varieties of Epimedium.

[0043] Figure 5 : ISSR-marked fingerprints of three Epimedium quality resources (1: Arrow Leaf No. 1; 2: Arrow Leaf No. 2; 3: Soft Hair No. 1).

[0044] Figure 6 Arrow Leaf No. 1 Barcode ID Card

[0045] Figure 7 Arrow Leaf No. 2 Barcode ID Card

[0046] Figure 8 : Soft Hair No. 1 Barcode ID Card. Detailed Implementation

[0047] The technical solution of this application will be further defined below with reference to specific embodiments, but the scope of protection is not limited to the descriptions provided. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available.

[0048] Example:

[0049] 1. Experimental Materials, Reagents and Instruments

[0050] 1.1 Experimental Materials

[0051] The test materials (Arrow Leaf No. 1, Arrow Leaf No. 2, and Soft Hair No. 1) were sourced from Ceheng County, Qianxinan Prefecture, Guizhou Province; Congjiang County, Qiandongnan Prefecture, Guizhou Province; and Jiangkou County, Tongren City, Guizhou Province. Two to three healthy, disease-free, pest-free, and soil-free fresh leaves were selected from each plant. Ten samples were randomly selected from each of the three varieties. After collection, the samples were immediately placed in silica gel-containing containers for rapid drying, numbered according to variety name, and stored in a cool, dry place after being brought back to the laboratory. Specific collection information is shown in Table 1.1, and plant images are available in […]. Figure 1 .

[0052] The primers used were synthesized by Shanghai Sangon Biotech Co., Ltd. Details of the primers that can amplify clear bands are shown in Table 1.2.

[0053] The collected information is shown in Table 1.1.

[0054]

[0055]

[0056] Table 1.2 Primer Information Table

[0057]

[0058]

[0059] 1.2 Experimental Reagents

[0060] Main reagents: liquid nitrogen, isopropanol, isoamyl alcohol, chloroform, cetyltrimethylammonium bromide (CTAB), disodium ethylenediaminetetraacetate (EDTA-Na2), 70% cold alcohol, anhydrous ethanol, β-mercaptoethanol, NaCl, NaOH, HCl, tris(hydroxymethyl)aminomethane (Tris), dd H2O, 2×taq supermix, nucleic acid dye (Beijing Bomed Gene Technology Co., Ltd.), agarose.

[0061] 1.3 Experimental Apparatus

[0062] The instruments used in the experiment were provided by the Institute of Planting, Breeding and Processing of Chinese Medicinal Herbs of Guizhou University of Traditional Chinese Medicine. Detailed information on the main instruments is shown in Table 1.3.

[0063] Table 1.3 Instrument Information Table

[0064]

[0065] 2. Experimental Methods

[0066] 2.1 Reagent Preparation

[0067] The preparation methods for the reagents required for DNA extraction from the leaves of Arrow Leaf No. 1, Arrow Leaf No. 2, and Soft Hair No. 1 are detailed in Table 2.

[0068] Table 2. Detailed information on reagent preparation

[0069]

[0070] 2.2 Extraction of Epimedium DNA using the CTAB method

[0071] (1) Take the leaves that have been dried and stored in silica gel and immerse them in a foam box containing liquid nitrogen until the leaves become brittle. Take out the leaves and grind them in a mortar containing liquid nitrogen. When the liquid nitrogen has almost completely evaporated, grind them into powder quickly and put the leaf powder into a 2ml centrifuge tube and cover it to prevent moisture absorption. Place the centrifuge tube containing the leaf powder in a refrigerator at -4℃ for storage. Repeat the above steps for subsequent leaves.

[0072] (2) Add 900 μl of CTAB buffer preheated to 65℃ to the centrifuge tube, and then incubate in a water bath at 65℃ for 40 min, inverting the centrifuge tube several times during the process. After the water bath, cool to room temperature, add an equal volume of 24:1 chloroform / isoamyl alcohol mixture, and centrifuge for 10 min by gently shaking and inverting the tube repeatedly. Set the centrifuge speed to 12000 r / min and the temperature to 4℃, and centrifuge for 10 min under these conditions.

