A cerium nanoscale enzyme composite active material and its application in liver failure treatment

By combining cerium nanozyme composite active material with miR122, the ROS homeostasis during stem cell differentiation is regulated. Combined with metal polyphenol network structure modification, the problems of complex and expensive stem cell differentiation process and impaired hepatocyte transplantation viability are solved, achieving efficient stem cell differentiation into hepatocytes and therapeutic effects for liver failure.

CN120866210BActive Publication Date: 2026-02-03SUN YAT SEN UNIV +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511082584.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-04
Publication Date
2026-02-03
Estimated Expiration
2045-08-04

AI Technical Summary

Technical Problem

In existing technologies, the process of stem cell differentiation into hepatocytes is complex and expensive, and the problem of impaired viability during hepatocyte transplantation has not been effectively solved. There is also a lack of research on the ROS homeostasis regulation mechanism during stem cell differentiation, which affects the therapeutic effect.

Method used

Using cerium nanozyme composite active material, RCN-miRNA complex was synthesized, miR122 was used to induce stem cell differentiation, and cerium dioxide nanozyme was used to regulate intracellular ROS homeostasis and protect mitochondrial function. Combined with metal polyphenol network structure modification of hepatocytes, the function and vitality after transplantation were enhanced.

Benefits of technology

This method enables low-cost in vitro induction of stem cell differentiation into hepatocytes, improving differentiation efficiency and cell viability, enhancing the therapeutic effect of hepatocyte transplantation, solving the problem of ROS homeostasis regulation during stem cell differentiation, and improving the treatment effect of liver failure.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120866210B_ABST
    Figure CN120866210B_ABST
Patent Text Reader

Abstract

The application discloses a cerium nanoscale enzyme composite active material and application thereof in liver failure treatment, and belongs to the technical field of nanomaterials. The application combines miR122 and cerium dioxide nanoscale enzyme functions, develops a new stem cell differentiation inducer, i.e., a cerium nanoscale enzyme composite active material, and deeply studies the potential mechanism of catalytically active nanoscale enzyme material in regulating stem cell fate. After modification, the cerium dioxide nanoscale enzyme can be used for delivering miR122 into stem cells, so that miR122 is highly enriched in cells, thereby inducing liver differentiation. Meanwhile, the catalytic activity of the cerium dioxide nanoscale enzyme can regulate intracellular ROS homeostasis, protect mitochondria from ROS-induced damage, thereby maintaining mitochondrial function and meeting the energy demand in the differentiation process, which is crucial for the successful differentiation of stem cells. In order to solve the problem of impaired viability in hepatocyte transplantation, it is proposed to coat a layer of Ce 4+ -polyphenol skeleton on the surface of induced hepatocyte-like cells (iHLCs), further protecting the function and viability of hepatocytes after transplantation, and improving the in-vivo treatment effect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of nanomaterials technology, and in particular relates to a cerium nanoenzyme composite active material and its application in the treatment of liver failure. Background Technology

[0002] Acute liver failure is characterized by the loss of function of numerous hepatocytes, leading to a rapid decline in liver function. Hepatocyte transplantation can rapidly support liver function and promote liver regeneration, offering a promising strategy for treating liver failure. However, the clinical application of hepatocyte transplantation still faces significant challenges, limited by insufficient hepatocyte viability and a limited source. Generally, donor livers are prioritized for organ transplantation, and liver tissue unsuitable for transplantation is the primary source for isolating primary hepatocytes. However, the quality and quantity of hepatocytes obtained from these untransplantable livers are limited, restricting therapeutic efficacy and clinical application. Hepatocyte-like cells derived from stem cells show great potential as an alternative to liver transplantation. However, guiding the specific differentiation of stem cells into functional hepatocytes in vitro remains a major challenge. Furthermore, preserving the viability and function of transplanted cells to enhance therapeutic efficacy is also crucial for hepatocyte transplantation therapeutic strategies.

[0003] Significant progress has been made in the study of hepatocyte differentiation from stem cells such as induced pluripotent stem cells (iPSCs) and mesenchymal stem cells (MSCs). For example, continuous culture of stem cells in media rich in various growth factors has been shown to effectively induce MSCs to differentiate into hepatocyte-like cells. However, these differentiation methods remain complex and expensive for clinical applications. MicroRNAs play an important role in regulating gene expression, affecting cell differentiation, proliferation, and survival. Previous studies have shown that overexpression of miR122 in MSCs can promote liver differentiation and hepatocyte maturation through the miR122 / FOXA2 / HNF4-α positive feedback loop, potentially enabling low-cost in vitro regulation of stem cell liver differentiation. During differentiation, stem cells require a large supply of ATP to meet the needs of various life activities, and the cell's energy supply mode shifts towards oxidative phosphorylation, while simultaneously enhancing mitochondrial biosynthesis. With the increase in intracellular mitochondrial ATP levels, reactive oxygen species are inevitably produced as a byproduct. Intracellular reactive oxygen species (ROS) play an important role as signaling molecules. Although excessive ROS can impair cell viability and organelle function, maintaining appropriate ROS levels is necessary and beneficial for maintaining cell function and plays a role in cell differentiation and proliferation. Previous studies have found that regulating mitochondrial ROS levels can affect the cell differentiation process and help determine the direction of stem cell differentiation.

[0004] Functional biomaterials are widely used in regenerative medicine due to their inherent physicochemical properties and modifiable surfaces. Previous studies have demonstrated that functional nanomaterials can effectively regulate stem cell differentiation, including bone and neural differentiation. For example, catalytically active nanozymes can protect stem cell viability by scavenging excess reactive oxygen species (ROS) in the tissue microenvironment, thereby promoting stem cell survival and differentiation. However, research on the specific mechanisms by which nanozymes directly regulate stem cell fate is limited. Most studies focus on using nanozymes to scavenge excess ROS in the tissue microenvironment, thereby indirectly protecting the stem cell differentiation process, with fewer studies addressing the regulation of ROS homeostasis during stem cell differentiation. The catalytic properties of nanozymes hold promise for regulating intracellular ROS balance during stem cell differentiation, thereby enhancing mitochondrial function and the ability to regulate stem cell fate. Summary of the Invention

[0005] This invention provides a method for preparing cerium nanozyme composite active materials, comprising the following steps:

