Development, preparation and application of liquid phase chip for detecting high-yield wide-adaptability related characters of wheat

Abstract

The invention discloses development, preparation and application of a liquid phase chip for detecting wheat high-yield wide-application related traits, and belongs to the technical field of nucleic acid detection molecules. The technical problem to be solved by the invention is how to realize quick and accurate detection of multiple SNP sites of wheat. The chip for detecting the genotype of the SNP site of the wheat comprises a reagent for specifically detecting the SNP site, the SNP sites are 5452 SNP sites in a table 1; the position information of the SNP locus is determined by comparison on the basis of a wheat genome reference sequence Triticumastivum IWGSCv1.0 version, and the position information of the SNP locus is determined by comparison on the basis of the wheat genome reference sequence Triticumastivum IWGSCv1.0 version. The 5452 SNP molecular marker combination provided by the invention is strong in representativeness, high in polymorphism, good in universality, high in coverage rate on a genome and uniform in distribution, and is particularly suitable for applications such as chip preparation, molecular marker-assisted selection, directional improvement, important character gene mining and identification, function analysis and the like.

Description

Technical Field

[0001] This invention belongs to the field of nucleic acid detection molecular technology, specifically involving the development, preparation and application of liquid-phase chips for detecting high-yield and widely adaptable traits in wheat. Background Technology

[0002] As a major global food crop, wheat's genetic improvement heavily relies on molecular marker technology. While traditional wheat genotyping methods (such as whole-genome resequencing) can comprehensively analyze genetic variations, the massive size of the wheat genome (approximately 16 Gb) leads to high sequencing costs and complex data analysis. Furthermore, while solid-phase SNP chips (such as 15K and 660K) can reduce costs, they suffer from the following problems: ① High technological dependence, requiring specific sequencing platforms and exhibiting low flexibility; ② Fixed loci, only able to detect preset, fixed SNP loci, unable to be dynamically updated; ③ An imbalance between cost and coverage, with high-density chips (such as 660K) being expensive, while low-density chips (such as 15K) have insufficient coverage, making it difficult to meet the multi-gene mapping needs of complex traits (such as disease resistance and yield).

[0003] Liquid-phase chips based on targeted sequencing and liquid-phase capture technologies (such as...) This technology, through probe design, flexibly captures SNP sites in target regions, significantly improving the efficiency and economy of wheat breeding: ① High flexibility and dynamic updating: the probe can be dynamically adjusted for newly discovered genes or QTLs; ② High cost-effectiveness: liquid-phase chips do not require solid-phase carriers, reducing library construction costs by more than 90%, and have high throughput; ③ Uniform coverage: the design emphasizes balanced genome distribution, avoiding the skewed distribution problem of traditional chips.

[0004] Liquid-phase microarrays, through technological innovation and multidisciplinary collaboration (such as genomics and bioinformatics), are reshaping the paradigm of wheat breeding. Their low cost, high flexibility, and precise targeting not only accelerate the translation of genetic research into breeding practice but also provide an efficient tool for addressing climate change and disease threats. In the future, with the accumulation of pan-genome resources and the widespread adoption of automation technologies, liquid-phase microarrays are expected to become a core support platform for wheat molecular breeding. Summary of the Invention

[0005] The technical problem this invention aims to solve is: how to obtain a low-cost, highly flexible, and precisely targeted liquid-phase chip to achieve rapid and accurate detection of multiple SNP sites in wheat. To solve this technical problem, this invention provides the following technical solution.

[0006] This invention provides a chip for detecting wheat SNP locus genotypes, including reagents for specifically detecting SNP loci; the SNP loci are the 5452 SNP loci in Table 1; the location information of the 5452 SNP loci in Table 1 is determined by comparison with the wheat genome reference sequence, which is Triticum_aestivum_IWGSCv1.0.

[0007] In this invention, the reagent includes a single-stranded nucleotide probe.