[0073] (3) Take the supernatant, transfer it to a new centrifuge tube, add 900 μl of 24:1 chloroform / isoamyl alcohol mixture, and centrifuge at 12000 r / min for 10 min.

[0074] (4) Transfer the supernatant to a new centrifuge tube, add 540 μl of isopropanol, mix slowly, and place in a 4°C refrigerator for 3 h to precipitate. After precipitation, centrifuge at 12000 r / min and 4°C for 10 min to allow the precipitate to gather at the bottom; slowly pour out the liquid, add 70% ethanol to the centrifuge tube and wash twice, and finally wash once with anhydrous ethanol. After discarding all the liquid, wait for the anhydrous ethanol to evaporate and store the white precipitate in TE buffer for later use.

[0075] 2.3 Agarose gel electrophoresis to determine DNA purity

[0076] Prepare a 1% agarose gel using 1×TAE solution as the electrophoresis buffer and agarose solvent, ensuring the addition of nucleic acid dyes. After solidification, carefully remove the comb. Spot 3 μl of StarMaker D2000 gel into the first well as a sample control. For each DNA sample, aspirate 3 μl and mix thoroughly with 3 μl of 2×tap super mix. Finally, spot another 3 μl of the mixture into the well. Set the voltage to 120V and the time to 20 min. Place the gel in the electrophoresis pool with the well side facing the negative electrode, allowing the sample to migrate from the negative to the positive electrode. After electrophoresis, remove the gel and photograph it using a gel imaging system to assess DNA quality.

[0077] 2.4 PCR amplification

[0078] Reaction system: Total volume 20 μl, 1 μl template DNA, 2 μl primers, 8.4 μl 2×tap supermix, 8.6 μl lddH2O.

[0079] Amplification program: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 1 min, 53℃ annealing for 1 min, 72℃ extension for 1 min, 35 cycles, 72℃ extension for 10 min, 4℃ cooling.

[0080] 2.5 Screening of ISSR primers

[0081] The ISSR primer sequences synthesized by Shanghai Sangon Biotech Co., Ltd. were initially screened by PCR using DNA samples from two different species, namely Arrow Leaf No. 1, Arrow Leaf No. 2, and Soft Hair No. 1. The primers with clear target bands were selected by electrophoresis on agarose gel with 1% TAE at 120V for 40 minutes.

[0082] 2.6 Data Analysis

[0083] Data analysis was performed manually, with clear and reproducible bands included in the statistics, while those with poor reproducibility were excluded. At the same locus, a band was recorded as "1" and no band as "0". Electrophoresis patterns were converted into fingerprints, and a barcode generator was used to create molecular identification codes for three new Epimedium varieties using CODE128. A 0-1 matrix was constructed and converted to TXT format. Popgene32 was used to analyze the observed alleles (Na), effective allele count (Ne), Shannon's information index (I), Nei's genetic diversity (h), and Nei's genetic similarity coefficient and genetic distance for each variety and each Epimedium plant. NTsys was used for cluster analysis, constructing UPGMA cluster trees and determining the correlation between the genetic distance matrix and the geographical distance matrix.

[0084] 3. Results and Analysis

[0085] 3.1 ISSR banding and polymorphism analysis

[0086] 3.1.1 ISSR banding and polymorphism analysis of Arrow Leaf No. 1

[0087] A total of 186 bands were amplified by 19 ISSR primer pairs, of which 138 were polymorphic, with an average polymorphic site percentage of 74.19%. Each primer amplified 4–14 polymorphic bands, averaging 9 polymorphic bands per primer. 23 primers amplified bands ranging from 100 to 2000 bp. The difference in the number of bands and fragment sizes amplified by different primers on the same plant material indicates that different primers have different binding sites with the template DNA. The 74.19% polymorphic site percentage of the 19 ISSR primers reflects the polymorphic differences among different populations. The amplification statistics of the Arrowleaf No. 1 primer are shown in Table 3.1, and examples of amplification patterns of the primers in 10 Arrowleaf No. 1 samples are shown in [reference needed]. Figure 2 -A.