[0006] (1) Synthesis of RCN: 1.3-1.4 mmol of cerium(III) acetate hydrate and 3-3.5 g of oleylamine were added to 10-20 mL of xylene. After stirring at room temperature for 22-26 hours, the mixture was heated to 88-92 °C at a rate of 1-3 °C / min. Then, 0.8-1.2 mL of deionized water was added, and the resulting solution was stirred at 88-92 °C for 2.5-3.5 hours. Then, 45-55 mL of ethanol was added to precipitate the nanoparticles. The cerium dioxide nanoparticles CN were collected by centrifugation. 14-16 mg of CN, 2.8-3.2 mg of 2-bromo-2-methylpropionic acid, and 0.2-0.3 mg of citric acid were added to a mixed solution of 14-16 mL of chloroform and DMF, wherein the volume ratio of chloroform to DMF was 0.8-1.2:0.8-1.2. The mixture was then stirred at 28-32 °C. Stir at ℃ for 5-7 hours, centrifuge to collect CN with 2-bromo-2-methylpropionic acid end-capped, disperse 14-16 mg CN, 36-40 mg EDC and 21-25 mg NHS with 2-bromo-2-methylpropionic acid end-capped in 14-16 mL of deionized water, then activate the mixture by stirring at room temperature for 25-35 minutes, then add 3-5 mL of 8-12 mg / mL CR9 aqueous solution dropwise to the above mixture, then stir at room temperature for another 5-7 hours, and centrifuge to collect CR9-functionalized cerium dioxide nanoparticles RCN;

[0007] (2) Synthesis of RCN-miRNA complex: The RCN and miR122 obtained in step (1) are mixed in water at a mass ratio of 1:5-7, wherein the concentration of miR122 is 4-6 μM, and then the mixture is incubated at 36-38 °C with shaking for 0.8-1.2 hours to obtain the RCN-miRNA complex, which is the cerium nanozyme composite active material.

[0008] In one embodiment of the present invention, the mass ratio of RCN to miR122 in step (2) is 1:6.

[0009] In one embodiment of the present invention, the concentration of miR122 in step (2) is 5 μM.

[0010] The present invention also provides a cerium nanozyme composite active material prepared by the above preparation method.

[0011] This invention also provides the application of the above-mentioned cerium nanozyme composite active material in the preparation of stem cell differentiation inducers.

[0012] The present invention also provides a method for preparing hepatocytes for treating liver failure, comprising the following steps:

[0013] (1) Add the above-mentioned cerium nanozyme composite active material to a culture medium containing stem cells, wherein the concentration of miR122 is 70-90 nM, and induce for 13-15 days;

[0014] (2) Wash the cells with 1×DPBS, then add 1 mL of TA solution and shake for a few seconds, then add 1 mL of Ce(SO4)2 solution and mix well. React for 25-35 seconds, then wash away the reaction solution to obtain hepatocytes modified with metal polyphenol network structure; the concentration of the TA solution is 110-130 μg / mL, and the concentration of the Ce(SO4)2 solution is 65-75 μg / mL.

[0015] In one embodiment of the present invention, the induction time in step (1) is 14 days.

[0016] In one embodiment of the present invention, the concentration of the TA solution in step (2) is 120 μg / mL and the concentration of the Ce(SO4)2 solution is 70.3 μg / mL.

[0017] The present invention also provides hepatocytes prepared by the above-described preparation method.

[0018] This invention also provides the application of the above-mentioned hepatocytes in the preparation of products for treating liver failure.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] This invention combines the functions of miR122 and cerium dioxide nanozymes to develop a novel stem cell differentiation inducer and delves into the potential mechanisms by which catalytically active nanozyme materials regulate stem cell fate. After modification, the cerium dioxide nanozyme can be used to deliver miR122 into stem cells, resulting in high intracellular miR122 accumulation and inducing liver differentiation. Simultaneously, the catalytic activity of the cerium dioxide nanozyme can regulate intracellular ROS homeostasis, protecting mitochondria from ROS-induced damage and maintaining mitochondrial function to meet the energy requirements during differentiation, which is crucial for successful stem cell differentiation. To address the problem of impaired viability in hepatocyte transplantation, a layer of cerium dioxide nanozyme is coated onto the surface of induced hepatocyte-like cells (iHLCs). 4+ - Polyphenolic backbone further protects the function and vitality of transplanted liver cells, thereby improving the therapeutic effect in vivo. Attached Figure Description

[0021] Figure 1 (A) Schematic diagram of RCN-miRNA synthesis; (B) TEM image of cerium dioxide nanozyme (CN); (C) SAED image of CN; (D) Elemental scan image of CN; (E) HRTEM image and lattice spacing analysis of CN; (F) XPS analysis of CN; (G) TEM image of RCN; (H) HRTEM image of RCN; (I) XPS analysis of RCN.

[0022] Figure 2 (A) Agarose gel electrophoresis was used to determine the loading rate of RCN on miRNA; (B) CCK8 assay was used to evaluate the viability of stem cells treated with different concentration gradients of RCN.

[0023] Figure 3 Characterization results of RCN-miRNA complexes with different RCN:miRNA ratios, where G1-G4 represent RCN-miRNA complexes with different RCN:miRNA mass ratios: G1 (2:1), G2 (4:1), G3 (6:1), and G4 (8:1), and G0 represents miRNA; (A) Zeta potential of G0-G4; (B) Hydrated particle size of CN, RCN, and RCN-miRNA complexes (G1-G4); (C) TEM images of G1, G2, G3, and G4; (D) Uptake fluorescence image of G0-G4 in hADSCs; (E) Flow cytometry detection of G0-G4 uptake in hADSCs; (F) CCK8 assay to evaluate the effect of G0-G4 on stem cell proliferation.

[0024] Figure 4The results of RCN-miRNA-induced stem cell differentiation in vitro include (AE) the relative expression levels of liver marker genes (HNF4A, ALB, CYP3A4, AFP and CYP1A2) in different groups of cells on days 7 and 14 of differentiation; and (F) the relative copy number of mitochondria in different groups of cells.

[0025] Figure 5 On day 7 of differentiation in the (AC) group, the expression levels of FOXA2, SOX17 and CXCR4 genes in cells of different induction groups; (DF) the gene expression levels of mitochondrial biogenesis-related regulatory factors in cells of different induction groups; (G) a schematic diagram of the mechanism by which RCN-miRNA enhances mitochondrial biogenesis and induces liver differentiation of stem cells.

[0026] Figure 6 To illustrate the expression of TCF7L2 in cells 7 days after induction, (A) is an immunofluorescence staining image of TCF7L2; and (B) is a semi-quantitative analysis of the expression level of TCF7L2 in cells.

[0027] Figure 7 For RCN's ·O 2- The results of the characterization of clearance ability.

[0028] Figure 8 The results of the detection of the protective effect of RCN on mitochondrial function include: (A) mitochondrial membrane potential of stem cells pretreated with different concentrations of RCN and exposed to hydrogen peroxide, with a scale bar of 100 μm; (B) mitochondrial membrane potential of cells in different treatment groups analyzed by flow cytometry; (C) statistical graph of mitochondrial membrane potential flow cytometry results; and (D) expression of the TCF7L2 gene in different groups of cells.