[0008] In this invention, for each SNP site, a target site is selected from 110 bp upstream to 110 bp downstream of the location of the SNP site on the wheat genome reference sequence, and one or / and two probes are designed for the target site, wherein the nucleotide sequence of the probe is either inversely complementary to or identical to the nucleotide sequence within the target site.

[0009] In this invention, the target may encompass the SNP site.

[0010] In this invention, the chip contains a total of 5,452 to 10,904 single-stranded nucleotide probes.

[0011] In this invention, the start and end positions of the target sites corresponding to each single-stranded nucleotide probe are shown in Table 1.

[0012] In this invention, the single-stranded nucleotide probe is modified with biotin.

[0013] In this invention, the chip also includes magnetic beads modified with streptavidin.

[0014] In this invention, the chip is a liquid-phase probe hybridization chip.

[0015] The present invention also provides nucleic acid probe compositions comprising any of the single-stranded nucleotide probes described above.

[0016] It should be noted that, given the reference genome and its version number, and the specific location of the target site within it, obtaining the specific sequence information of each probe is very easy for those skilled in the art. Due to space limitations, the specific sequence information of each probe is not presented visually in this article.

[0017] The application of the aforementioned chip in the localization of wheat candidate genes, genetic diversity analysis, variety identification, kinship identification, haplotype analysis, germplasm resource evaluation and new germplasm creation, genome-wide association analysis, genome selection breeding or assisted breeding is also protected by this invention.

[0018] The application of the above-mentioned nucleic acid probe composition in at least one of the following is also within the scope of protection of this invention:

[0019] A1) Applications in the localization of wheat candidate genes, genetic diversity analysis, variety identification, kinship identification, haplotype analysis, germplasm resource evaluation and new germplasm creation, genome-wide association analysis, genome selection breeding or assisted breeding;

[0020] A2) Applications in the preparation of products for the localization of wheat candidate genes, genetic diversity analysis, variety identification, kinship identification, haplotype analysis, germplasm resource evaluation and new germplasm creation, genome-wide association analysis, genome selection breeding or assisted breeding.

[0021] In this invention, the 5452 SNP molecular markers include relevant loci obtained by mapping various environmental adaptability traits of wheat such as drought and low nitrogen, and relevant loci obtained by mapping yield traits such as thousand-grain weight, number of grains per spike, grain length, grain width, plant height, or spike length.

[0022] The candidate genes can be genes with high yield and broad adaptability traits.

[0023] In this invention, the products include, but are not limited to, reagents, chips, and whole-genome selection models.

[0024] The beneficial technical effects provided by this invention are as follows:

[0025] (1) The 5452 SNP molecular marker combinations provided in this embodiment of the invention cover a wide range of wheat germplasm resource data. They are highly representative, highly polymorphic, and have good universality. They have high coverage and uniform distribution on the genome and are particularly suitable for applications such as chip preparation, molecular marker-assisted selection, targeted improvement, identification and functional analysis of important trait genes.

[0026] (2) The present invention provides a 5K wheat whole genome chip containing probes for detecting the above-mentioned sites. The chip has the characteristics of high efficiency, low cost, good genetic stability, simple typing, and high throughput. It can produce a large amount of data at one time and can cover the detection of nearly a thousand materials at the same time. It is also suitable for mainstream second-generation sequencing platforms such as Illumina and MGI, and has platform versatility. Attached Figure Description

[0027] Figure 1 This is a flowchart illustrating the chip design and fabrication process of the present invention.

[0028] Figure 2 Example diagram of two probes designed for the target point corresponding to SNP2945.

[0029] Figure 3 To label chromosome distribution on a liquid-phase microarray. Detailed Implementation

[0030] I. Terminology in this invention:

[0031] Examples of resources describing many of the molecular biology-related terms used in this article can be found in the following literature: Alberts et al., Molecular Biology of The Cell, 5th ed., Garland Science Publishing, Inc.: New York, 2007; Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed., Springer-Verlag: New York, 1991; King et al., A Dictionary of Genetics, 6th ed., Oxford University Press: New York, 2002; and Lewin, Genes IX, Oxford University Press: New York, 2007.