[0088] Table 3.1 Statistical table of amplification sites using primer No. 1 (arrow leaf)

[0089]

[0090] 3.1.2 ISSR banding and polymorphism analysis of Arrow Leaf 2

[0091] A total of 154 bands were amplified by 14 ISSR primer pairs, of which 129 were polymorphic, representing 83.77% of the total. Each primer amplified 9–14 polymorphic bands, with an average of 11 polymorphic bands per primer. The bands amplified by 23 primers were all between 100 and 2000 bp. The amplification statistics of the Arrow Leaf 2 primer sites are shown in Table 3.2, and examples of the amplification patterns of the primers in 10 Arrow Leaf 2 samples are shown below. Figure 2-B.

[0092] Table 3.2 Statistical table of amplification sites using primer No. 2 (arrow leaf)

[0093]

[0094]

[0095] 3.1.3 ISSR banding and polymorphism analysis of Soft Hair No. 1

[0096] Eight ISSR primer pairs amplified a total of 74 bands, of which 62 were polymorphic, representing 83.78% of the total. Each primer amplified 4–14 polymorphic bands, with an average of 9 polymorphic bands per primer. 23 primers amplified bands between 100 and 2000 bp. The amplification statistics for the 'Rou Mao 1' primers are shown in Table 3.3, and examples of the amplification patterns of the primers in 10 'Rou Mao 1' samples are shown below. Figure 2 -C.

[0097] Table 3.3 Statistical table of amplification sites using primer 1 (pubescent type).

[0098]

[0099] 3.2 Genetic diversity analysis of ISSR loci

[0100] The genetic diversity of the three Epimedium varieties was analyzed using popgene32 and is shown in Table 3.4.

[0101] The polymorphic locus of Epimedium brevicornu 1 was 121, with a polymorphism rate of 72.02%; the polymorphic locus of Epimedium brevicornu 2 was 129, with a polymorphism rate of 83.77%; and the polymorphic locus of Epimedium brevicornu 1 was 62, with a polymorphism rate of 83.78%. All three loci were between 100 and 2000 bp. The average number of observed alleles (Na) for Epimedium brevicornu 1, Epimedium brevicornu 2, and Epimedium brevicornu 1 were 1.7202, 1.8377, and 1.8378, respectively; the average number of effective alleles (Ne) were 1.4404, 1.4616, and 1.5760, respectively. Compared to the other two varieties, Epimedium brevicornu 1 showed greater genetic variation. The Nei's genetic diversity (h) of the three varieties ranged from 0.0000 to 0.5000. The average Nei's genetic diversity (h) of Arrowleaf 1 was 0.2595, while that of Arrowleaf 2 and Soft Hair 1 were 0.2794 and 0.3238, respectively. The Shannon's information index (I) of Arrowleaf 1, Arrowleaf 2, and Soft Hair 1 ranged from 0.0000 to 0.6931, with averages of 0.3884, 0.4252, and 0.4763, respectively. The size of polymorphic sites and polymorphic percentages reflected genetic richness. Comparatively, Soft Hair Epimedium 1 showed greater genetic diversity, while Arrowleaf Epimedium 2 showed slightly higher genetic diversity than Arrowleaf Epimedium 1.

[0102] Table 3.4 Genetic diversity levels of three Epimedium brevicornu populations

[0103]

[0104] 3.3 Analysis of Genetic Similarity and Clustering Results

[0105] UPGMA clustering diagrams of three Epimedium species were constructed using NTsys, and the results are as follows: Figure 3 The similarity coefficients and genetic distances of the three Epimedium species were then calculated using popgene32, and the results are shown in Tables 3.5, 3.6, and 3.7. When the genetic similarity coefficient was 0.35, the samples were divided into two main categories; when the genetic similarity coefficient was 0.542, the 30 samples were divided into three main categories. The classification results showed significant varietal characteristics: Category I was the Arrowleaf No. 1 variety, Category II was the Arrowleaf No. 2 variety, and Category III was the Soft Hair No. 1 variety.