[0029] Figure 9 The expression of TCF7L2 in cells under different concentrations of RCN induction is shown in the following figures: (A) Immunofluorescence staining image of TCF7L2; (B) Protein immunoblotting analysis results of TCF7L2 expression level in cells; (C) Semi-quantitative analysis results of TCF7L2 expression level in cells.

[0030] Figure 10 The results show the protective effect of metal polyphenol network surface modification on cells, including (A) a schematic diagram of surface modification; (B) SEM images of unmodified cells and modified cells; (C) cell viability of modified cells under different concentrations of hydrogen peroxide; (D) intracellular ROS staining fluorescence images before and after modification under 500 μM hydrogen peroxide stimulation; (E) fluorescence image of 2-NBDG uptake in modified cells; and (F) flow cytometry analysis of 2-NBDG uptake in modified cells.

[0031] Figure 11The results show the effect of modifying the cell surface with a metal polyphenol network structure on cell viability, including (A) live and dead cell staining images before and after modification; (B) CCK8 assessment of cell viability before and after modification; and (C) bright field image of cells after modification.

[0032] Figure 12 Images showing cell viability and cell death before and after modification under stimulation with 500 μM hydrogen peroxide.

[0033] Figure 13 To evaluate the in vivo therapeutic effect of MP-iHLCs in a liver failure model, the following data are presented: (A) Schematic diagram of animal experimental groups; (B) Serum ALT levels in mice of different treatment groups; (C) Serum AST levels in mice of different treatment groups; (D) Serum TBILI levels in mice of different treatment groups; (E) H&E staining images of liver sections from different treatment groups, with the damaged liver area represented by the black dashed line, scale bar at 200 μm; (F) Statistical analysis of the liver damage area in different treatment groups; (G) TUNEL (red) staining fluorescence images of liver sections from different treatment groups, scale bar at 200 μm; (H) Statistical analysis of the number of TUNEL-positive cells in the liver of different treatment groups.

[0034] Figure 14 To evaluate the in vivo antioxidant effect of MP-iHLCs in a liver failure model, (AC) the relative mRNA expression levels of Ho1, Nqo1 and Nox2 in liver tissues of different groups; (D) HO-1 (red) immunofluorescence staining images in liver sections of different treatment groups, scale bar 100 μm.

[0035] Figure 15 To evaluate the in vivo anti-inflammatory effect of MP-iHLCs in a liver failure model, (AC) the relative mRNA expression levels of Il6, Nlrp3 and Tnfa in liver tissues of different groups; (D) TNFA (red) immunofluorescence staining images in liver sections of different treatment groups, scale bar 100 μm.

[0036] Figure 16 Images of IL10 (green) immunofluorescence staining in liver sections from different treatment groups, scale bar 100 μm.

[0037] Figure 17 (A, B) show the flow cytometry results of macrophages in different groups of liver tissue; (C) shows the flow cytometry results of neutrophils in different groups of liver tissue.

[0038] Figure 18Transcriptome sequencing analysis of the healthy group, the model group, and the MP-iHLCs treatment group (n=3), including (A) two-dimensional PCA analysis results of gene expression matrices of the three groups; (B) heatmap of differentially expressed genes among the groups (P < 0.05).

[0039] Figure 19 GO enrichment analysis of differentially expressed genes in the model group compared with the healthy group.

[0040] Figure 20 To compare the model group with the healthy group, representative KEGG enrichment analysis was performed on differentially expressed genes.

[0041] Figure 21 (A) Trend clustering analysis was performed on differentially expressed genes among groups; (B) The circle plot shows the distribution abundance of different gene clusters in lipid metabolism-related pathways; (C) The circle plot shows the distribution abundance of different gene clusters in liver regeneration-related pathways; (D) The heatmap-bubble plot shows the expression levels of liver function genes, including Aox3, Fom1, Ugt2b1, Ugt2a3, Cyp1a2, Otc, Abcb11, Asl, Cyp2e1, Abcc2, Slc10a, and Abcc3.

[0042] Figure 22 The middle (A) circle diagram shows the distribution and abundance of different gene clusters in pathways related to energy metabolism; the (B) circle diagram shows the distribution and abundance of different gene clusters in pathways related to antioxidant function.

[0043] Figure 23 (A) Sankey-bubble plot showing Reactome enrichment analysis of differentially expressed genes among the three groups; (B) GO enrichment analysis of differentially expressed genes in the mMP-iHLCs treatment group compared with the model group.

[0044] Figure 24 To compare the MP-iHLCs treatment group with the model group, representative KEGG enrichment analysis was performed on differentially expressed genes. Detailed Implementation

[0045] Example 1

[0046] All animal experiments in this embodiment were conducted according to the protocol approved by the Laboratory Animal Management and Use Committee of Sun Yat-sen University (Approval No.: SYSU-IACUC-2023-000774). Male C57BL / 6 mice (18-22 g) aged 6-8 weeks were obtained from Guangdong Sijiajingda Biotechnology Co., Ltd. The mice were housed in an SPF-grade cleanroom provided by Guangzhou Zeyuan Biotechnology Co., Ltd.

[0047] 1. Experimental Methods

[0048] 1.1 Synthesis and Characterization of RCN

[0049] Cerium(III) acetate hydrate (CH3CO2)3Ce·xH2O (1.36 mmol) and oleylamine (3.2 g) were added to 15 mL of xylene. After stirring at room temperature for 24 hours, the mixture was then thawed at 2 °C for 1 min. -1 The solution was slowly heated to 90 °C, and then 1 mL of deionized water was rapidly injected with vigorous stirring. The resulting solution was stirred at 90 °C for 3 hours, and then 50 mL of ethanol was added to precipitate the nanoparticles. Cerium dioxide nanoparticles (CN) were collected by centrifugation. Next, the synthesized CN (15 mg), BMPA (2-bromo-2-methylpropionic acid, 2.99 mg), and citric acid (0.26 mg) were added to a mixture of chloroform and DMF (50 / 50 v / v, 15 mL), and the mixture was stirred at 30 °C for 6 hours. BMPA-terminated CN was collected by centrifugation. BMPA-terminated CN (15 mg), EDC (38.34 mg), and NHS (23.02 mg) were dispersed in 15 mL of deionized water, and the mixture was activated by stirring at room temperature for 30 minutes. Subsequently, 4 mL of CR9 (nonamericine) aqueous solution (10 mg / mL) was rapidly added dropwise to the above mixture, and then stirred at room temperature for another 6 hours. CR9-functionalized cerium dioxide nanoparticles (RCN) were collected by centrifugation and dispersed in deionized water for further use. The size distribution and surface charge of the prepared nanomaterials were determined using a Litesizer™ 500 nanoparticle size analyzer. Morphology and properties were characterized using a 300 kV transmission electron microscope.