[0032] Any references cited in this article, including, for example, all patents, published patent applications and non-patent publications, are incorporated in their entirety by reference.

[0033] For ease of understanding of this disclosure, several terms and abbreviations used herein are defined as follows:

[0034] When used in a list of two or more items, the term "and / or" means that any of the listed items can be used alone or in combination with any one or more of the listed items. For example, the expression "A and / or B" is intended to mean either or both of A and B, i.e., A alone, B alone, or a combination of A and B. The expression "A, B and / or C" means A alone, B alone, C alone, a combination of A and B, a combination of A and C, a combination of B and C, or a combination of A, B and C.

[0035] The term "comprising" is not intended to be restrictive, but rather inclusive and implies the presence of other elements besides those listed, and can be interpreted as "including but not limited to". The term "comprising" also encompasses the terms "consisting of" and "substantially consisting of". In this document, the terms "including" and "comprise" are used interchangeably.

[0036] In this paper, the term "polymorphism" refers to genetic polymorphism, which is used to describe the diversity of the genome of a species (such as wheat), essentially referring to inter-individual differences in a DNA sequence unique to an individual. In other words, genetic polymorphism is the occurrence of multiple discrete allelic states within the same population. Polymorphism involves one of two or more variants of a particular DNA sequence. Single nucleotide polymorphism (SNP) is the most common type of polymorphism, which is a DNA sequence polymorphism caused by a variation of a single nucleotide at the genomic level.

[0037] II. Implementation Examples

[0038] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0039] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0040] Unless otherwise specified, the quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0041] Example 1: Development of a liquid-phase chip for detecting high-yield and widely adaptable traits in wheat

[0042] Figure 1 This is a flowchart illustrating the chip design and fabrication process of the present invention.

[0043] 1.1 Chip Development

[0044] according to Figure 1 The steps shown involve a two-year genome-wide association analysis (660K solid-phase microarray) of nine wheat traits (grain length, grain width, plant height, spike length, number of grains per spike, length of the internode below the spike, thousand-grain weight, yield per plant, and biomass per plant) to select SNP markers above the threshold (4). For the selected loci, site verification / evaluation is performed on the wheat reference genome (Triticum_aestivum_IWGSCv1.0), and liquid-phase probe capture technology is used. Probe development and optimization were conducted. Site evaluation principles: probe length 100 bp, probe GC content 30-70%, and a maximum number of 5 similar fragments. A total of 5452 SNP molecular markers were finally obtained through screening, as shown in Table 1. These 5452 SNP molecular markers include relevant sites obtained from mapping various environmental adaptations of wheat, such as drought and low nitrogen, and relevant sites obtained from mapping yield traits such as thousand-grain weight, number of grains per spike, grain length, grain width, plant height, or spike length. For each SNP site, one or two target sites were selected from within a range of 110 bp upstream to 100 bp downstream of the SNP site in the wheat genome reference sequence (Triticum_aestivum_IWGSCv1.0 version). These target sites covered the SNP site. One or two probes were designed for each target site. Based on the principle of target anti-complementarity, the sense strand was designed first; if more than 5 similar sequences existed in the chromosome set, the antisense strand was used. The nucleotide sequence of the probe was anti-complementary or identical to the nucleotide sequence within the target site range.

[0045] Information on 5452 SNP molecular markers is shown in Table 1. In the SNP loci, the character before the colon (:) is the chromosome number, and the Arabic numeral after the colon (:) is the physical location of the SNP locus on that chromosome. In the three characters from right to left, the nucleotide before the ">" is the wild-type nucleotide (also called the reference allele or ref), and the nucleotide after the ">" is the mutant nucleotide (also called the variable allele or alt). For example, in SNP1, the SNP locus is "Chr1A:7775709C>G", where "Chr1A" represents chromosome 1A, and "7775709" represents the specific location on chromosome 1A in the wheat reference genome Triticum_aestivum_IWGSCv1.0. "C>G" indicates that the wild-type nucleotide at this SNP locus is C, and the mutant nucleotide is G. In the target location, the character before the colon (-) is the target start position, and the character after the colon (-) is the target end position. The target is the location where a probe is designed for the first SNP locus in the column.