[0106] As shown in Table 3.5, the genetic distance of Arrow Leaf 1 is between 0.2488 and 0.4796, and the Nei's genetic similarity coefficient is between 0.6190 and 0.7798. Among them, the genetic distance between the J1-10 population of Pingrui Village and the J1-4 population of Chaoli Village in Congjiang County was the largest, with a value of 0.4796, while the genetic similarity was the smallest, at 0.6190, indicating that the higher the genetic differentiation between the two populations, the more distant their kinship. Next were the J1-4 population of Chaoli Village and the J1-2 population of Luoxiang Village in Congjiang County, and the J1-10 population of Pingrui Village and the J1-5 population of Chaoli Village in Congjiang County, with a genetic distance of 0.4605. The lowest genetic distance was between the J1-6 population of Pingrui Village and the J1-5 population of Chaoli Village in Congjiang County, with a genetic distance of 0.2488 and a genetic similarity of 0.7798, indicating that the genetic differentiation between the J1-6 and J1-5 populations was the lowest. Figure 3 It can be seen that J1-6 of Pingrui Village and J1-5 of Chaoli Village in Congjiang County are grouped together and have the closest kinship, while J1-10 of Pingrui Village in Congjiang County is a separate branch in the first category, indicating that it has the most distant kinship with the other population groups.

[0107] Table 3.6 shows that the genetic distance of Arrow Leaf 2 ranges from 0.2248 to 0.5710; the Nei's genetic similarity coefficient ranges from 0.5649 to 0.7987. Among them, the genetic distance between J2-10 and J2-1 in Hejiaba Village, Jiangkou County, is 0.5710, the largest genetic distance of this variety in the experiment, with a genetic similarity of 0.5649, indicating the highest genetic differentiation and the most distant kinship between the two populations. Next is J2-9 and J2-5 in Hejiaba Village, Jiangkou County, with a genetic distance of 0.5261 and a genetic similarity of 0.5909. The lowest genetic distances are between J2-5 and J2-4, and J2-6 and J2-5, with a genetic distance of 0.2248 and a genetic similarity of 0.7987, indicating the lowest genetic differentiation between J2-5 and J2-4, and J2-6 and J2-5. Figure 3 It can be seen that in category II, J2-9 has the largest genetic distance and is more distantly related to other populations; further subdivision shows that J2-10 is a separate branch, indicating that J2-10 is more distantly related to the other populations; next, J2-3, J2-4, J2-5, J2-6, J2-7, and J2-8 cluster into a larger branch, while J2-1 and J2-2 are a separate branch, indicating that they are most closely related.

[0108] Table 3.7 shows that the genetic distance of Soft Hair No. 1 is between 0.2610 and 0.6405, and Nei's genetic similarity coefficient is between 0.5270 and 0.7703. The genetic distance between R1-7 of Pingrui Village and R1-1 of Luoxiang Village, Congjiang County, is the largest (0.6405), while the genetic similarity is the smallest (0.5270). This is followed by R1-5 and R1-4 of Pingrui Village, and R1-9 and R1-7 of Chaoli Village, with a genetic distance of 0.5905 and a genetic similarity of 0.5541. The genetic distance between R1-5 and R1-2 of Pingrui Village and Luoxiang Village, Congjiang County, is the smallest (0.2610), while the genetic similarity is the highest (0.7703). This is followed by R1-3 and R1-2 of Luoxiang Village, and R1-7 and R1-2 of Pingrui Village, Congjiang County, with genetic distances of 0.2967 and genetic similarities of 0.7432. Figure 3 It can be seen that in Category III, R1-4 from Luoxiang Village, Congjiang County, has the largest genetic distance and is the most distantly related to the others, followed by R1-1 from Luoxiang Village, Congjiang County.