[0050] 1.2 RCN's ·O 2- Scavenging activity

[0051] The ·O₂ of different concentrations (50, 100, 150, 200, 250 and 300 μg / mL) of RCN was determined by the NBT colorimetric method. 2- Scavenging activity was assessed. A Tris-HCl buffer (10 mM, pH 7.4) containing 6.5 mM L-methionine, 37.5 μM NBT, and 10 μM riboflavin was first prepared as the working solution. Different concentrations of gold nanoclusters (5, 25, 50, 75, 100, 120, 150, and 200 μg / mL) were then used. -1 After mixing thoroughly with the working solution, the mixture was protected from light and irradiated for 3 minutes with 254 nm ultraviolet light (60 W) in an ultraviolet crosslinker. NBT was then reacted with the generated O2. - It is converted to formazan. Formazan has a characteristic absorption at 560 nm; the absorbance of the reaction solution at 560 nm is measured immediately to calculate ·O2.- Clearance rate.

[0052] 1.3 Synthesis and Characterization of RCN-miRNA Complex

[0053] To determine the loading efficiency of miRNA on RCN, RCN and miRNA (miR122, sequence SEQ ID NO.1:CGCGTGGAGTGTGACAATGG) were mixed at mass ratios of 0:1, 0.5:1, 1:1, 2:1, 3:1, 4:1, and 5:1, respectively, with the mass of miRNA (5 μM, aqueous solution) remaining constant and only the mass of RCN being varied. The mixtures were then incubated at 37 °C on a benchtop shaker for 1 hour to promote the binding of miRNA to RCN via electrostatic interactions, forming RCN-miRNA complexes. The loading efficiency of miRNA on RCN was assessed by agarose gel electrophoresis. To prepare RCN-miRNA complexes with different RCN:miRNA ratios, miRNA (5 μM, aqueous solution) was mixed with different masses of RCN at mass ratios of 1:2, 1:4, 1:6, and 1:8, respectively, with the mass of miRNA remaining constant. The mixtures were then incubated at 37 °C on a benchtop shaker for 1 hour to obtain complexes, which were named G1, G2, G3, and G4, respectively. Individual miRNAs were labeled G0. Equal amounts and concentrations of RCN corresponding to G1-G4 were named g1, g2, g3, and g4, respectively.

[0054] 1.4 RCN-miRNA complex uptake assay

[0055] First, hADSCs are divided into 1×10 5 Cells were seeded at a density of 100 cells per well in 24-well plates and cultured at 37 °C and 5% CO2 for 24 h until adherence. Cy5-miRNA (G0) or RCN-Cy5-miRNA (G1, G2, G3, and G4) were co-incubated with hADSCs for 6 h, with identical miRNA mass in each group. The culture medium was then removed, and the cells were washed three times with 1×PBS. Cells were digested with trypsin, and the collected cells were analyzed by flow cytometry. Another batch of cells was collected using the same treatment method for staining experiments. The collected cell samples were fixed in 4% PFA solution and then stained with nuclear stain. After washing off the staining solution, the cells were observed and imaged.

[0056] 1.5 In vitro stem cell differentiation induction experiment using RCN-miRNA complex

[0057] hADSCs were cultured in stem cell culture media supplemented with G0, G1, G2, G3, and G4, respectively, as differentiation media. The miRNA concentration in all groups was 80 nM. The differentiation media were changed every 3 days. Cells were collected at different time points, and the expression levels of genes such as HNF4A, ALB, CYP3A4, AFP, CYP1A2, COXI, PPRC1, FOXA2, SOX17, CXCR4, PPARγ, PGC1-α, and TCF7L2 were detected at different time points using real-time quantitative PCR.

[0058] 1.6 Mitochondrial membrane potential detection

[0059] hADSCs cells were distributed at a rate of 2 × 10⁶ cells per well. 5 Cells were seeded at a density of [number] cells per well in 24-well plates and cultured for 24 hours to allow for full cell adhesion. Subsequently, the cells were incubated overnight with RCN (g1, g2, g3, and g4). The treated cells were then incubated for 24 hours with basal medium containing 500 μM H2O2. After incubation, the cells were stained with DAPI and the JC-1 probe. Imaging was performed using an inverted fluorescence microscope. Some cell samples were labeled with the JC-1 probe, digested with trypsin, and the cells were collected. Intracellular mitochondrial membrane potential was detected using flow cytometry.

[0060] 1.7 Effects of the RCN-miRNA complex on mitochondrial function

[0061] hADSCs cells were distributed at a rate of 2 × 10⁶ cells per well. 5 Cells were seeded at a density of [number] cells per well in 24-well plates and cultured for 24 hours to allow for full cell adhesion. Subsequently, the stem cells were co-cultured with g1, g2, g3, and g4 cells for 24 hours, respectively. After removing the supernatant, the cells were subjected to TCF7L2 immunofluorescence staining. A subset of cell samples were collected for TCF7L2 gene and protein expression level analysis.

[0062] 1.8 Modification and Characterization of Metal Polyphenol Network Structure

[0063] First, 120 μg / mL tannic acid (TA) solution and 70.3 μg / mL Ce(SO4)2 solution were prepared using 1×DPBS solution. Then, 2×10... 5hADSCs were seeded in 10 cm cell culture dishes and cultured until the cells adhered. Before cell modification, the cells were washed three times with 1×DPBS, then 1 mL of TA solution was added and gently shaken for 20 seconds. Next, 1 mL of Ce(SO4)2 solution was added and mixed thoroughly. The reaction was allowed to proceed for approximately 30 seconds. After the reaction, the reaction solution was washed away, and the cells were washed three times with 1×DPBS. Fresh cell culture medium was then added for further experiments. Cell viability before and after modification was assessed using the CCK8 assay and a cell viability assay kit. Modified cells were collected using 0.25% trypsin. Single-cell suspensions were stained with DiD and DAPI and observed under an inverted fluorescence microscope. Some suspension cell samples were graded dehydrated, lyophilized, fixed on silicon wafers, and the metallopolyphenol network structure on the cell membrane was characterized using scanning electron microscopy.

[0064] 1.9 Evaluation of the cell-protective effect of metallopolyphenol network structure

[0065] 2-NBDG uptake assay: Modified and unmodified stem cells were incubated with 2-NBDG (100 μM) at 37 °C for 30 min. After incubation, the cells were washed twice with DPBS, stained with DAPI, and observed using an inverted fluorescence microscope. Some cell samples were collected after trypsin digestion, and intracellular 2-NBDG uptake was detected by flow cytometry.