[0046] Table 1 contains 1k background loci. Background loci only provide ref (reference allele) and not alt (variable allele). alt is represented by " / " in Table 1.

[0047] For example, in Table 1, SNP2945 is located at position 444887290 of the wheat 5A chromosome Triticum_aestivum_IWGSCv1.0 reference sequence, and its nucleotides are T (ref) or C (alt). For SNP2945, a target site is selected between positions 444887216 and 444887365 of the wheat 5A chromosome IWGSCv1.0 genome reference sequence, which covers the SNP. One or two probes are designed for this target site (considering specificity), and the nucleotide sequences of the probes are identical to or inversely complementary to the nucleotide sequences within the target range (example figure shown). Figure 2 For example, the nucleotide sequence of SNP2945 is T / C, and the nucleotide sequences of the two single-stranded DNA probes targeting the SNP2945 reference allele are as follows (5'-3'):

[0048] Probe 1: GTGCGTCACATGATGCCAATTATCACATAGGCATGGACGCGAGCTTTATCGACTGCGCACTAGCATTGAATGCTTGGTGG TATGATGGCGTGGATACGGT (SEQ ID NO:1, same as the first to 100th positions of the target).

[0049] Probe 2: GACTGCGCACTAGCATTGAATGCTTGGTGGTATGATGGCGTGGATACGGTGGTCAGCTGCACGCGGAACCACAAACCTAC ATGTTGACGAGTGTTGACTG (SEQ ID NO:2, same as the target site from position 51 to 150).

[0050] Table 1. 5452 SNP molecular markers

[0051]

[0052]

[0053]

[0054]

[0055]

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065]

[0066]

[0067]

[0068]

[0069]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076]

[0077]

[0078]

[0079]

[0080]

[0081]

[0082]

[0083]

[0084]

[0085]

[0086]

[0087]

[0088]

[0089]

[0090]

[0091]

[0092]

[0093] 1.2 Chip fabrication and usage methods

[0094] The principle of liquid-phase microarrays is site-specific capture sequencing based on the complementary binding of target probes and target sequences. First, a gDNA library is constructed from the material to be tested. Simultaneously, based on the principle of DNA complementarity, probes covering the target SNP are designed at each test site and modified with biotin. Then, in a liquid state, the biotin-modified probes hybridize with the target genomic region to form double strands. Subsequently, streptavidin-coated magnetic beads are used to molecularly adsorb the biotin-modified probes, thereby capturing the target sites that hybridize with the probes. Finally, the captured target sequences are eluted, amplified, and subjected to next-generation sequencing to obtain the genotype of the target SNP.

[0095] The specific steps are as follows: (1) First, construct a gDNA library for the material to be tested, and denature and dissociate the DNA into two single strands; (2) According to the principle of DNA complementarity, design probes covering the target mutation sites (including the 5452 SNP sites in Table 1 of this invention) at each test site, and modify the target probes (i.e. the probes for the 5452 sites in Table 1 of this invention) by biotin labeling, and the biotin-modified probes hybridize with the target region of the genome to form double strands; (3) Use streptavidin-coated magnetic beads to molecularly adsorb the biotin-modified probes, thereby capturing the target sites that hybridize with the probes; (4) Elute, amplify and sequence the captured target site sequences to obtain the genotype of the target mutation sites.

[0096] Liquid-phase chips capture labeled probes in suspension, overcoming the technical drawbacks of solid-phase chips such as poor repeatability, slow reaction rate, and limited flexibility. They offer advantages such as high throughput, low cost, simple and quick operation, and flexible use. The distribution of labeled chromosomes on a liquid-phase chip is shown below. Figure 3 As shown.