[0109] Generally, it is believed that the closer the absolute value of r is to "1", the stronger the correlation between the two variables. When r > 0, the two variables are positively correlated; when r < 0, they are negatively correlated. An r value of P < 0.05 indicates a significant linear correlation. NTsys was used to determine the correlation between the genetic distance matrix and the geographical distance matrix of three Epimedium varieties. The results are as follows: Figure 4 The results showed a significant correlation between the geographic distance and genetic distance matrices (r = 0.96076, P = 1.0000), with the P value being much greater than 0.05, indicating that the geographic distribution of the three Epimedium species may not be correlated with the level of genetic diversity among populations.

[0110] 3.4 Constructing Molecular Identity Cards

[0111] A single primer was used for ISSR-PCR amplification of two varieties. Electrophoresis revealed different band patterns between the two varieties, indicating that this primer can be used to distinguish between them. Based on statistical analysis of the amplified bands from 31 ISSR primers, six primers (823, 840, 841, 842, 854, and 866) were selected as core primers for identifying Arrowleaf No. 1, Arrowleaf No. 2, and Soft Hair No. 1. Fingerprint patterns for these three new varieties were constructed (e.g., ...). Figure 5 ) and molecular ID card (see results) Figures 6 to 8 ).

[0112] In the experiment, primer 866 did not produce clear bands in the amplification of Arrow Leaf 1 and Arrow Leaf 2, but it produced stable, clear, non-tailed, and highly polymorphic bands in the amplification of Soft Hair 1. This indicates that primer 866 can accurately and quickly identify Soft Hair 1 and can be used as a core primer for identifying Soft Hair 1. It has specific bands at 500bp, 750bp, and 2000bp, which can be used as a reference for identification. Of the six primers, primers 840 and 842 were used to amplify three new varieties of Epimedium, respectively, and obtained clear bands for each variety. However, of the other four primers, three primers could only distinguish two varieties, and the other primer could only distinguish one variety. The amplification results of primer 840 showed that, compared with the three varieties, only Arrow Leaf 1 had a band at the 2000bp site, only Soft Hair 1 had a band at the 1000bp site, and only Arrow Leaf 2 had a band at the 250bp site. Similarly, primer 842 could also directly identify the three varieties. Compared with primer 840, two sites need to be referenced to distinguish Arrow Leaf 1 from Arrow Leaf 2, and only Soft Hair 1 had a band at the 100bp site.

[0113] Table 3.5 Nei's genetic similarity coefficient and genetic distance of Arrow Leaf 1

[0114]

[0115] Table 3.6 Nei's genetic similarity coefficient and genetic distance of Arrow Leaf 2

[0116]

[0117]

[0118] Table 3.7 Nei's genetic similarity coefficient and genetic distance of Soft Hair No. 1

[0119]

[0120] 4. Discussion and Conclusion

[0121] ISSR molecular markers are a DNA polymorphism detection technology developed based on PCR technology. They have the advantages of being simple, universal, and highly reproducible. They can generate a rich variety of polymorphic sites, revealing the differences in polymorphism. The level of genetic variation affects the strength of a population's adaptability to the environment.

[0122] This study collected 30 Epimedium cultivation samples from Guizhou Province and amplified a total of 414 bands using 31 selected ISSR primers, of which 329 were polymorphic. Analysis of the genetic diversity of three Epimedium varieties using popgene32 showed that the polymorphic sites and percentages differed among the three varieties. The lowest polymorphic site was found in 'Arrow Leaf 1' (72.02%), with 121 polymorphic sites; the lowest was found in 'Arrow Leaf 2' (83.77%), with 129 polymorphic sites; and the highest was found in 'Soft Hairy Epimedium 1' (83.78%), with 62 polymorphic sites.

[0123] The average observed allele count (Na) and effective allele count (Ne) also differ among the three, indicating varying levels of genetic diversity. The observed allele count (Na) reflects the degree of polymorphism in the population, while the effective allele count (Ne) is an indicator of the magnitude of genetic variation. Comparatively, Soft-haired 1 exhibits greater genetic variation and richer genetic diversity, while Arrow-leaf 2 shows slightly higher genetic diversity than Arrow-leaf 1.