[0066] Hydrogen peroxide tolerance assay: Modified and unmodified stem cells were incubated for 30 minutes in different concentrations of H2O2 (100 μM, 250 μM, 500 μM, and 1 mM), and cell viability was measured using the CCK-8 assay. Cells treated with 250 μM hydrogen peroxide were stained with DCFH and subjected to live / dead cell staining. Intracellular ROS accumulation and cell viability were observed under an inverted fluorescence microscope.

[0067] 2.10 Construction and Treatment of Liver Failure Models

[0068] All in vivo animal experiments were reviewed and approved by the Ethics Committee of Sun Yat-sen University. A corn oil solution containing 30% CCl4 was prepared as a modeling agent and administered to mice via intraperitoneal injection at a dose of 5 μL / g. Modeling was successful after 24 hours, establishing a CCl4-induced ALF mouse model. Cell transplantation therapy was performed via intrasplenic injection, comparing the in vivo therapeutic effects of undifferentiated stem cells (hADSCs), G3-induced differentiated stem cells (iHLCs) (induction method as in 1.5, induction time 14 days), and metallopolyphenol network-modified iHLCs (MP-iHLCs) (operation as in 1.8). All mice were randomly divided into five groups (n = 5), with the following in vivo experimental protocols and treatment groups: I) healthy group; II) modeling group; III) hADSC treatment group; IV) iHLCs treatment group; V) MP-iHLCs treatment group. Each mouse was injected with 100 μL of PBS containing 100w cells. The healthy group received no treatment, while the modeling group received an equal volume of PBS. Mice were euthanized on the first day of treatment, and blood, liver, and other major organs were collected for subsequent evaluation of treatment effectiveness.

[0069] 2.11 Evaluation of the therapeutic effect of MP-iHLCs in a liver failure model

[0070] On the first day of treatment, the treatment effects of different treatment groups were evaluated.

[0071] (1) Serum detection: First, serum from mice in different treatment groups was collected. The levels of AST, ALT and ALB were detected by the Experimental Animal Center of Sun Yat-sen University.

[0072] (2) Detection of expression levels of inflammatory genes in liver tissue: Fresh livers of mice in different treatment groups were used for RNA extraction, and the mRNA expression levels of genes such as Ho1, Nqo1, Nox2, Il6, Nlrp3 and Tnfa were detected.

[0073] (3) Histological examination: Most liver tissue was fixed in 4% PFA, embedded in paraffin, and sections were used for tissue H&E staining, TUNEL staining, and immunofluorescence staining for HO-1, TNFA, and IL10 proteins. Cell (carried cell) samples or fresh frozen tissue sections were fixed in 4% PFA fixative at room temperature for 15 min, washed three times with 1×PBS, and then permeabilized and blocked. First, the samples were incubated with primary antibody overnight at 4 ℃. After incubation, the primary antibody incubation solution was removed, and the samples were washed three times with 1×PBS solution. The corresponding fluorescently labeled secondary antibody was added, and the samples were incubated at room temperature in the dark for 2 hours. After incubation, the secondary antibody incubation solution was removed, and the samples were washed three times with 1×PBS solution. DAPI staining solution (0.2 μg / mL) was added. -1Stain for 15 minutes, then wash three times with 1×PBS, and observe and image under an inverted fluorescence microscope or a confocal microscope.

[0074] (4) In vivo biosafety assessment:

[0075] (1) Serological detection: Serum from different groups of mice was collected, and serum biochemical indicators such as blood urea nitrogen (BUN) and lactate dehydrogenase (LDH) were measured to assess cardiac and renal function.

[0076] (2) Histological examination: The heart, spleen, lungs and kidneys of mice from different groups were collected, fixed with 4% PFA and stained with H&E.

[0077] 2.12 Extraction of non-parenchymal cells from the liver

[0078] Fresh liver tissue was collected from different groups of mice and digested with type IV collagenase at 37 °C for 30 minutes. The digested cells were then gently ground and filtered through a 40 μm mesh. The resulting filtrate was centrifuged at 50 g for 5 minutes at low temperature. Finally, the collected supernatant was centrifuged at 650 g for 5 minutes at 4 °C to obtain non-celled cells. All cells were purified by treatment with erythrocyte lysis buffer before staining. Cell suspensions were then prepared for flow cytometry analysis.

[0079] 2.13 Liver tissue transcriptome sequencing analysis

[0080] Transcriptome sequencing was performed on the livers of mice in different groups of a CCl4-induced liver failure model to evaluate the in vivo therapeutic effect. On day 1 of treatment, fresh liver tissue (n = 3) was collected from mice in groups I, II, and IV for transcriptome sequencing analysis. All data analyses were performed on the OmicStudio platform (https: / / www.omicstudio.cn / tool).

[0081] 2.14 RNA Extraction and Real-Time Quantitative PCR

[0082] RNA was extracted from cell or tissue samples using the FastPure® Cell / Tissue Total RNA Isolation Kit; real-time quantitative PCR was performed using the PreScript One-Step RT-qPCR SYBR Green Kit.

[0083] (1) Sample processing: Take about 10-20 mg of liver tissue sample and grind it in liquid nitrogen. Immediately transfer the powder ground in liquid nitrogen to Buffer RL and add 350 μl of Buffer RL for complete lysis; collect about 5 × 10⁻⁶ cells for cell samples. 6 Each cell was lysed by adding 500 μl of Buffer RL.

[0084] (2) RNA extraction: RNA extraction of cell samples was performed according to the FastPure® Cell / Tissue Total RNA Isolation Kit instructions. RNA extraction of tissue samples was performed according to the method described in Chapter 2.3.12.

[0085] (3) One-Step qRT-PCR reaction: Quantitative analysis was performed using the PreScript One-Step RT-qPCR SYBR Green Kit. The reaction system is shown in Table 1.

[0086] Table 1 One-Step qRT-PCR Reaction System

[0087] reagents Volume (μL) <![CDATA[RNase-free ddH2O]]> to 25 µL 2× One-Step RT-qPCR Buffer 12.5 μL C-SsoRobust Taq DNA Polymerase (5 U / μL) 0.5 μL Prescript Ⅲ RT Enzyme Mix 0.5 μL Forward Primer (10 μM) 0.5 μL Reverse Primer (10 μM) 0.5 μL Total RNA (10 pg ~ 100 ng) 2 μL

[0088] 2.15 Statistical Analysis

[0089] All data were analyzed and processed using GraphPad Prism software. Values ​​are expressed as mean ± standard deviation. Unless otherwise stated, all presented data are from replicate experiments with at least three independent samples. Appropriate statistical methods were used for data comparison, including Student's t-test, one-way ANOVA, or two-way ANOVA. *P < 0.05 was considered statistically significant, and ns indicated no statistically significant difference (*p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001).