[0097] Example 2: Application of the chip of the present invention

[0098] Twelve wheat varieties approved for production were used for quality testing of the chip in this invention. DNA was extracted from leaves of wheat that had grown for one week (12 wheat samples) for genome resequencing (using OD). 260 / OD 280 High-quality DNA (≥50 ng / μL, 1.8-2.0, avoiding degradation or contamination) was used to detect wheat DNA using the chip described above according to the method in section 1.2. The detection results included the number of SNP deletion sites, the number of SNP detection sites, and the SNP detection rate. The site detection results of the chip of this invention on 12 wheat materials are shown in Table 2. The results show that the average site detection rate of the 5K liquid phase chip is 96.865%.

[0099] Wherein, SNP detection rate = number of SNPs detected / total number of SNPs * 100%;

[0100] Total number of SNP sites = number of detected SNP sites + number of missing SNP sites.

[0101] Table 2. Site test results of the chip of the present invention on 12 wheat samples.

[0102] wheat sample name Total number of SNP loci Number of SNP missing sites SNP detection sites SNP detection rate (%) Hebei 5265 5452 217 5235 96.020 Kexin No. 9 5452 216 5236 96.038 Stone 14-5628 5452 92 5360 98.312 Lumai 15 5452 229 5223 95.800 Zhoumai 24 5452 226 5226 95.855 Zhoumai 32 5452 271 5181 95.029 Ningmai 14 5452 94 5358 98.276 Wanmai 33 5452 41 5411 99.248 East 2-8 5452 224 5228 95.891 Yunhan 805 5452 84 5368 98.459 Jinmai 102 5452 219 5233 95.983 New Year No. 2 5452 138 5314 97.469

[0103] The present application has been described in detail above. Those skilled in the art will recognize that the present application can be implemented in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments are given in this application, it should be understood that further modifications can be made to the present application. In summary, in accordance with the principles of this application, this application is intended to include any changes, uses, or improvements to the present application, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A chip for detecting wheat SNP loci genotypes, which is a reagent for specifically detecting SNP loci; the SNP loci are the 5452 SNP loci in Table 1; the physical locations of the 5452 SNP loci in Table 1 are determined by comparison with the wheat genome reference sequence, which is Triticum_aestivum_IWGSCv1.

0.

2. The chip according to claim 1, characterized in that: The reagents include single-stranded nucleotide probes.

3. The chip according to claim 2, characterized in that: For each SNP site, a target site is selected from 110 bp upstream to 110 bp downstream of the location of the SNP site on the wheat genome reference sequence. The target site covers the SNP site. One or / and two probes are designed for the target site. The nucleotide sequence of the probe is either inversely complementary to or the same as the nucleotide sequence within the target site range.

4. The chip according to claim 3, characterized in that: The starting and ending positions of the target points corresponding to the probes are shown in Table 1.

5. The chip according to any one of claims 2-4, characterized in that: The single-stranded nucleotide probe is modified with biotin.

6. The chip according to any one of claims 1-5, characterized in that: The chip also includes magnetic beads modified with streptavidin.

7. The chip according to any one of claims 1-6, characterized in that: The chip is a liquid-phase probe hybridization chip.

8. The application of any one of the chips described in claims 1-7 in the localization of wheat candidate genes, genetic diversity analysis, variety identification, kinship identification, haplotype analysis, germplasm resource evaluation and new germplasm creation, genome-wide association analysis, genome selection breeding or assisted breeding.

9. A nucleic acid probe composition, characterized in that, The nucleic acid probe composition comprises the single-stranded nucleotide probe according to any one of claims 2 to 7.

10. The use of the nucleic acid probe composition of claim 9 in at least one of the following: A1) Applications in the localization of wheat candidate genes, genetic diversity analysis, variety identification, kinship identification, haplotype analysis, germplasm resource evaluation and new germplasm creation, genome-wide association analysis, genome selection breeding or assisted breeding; A2) Applications in the preparation of products for the localization of wheat candidate genes, genetic diversity analysis, variety identification, kinship identification, haplotype analysis, germplasm resource evaluation and new germplasm creation, genome-wide association analysis, genome selection breeding or assisted breeding.

Images