[0124] Cluster diagrams of the three Epimedium species constructed using NTsys and Nei's genetic similarity coefficient and genetic distance tables derived from popgene32 show that: the genetic distance of Epimedium 'Arrow Leaf 1' is between 0.2488 and 0.4796, and the genetic similarity is between 0.6250 and 0.7798; the genetic distance of Epimedium 'Arrow Leaf 2' is between 0.2248 and 0.5710, and the genetic similarity is between 0.5649 and 0.7987; the genetic distance of Epimedium 'Soft Hair 1' is between 0.2610 and 0.6405, and the Nei's genetic similarity coefficient is between 0.5270 and 0.7703.

[0125] In addition, the correlation analysis between geographical location and genetic distance constructed by NTsys confirmed that there may be no correlation between geographical distance and genetic distance among the three Epimedium varieties (r = 0.96076, P = 1.0000), that is, geographical distribution does not affect the level of genetic diversity among populations.

[0126] From the 31 selected primers, 6 ISSR primers were further screened to obtain clear bands. A band at the same locus was marked as "1", and no band was marked as "0". Three quality fingerprint profiles of Epimedium were established, creating a unique barcode identification for each variety, providing experimental evidence for identifying Epimedium germplasm resources. Primers 840 and 842 can distinguish the three Epimedium varieties separately. Primer 866 only shows a clear, non-tailed band in the gel imaging of 'Ruomao 1', thus distinguishing it from 'Ruomao 1'. Primer 823 can distinguish 'Jianye 1' and 'Jianye 2' at four loci: 2000bp, 1000bp, 500bp, and 250bp.

[0127] As a billion-yuan industry in Guizhou Province, Epimedium is of great significance for constructing a precise germplasm fingerprint map of Epimedium germplasm resources, analyzing its genetic diversity, and discovering germplasm with rich genetic backgrounds to improve existing varieties. This will provide accurate data for distinguishing Epimedium varieties, protecting the intellectual property rights of existing varieties, and promoting the improvement of Epimedium varieties and the breeding of superior new varieties.

[0128] This invention utilizes ISSR molecular marker technology to preliminarily analyze the band polymorphism, population polymorphism, phylogenetic relationships, and clustering results of three cultivated Epimedium varieties in Guizhou Province. It demonstrates that there is a certain degree of genetic diversity among the varieties and among the populations, and also provides data reference for promoting the improvement of Epimedium varieties and the breeding of superior new varieties.

[0129] Finally, it should be noted that the above embodiments are merely representative examples of this application. Obviously, the technical solutions of this application are not limited to the above embodiments, and many variations are possible. All variations that can be directly derived or conceived by those skilled in the art from the content disclosed in this application should be considered within the scope of protection of this application.

Claims

1. A primer set for SSR molecular markers used for the identification of Epimedium varieties, characterized in that, The primer set of the SSR molecular marker includes any one or more of the following SSR molecular marker primers: (1) Sequence of SSR molecular marker primer 823: TCTCTCTCTCTCTCTCTC; (2) Sequence of SSR molecular marker primer 840: GAGAGAGAGAGAGAGAGACTT; (3) Sequence of SSR molecular marker primer 841: GAGAGAGAGAGAGAGAGACTC; (4) Sequence of SSR molecular marker primer 842: GAGAGAGAGAGAGAGAGACTG; (5) Sequence of SSR molecular marker primer 854: TCTCTCTCTCTCTCTCTCAGG; (6) Sequence of SSR molecular marker primer 866: CTCCTCCTCCTCCTCCTC.

2. The application of the primer set described in claim 1 in the identification of Epimedium varieties.

3. The application as described in claim 2, characterized in that, The Epimedium varieties include Epimedium Arrow Leaf No. 1, Epimedium Arrow Leaf No. 2, and Epimedium Soft Hair No.

1.

4. A method for identifying Epimedium varieties, characterized in that, The primer set described in claim 1 is used for differentiation, and the specific steps are as follows: (1) Epimedium DNA was extracted using the CTAB method; (2) Using the DNA obtained above as a template, add the primer set of the SSR molecular marker described in claim 1 to perform PCR amplification to obtain PCR product; (3) The obtained PCR products were detected by electrophoresis on an agarose gel to obtain detection bands; identification was performed based on whether clear bands could be obtained and the size of the detection bands.