[0090] 2. Experimental Results and Discussion

[0091] 2.1 Synthesis and Characterization of CN and RCN

[0092] Cerium nanozymes, due to their excellent biocompatibility and catalytic activity, are widely used in regenerative medicine and have been applied to treat ischemic vascular diseases, neurodegenerative diseases, and acute kidney injury. In this study, we selected cerium dioxide nanozymes as the delivery carrier for microRNA122 (miR122). First, we synthesized ultrasmall cerium oxide nanoparticles (CN) with a diameter of less than 5 nm using the reverse micelle method. Figure 1 B). Selected area electron diffraction (SAED) pattern of CN ( Figure 1 C) and element distribution map ( Figure 1 (D) These findings jointly verified the successful synthesis of cerium nanozymes. High-resolution transmission electron microscopy (HRTEM) images showed that CN exhibited high crystallinity, with clearly discernible lattice fringes and a crystal interplanar spacing of 0.3185 nm. Figure 1 E), and the corresponding SAED diffraction peak ( Figure 1 C) Consistent. X-ray photoelectron spectroscopy (XPS) analysis shows that the characteristic peaks of the Ce 3d orbitals in CN contain trivalent (Ce) orbitals. 3+ ) and tetravalent (Ce 4+ Mixed valence states of cerium Figure 1 F), this characteristic indicates that it has excellent redox catalytic activity. Subsequently, surface modification was performed. Oligoarginine (CR9) was modified onto the BMPA-terminated CN surface via EDC-NHS coupling reaction to obtain CR9-functionalized cerium oxide nanoparticles (RCN). Figure 1 A). The particle size of RCN is approximately 50.2 ± 8.1 nm ( Figure 1 G). HRTEM images of RCN show that its crystallinity was not altered by surface modification ( Figure 1 H). The appearance of the N 1s peak (corresponding to the amino group of CR9) in the XPS analysis of RCN also proves the successful modification of CR9. Figure 1 I).

[0093] 2.2 Preparation and Characterization of RCN-miRNA Complex

[0094] The surface potential of the RCN is approximately 28.2 ± 0.9 mV. Figure 3 A) can effectively load negatively charged miRNAs through electrostatic interactions. Gel retardation experiments showed that RCN at a 1:2 ratio can completely load miRNAs (A). Figure 2 A). Figure 2 The CCK8 results in B showed that RCN had little effect on stem cell viability, only slightly decreasing at high concentrations. By loading equal amounts of miRNA, we prepared a series of RCN-miRNA complexes (G1-G4) containing different RCN concentrations. Figure 2 A). G1-G4 all exhibit positive surface charge ( Figure 2 A), with a similar diameter, approximately 100 nm ( Figure 3 B, C).

[0095] We then used flow cytometry to evaluate the intracellular miRNA delivery efficiency of the RCN-miRNA complex. Figure 3Flow cytometry and fluorescence results at E and D showed that RCN significantly improved miRNA delivery efficiency compared to the free miRNA group, and there was no significant difference in uptake efficiency among different RCN-miRNA complexes. Meanwhile, Figure 3 The CCK8 results for F showed that none of the four ratios of RCN-miRNA complexes affected stem cell activity.

[0096] 2.3 In vitro induction of stem cell differentiation by RCN-miRNA complex

[0097] Subsequently, we investigated the potential of the RCN-mRNA complex in inducing liver differentiation of stem cells in vitro. For example... Figure 4 As shown, we examined the differentiation status of different groups on days 7 and 14 of differentiation. On day 7 of differentiation, HNF4A ( Figure 4 A) and ALB Figure 4 The expression levels of ALB in group B were 7.9-fold and 9.2-fold higher than those in undifferentiated cells, respectively. By day 14 of differentiation, the expression level of ALB gene in group G3 was upregulated to 11.7-fold. Figure 4 B). Furthermore, we found that differentiated cells in the G3 group showed higher expression of liver-related genes compared to other groups, including CYP3A4, AFP, and CYP1A2 (B). Figure 4 CE). Specifically, on days 7 and 14, the expression level of CYP1A2 in the G3 group increased significantly to 8.3 times and 45.0 times that of the undifferentiated group, respectively. Figure 4 E). Mitochondria remain in a low-activity state in undifferentiated stem cells. During cell differentiation, the number of mitochondria increases significantly to meet the energy requirements of various differentiation activities. Mitochondrial copy number was assessed by the ratio of mitochondrial DNA (COXI gene) to nuclear DNA (PPRC1 gene). We observed an increase in mitochondrial biogenesis on day 14 in all differentiation groups. Figure 4 F). Among them, the number of mitochondria in the G3 group of differentiated cells increased significantly on day 7, reaching 3.4 times that of the undifferentiated group, and 5.2 times that of the undifferentiated group on day 14. Figure 4 F). Mitochondria are the primary source of energy for cells and play a crucial role in ATP production, which is essential for supporting cell differentiation.

[0098] 2.4 RCN-miRNA complex enhances mitochondrial biogenesis to regulate stem cell differentiation

[0099] We further investigated the early stages of cell differentiation and found that the expression of several other genes, including FOXA2, SOX17, and CXCR4, showed a similar trend, with significantly higher expression levels in the G3 group than in other groups. Figure 5(AC). Based on previous experimental results, the four RCN-miRNA complexes carried equal amounts of miRNA into cells, and the four complexes had similar uptake efficiencies; however, drastically different differentiation efficiencies were observed. Figure 4 In the F results, we observed a higher mitochondrial copy number induced in the G3 group. It is well known that stem cell differentiation is a high-energy-consuming process. To ensure sufficient energy, stem cells undergo a metabolic shift from the less energy-efficient glycolysis pathway to the TCA cycle, thereby enhancing mitochondrial function.

[0100] Therefore, we further investigated the expression of key regulators of mitochondrial biosynthesis, PPARγ and PGC-1α, during differentiation. Figure 5 As shown in D and 5E, on day 7 of differentiation, PPARγ and PGC-1α were significantly upregulated in the G3 group compared to other groups. These results suggest that the higher differentiation efficiency may be due to enhanced mitochondrial function in the differentiated cells of the G3 group. These findings further indicate that mitochondrial biogenesis plays a crucial role in promoting stem cell differentiation.