5. The method as described in claim 4, characterized in that, Step (3) involves identification based on whether clear bands can be obtained and the size of the detection bands, as follows: If the primer set is primer 866, an SSR molecular marker, and a stable, clear, non-tailed, and highly polymorphic band is obtained during amplification, then the sample is Epimedium Breast No. 1; and there are specific bands at 500bp, 750bp, and 2000bp positions. If the primer set is primer 840 of SSR molecular marker, and there is a detection band of 2000 bp, it proves that the sample is Epimedium Arrow Leaf No. 1; if there is a detection band of 1000 bp, it proves that the sample is Epimedium Soft Hair No. 1; if there is a detection band of 250 bp, it proves that the sample is Epimedium Arrow Leaf No.

2. If the primer set is SSR molecular marker primer 842, and there is a detection band with a size of 100 sites, then the sample is Epimedium hygroscopicum No.

1. If the primer set is primer 854, an SSR molecular marker, and there is a detection band with a size of 500 sites, then the sample is Epimedium Arrow Leaf No. 1; if there is a detection band with a size of 1000 sites, then the sample is Epimedium Arrow Leaf No.

2. If the primer set is SSR molecular marker primer 823, and there is a detection band with a size of 250 or 500 sites, then the sample is Epimedium Arrow Leaf No.

2. If the primer set is primer 841 with SSR molecular marker, and there is a detection band with a size of 500 sites, then the sample is Epimedium Arrow Leaf No.

1. If the primer set contains primer 823 with an SSR molecular marker, and there is a detection band of size 200, then the sample is Epimedium Arrow Leaf No.

1.

6. A kit for identifying Epimedium species, characterized in that, The kit contains the primer set as described in claim 1.

7. The application of the primer set of claim 1 or the kit of claim 6 in the genetic diversity analysis of Epimedium varietal resources, the construction of Epimedium varietal DNA fingerprint database, and the molecular breeding system of new Epimedium varieties.

8. The application of the primer set described in claim 1 in constructing the molecular identity card of Epimedium species DNA.

9. A method for constructing a DNA molecular identity card for Epimedium species, characterized in that, The primer set described in claim 1 is used for construction, and the specific steps are as follows: (1) DNA templates of Epimedium Arrow Leaf No. 1, Arrow Leaf No. 2, and Soft Hair No. 1 were extracted using the CTAB method; (2) PCR amplification was performed using the primer set of the SSR molecular marker described in claim 1. DNA samples of Arrow Leaf No. 1, Arrow Leaf No. 2 and Soft Hair No. 1 were used for PCR screening. The primers with clear target bands were screened out by electrophoresis on agarose gel with 1% TAE at 120V for 40 min. (3) The bands were read manually. Clear and reproducible bands were included in the statistics, while those that were not were excluded. A 0-1 matrix table was established. Popgene32 was used to analyze the observed alleles (Na), effective alleles (Ne), Shannon's information index (I), Nei's genetic diversity (h), and Nei's genetic similarity coefficient and genetic distance for each variety and each Epimedium plant of the three new Epimedium varieties. Cluster analysis was performed using NTsys to construct a UPGMA clustering tree and determine the correlation between the genetic distance matrix and the geographical distance matrix. At the same locus, a band is recorded as "1" and no band is recorded as "0". The electrophoresis pattern is converted into a fingerprint pattern. Using a barcode generator, molecular identification cards for the above three Epimedium varieties are created according to the CODE128 code.

10. The method as described in claim 9, characterized in that, The PCR amplification system consisted of: 20 μL, 1 μL template DNA, 2 μL primers, 8.4 μL 2×taq supermix, and 8.6 μL dd H2O; the amplification program was: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 1 min, 53℃ annealing for 1 min, 72℃ extension for 1 min, 35 cycles, 72℃ extension for 10 min, and cooling to 4℃.

Images