[0101] However, the molecular mechanisms linking mitochondrial dynamics to differentiation regulation remain poorly understood. Hepatic transcription factors play a crucial role in regulating stem cell differentiation in the liver, and studies have reported that PGC-1α can co-activate multiple hepatic transcription factors, including HNF4-α. Figure 4 The results in group A also showed that RCN-miRNA induced increased HNF4-α expression compared to the undifferentiated group. These results suggest that PGC-1α may play a role in the co-regulation of mitochondrial biosynthesis and cell differentiation. Therefore, we conducted an in-depth study of TCF7L2, an upstream regulator of the interaction between hepatocyte differentiation and mitochondrial biosynthesis. Figure 5 As shown in F, compared with undifferentiated stem cells, TCF7L2 gene expression was suppressed in groups G1-G4. Figure 6 Similar results were observed in the immunofluorescence images of TCF7L2 in cells from different differentiation groups, showing that TCF7L2 expression in differentiated cells was significantly inhibited. These results suggest that an appropriate dose of RCN may inhibit TCF7L2 expression, thereby promoting mitochondrial function and synergistically regulating stem cell liver differentiation. Figure 5 G).

[0102] 2.5 RCN protects mitochondrial function from damage

[0103] ROS is an unavoidable byproduct of ATP production during oxidative phosphorylation. During differentiation, ATP synthesis increases significantly, and excessive ROS accumulation can damage proteins, lipids, and DNA. Therefore, maintaining a modifiable baseline ROS level is crucial for cell signaling and overall cellular function; maintaining appropriate ROS levels promotes faster cell differentiation.

[0104] The catalytic activity of RCN may help maintain redox homeostasis in stem cells, thereby promoting cell differentiation. Using the NBT staining method, we determined the ·O₂ content of RCN. 2- The scavenging ability was characterized. The superoxide anion scavenging ability of RCN increased with increasing concentration ( Figure 7 ).

[0105] We further investigated the protective effect of RCN on mitochondrial function. Different doses of RCN treatment (g1-g4) effectively alleviated hydrogen peroxide-induced mitochondrial oxidative stress and showed significant protective effects on mitochondria. Figure 8 A). ROS oxidative stress leads to a decrease in mitochondrial membrane potential, while increasing RCN concentration can effectively reverse mitochondrial depolarization and alleviate cellular oxidative stress damage. Figure 8 (B, C). The above results indicate that RCN can scavenge mtROS and restore mitochondrial function by regulating redox homeostasis. We hypothesize that RCN can promote stem cell differentiation by regulating redox homeostasis and enhancing mitochondrial biosynthesis in cells by scavenging excess ROS.

[0106] 2.6 RCN can inhibit TCF7L2 expression

[0107] Inhibition of the Wnt / β-catenin signaling pathway is crucial for early liver differentiation. TCF7L2 is also a downstream effector of the Wnt / β-catenin signaling pathway. We further investigated whether RCN alone possesses inhibitory activity against TCF7L2 in stem cells. We incubated stem cells with different groups of RCN (g1-g4) to investigate the effects of RCN on stem cells. After 24 hours of incubation, all RCN-treated groups showed rapid inhibition of the TCF7L2 gene. Figure 8 D). Immunofluorescence staining results for TCF7L2 also showed similar results ( Figure 9 Quantitative analysis of TCF7L2 and β-catenin proteins in g3 group cells also showed a significant inhibitory effect. These results indicate that RCN can regulate mitochondrial redox homeostasis and inhibit TCF7L2 expression, thereby enhancing the liver differentiation effect of stem cells.

[0108] 2.7 The protective effect of metal polyphenol network structure modification on cells

[0109] Finally, we selected G3-induced hepatocyte-like cells (iHLCs) for subsequent hepatocyte transplantation therapy. To enhance the cell transplantation effect, we modified the iHLCs with a metallopolyphenol network structure to protect cell viability and enhance in vivo therapeutic efficacy. This was achieved through the use of tannic acid (TA) and Ce... 4+ The coordination effect constructs the TA-Ce metal polyphenol network structure ( Figure 10 A). Live / dead staining and CCK8 assay results showed that TA-Ce modification had no significant effect on cell viability. Figure 11 A, B). SEM ( Figure 10 B) and brightfield image ( Figure 11 C) shows that the TA-Ce network structure partially covers the cell surface.

[0110] Next, the protective effect of metal polyphenol network structure modification on cells was evaluated in vitro under simulated oxidative damage conditions. The viability of unmodified cells decreased sharply with increasing H2O2 concentration, while cells modified with the TA-Ce network structure maintained near-intact cell viability under 0.1 mM H2O2 conditions. Figure 10 C), Figure 10 As can be seen from D, under stimulation with 500 μM hydrogen peroxide, the accumulation of ROS in the modified group cells was significantly reduced ( Figure 12 Shell permeability assays showed that modification of the TA-Ce network structure on the cell surface did not affect the cells' ability to take up glucose, and the modified cells exhibited similar permeability to the unmodified cells. Figure 10 E, F). These results indicate that TA-Ce modification effectively protects cells from exogenous damage and promotes cell survival, which has great potential for in vivo therapeutic applications.

[0111] 2.8 Therapeutic effects of MP-iHLCs in a liver failure model

[0112] Next, we evaluated the therapeutic effects of MP-iHLCs in an animal model of liver failure. Figure 13 A represents the grouping in the animal experiment. We compared the in vivo therapeutic effects of MP-iHLCs with undifferentiated cells and modified differentiated cells. Serological analysis showed that the levels of ALT, AST, and TBIL in all three treatment groups were significantly lower than those in the model group. Among them, the MP-iHLCs treatment group showed the best therapeutic effect. Figure 13 BD). Only the MP-iHLCs treatment group showed a statistically significant difference in TBIL levels ( Figure 13 D). Histological analysis of the liver after treatment and H&E staining results showed that after modeling, there was extensive necrosis of liver tissue, and MP-iHLCs treatment could effectively reduce the area of ​​liver tissue necrosis and reduce liver damage. Figure 13 E, F). TUNEL staining was used to observe the degree of liver damage. Significant hepatocyte apoptosis was observed in the model group, with TUNEL-positive cells accounting for 28.0% (E, F). Figure 13 F). Compared with the model group, apoptosis was alleviated in all treatment groups ( Figure 13 G). The MP-iHLCs group showed the lowest percentage of TUNEL-positive cells, approximately 6.0%, significantly lower than the hMSCs group (approximately 20.5%) and the iHLCs group (approximately 11.5%). Figure 13 H).

[0113] In addition, the expression of genes related to antioxidant function in liver tissue was detected. Figure 14 Results A and B showed that after treatment, the expression of both Ho1 and Nqo1 was effectively increased in the MP-iHLCs group. Immunofluorescence staining results for HO-1 are shown below. Figure 14 As shown in Figure D, HO-1 protein expression was significantly increased in the MP-iHLCs treatment group. Compared with the model group, Nqo1 expression increased 2.1-fold in the iHLCs group and 2.8-fold in the MP-iHLCs group. Figure 14 A). Nox2 gene expression was effectively downregulated in both iHLCs and MP-iHLCs groups. Figure 14 B). These results show that iHLCs treatment can effectively enhance the antioxidant function of hepatocytes and reduce ROS damage caused by oxidative stress. We observed that, compared with the iHLCs group, the MP-iHLCs group showed higher Ho1 and Nqo1 gene expression and lower Nox2 gene expression (B). Figure 14 (AC), which may be related to the antioxidant function of the TA-Ce structure itself.

[0114] 2.9 Anti-inflammatory effects of MP-iHLCs in a liver failure model

[0115] TA, a natural, multifunctional polyphenol compound, has been shown to have anti-inflammatory properties. We further evaluated the anti-inflammatory effects of MP-iHLCs in a liver failure model. Quantitative RT-PCR analysis of liver tissue showed that, compared with the model group, the inflammatory genes Il6, Nlrp3, and Tnfa were significantly downregulated in all three treatment groups. Figure 15 AC). Notably, compared to the iHLCs group, the MP-iHLCs group showed a further reduction in Nlrp3 expression (AC). Figure 15 B). Immunofluorescence staining was used to detect TNFA protein expression in tissues. Compared with the iHLCs group, the MP-iHLCs group showed lower TNFA expression (B). Figure 15 D) and higher IL10 expression ( Figure 16 ).

[0116] Non-parenchymal cells in the liver tissue of the model group and each treatment group were analyzed by flow cytometry. The results are as follows: Figure 17 As shown. Compared with the model group, the proportion of M1 pro-inflammatory macrophages was reduced in the treatment group ( Figure 17 A), along with the increase in the proportion of M2 type anti-inflammatory macrophages ( Figure 17 B). Furthermore, compared to the model group, all treatment groups showed lower neutrophil infiltration and accumulation (B). Figure 17 C). Overall, MP-iHLCs showed better anti-inflammatory effects than the iHLCs group. Figure 17 The results indicate that the TA-Ce metallopolyphenol network structure plays a certain therapeutic role in anti-inflammatory resolution. These results further demonstrate that the metallopolyphenol network structure can not only protect the viability of transplanted cells but also exert a certain therapeutic effect.

[0117] 2.10 Liver tissue transcriptome sequencing analysis

[0118] Finally, to further understand the treatment mechanism, we performed transcriptome sequencing analysis on livers from the healthy group, the model group, and the MP-iHLCs treatment group. Figure 18 As shown in Figure A, principal component analysis (PCA) revealed the differences in gene expression profiles among all detected genes in the three groups. The heatmap then displays the gene expression profiles of all differentially expressed genes in the three groups. Figure 18 B).

[0119] Comparison of differentially expressed genes between the healthy group and the model group revealed severe liver damage and a significant decline in liver function after modeling. Figure 19 GO enrichment analysis showed that lipid and fat metabolism pathways, bile acid synthesis and transport pathways, and mitochondrial function-related pathways were significantly downregulated in the model group. Figure 20 The KEGG enrichment analysis results also showed that, compared with the healthy group, the apoptosis pathway and the P53 signaling pathway in the liver of the model group were significantly upregulated, while the bile secretion-related pathway was significantly downregulated.

[0120] Next, we will focus on a detailed analysis of the differentially expressed genes among the three groups. Based on the cluster analysis of the expression level trends of the differentially expressed genes among the three groups, we selected six gene clusters with different trends, which were named cluster1, cluster2, cluster3, cluster4, cluster5, and cluster6, respectively. Figure 21 A). Cluster 2 represents a gene group whose expression was downregulated after induction of liver failure, and whose expression level returned to near normal in mice after treatment with MP-iHLCs. Figure 21A). Based on Reactome enrichment analysis, we enriched and categorized all genes in these six groups according to their functions or pathways. The analysis revealed that the gene population in cluster 2 is mainly involved in metabolism (…). Figure 21 B), cell cycle ( Figure 21 B) and mitochondrial translation ( Figure 22 A) and other functions. We screened several important genes related to liver function and regeneration from cluster 2 gene population, including Aox3, Fom1, Ugt2b1, Ugt2a3, Cyp1a2, Otc, Abcb11, Asl, Cyp2e1, Abcc2, Slc10a1, and Abcc3, etc. Figure 21 The heatmap-bubble chart of D visually illustrates the changes in these gene expression levels.

[0121] Cluster 4 genes are mainly involved in activities such as metabolism, ABC family protein-mediated transport, and cell cycle. Figure 21 B, C). Genes in Cluster 6 are primarily involved in metabolism, cell cycle, and TCA activity (B, C). Figure 21 B, C and Figure 22 A). Genes related to antioxidant and cell protection are mainly concentrated in clusters 1, 3, and 5 (A). Figure 22 B).

[0122] Figure 23 The Sankey-bubble plot of A shows the Reactome enrichment analysis results of differentially expressed genes among the three groups. It can be seen that liver failure damage is mainly manifested in the loss or disorder of hepatocyte metabolic function, including impaired drug metabolism, lipid metabolism, and decreased metabolic enzyme activity. These results suggest that MP-iHLCs treatment may restore liver function by regulating liver-specific biological functions, liver regeneration, energy metabolism, and antioxidant pathways.

[0123] Similarly, we performed GO enrichment and KEGG enrichment analyses to compare the model group and the treatment group. It can be seen that, compared with the model group, the treatment group showed significant upregulation of pathways such as angiogenesis, extracellular matrix, transmembrane transport protein activity, positive regulation of proliferation, cell differentiation, and lipid metabolism. Figure 23 B).

[0124] KEGG enrichment analysis showed that, compared with the model group, liver function-related pathways such as drug metabolism and bile acid synthesis were upregulated in the treatment group, while the apoptosis pathway showed a downregulation trend. Figure 24 These results confirm that MP-iHLCs restore liver function by activating liver regeneration-related signaling and antioxidant defense systems.

[0125] 3. Summary

[0126] Hepatocytes derived from stem cells show great potential as an alternative to liver transplantation. Hepatocyte transplantation treats liver failure by rapidly supporting liver function and promoting liver regeneration. However, guiding the specific differentiation of stem cells into functional hepatocytes in vitro remains a significant challenge. Furthermore, protecting the viability and function of transplanted cells to enhance therapeutic efficacy is also crucial for hepatocyte transplantation strategies. During stem cell differentiation, various life activities require a large supply of ATP to meet energy demands, leading to a significant increase in mitochondrial copy number and a shift in energy supply mode towards oxidative phosphorylation. With the increase in intracellular mitochondrial ATP levels, reactive oxygen species (ROS) are inevitably produced as byproducts. Intracellular ROS act as important signaling molecules; although excessive ROS can impair cell viability and organelle function, maintaining appropriate ROS levels is necessary and beneficial for maintaining cell function and plays a role in cell differentiation and proliferation. Previous studies have shown that catalytically active nanozymes can regulate stem cell differentiation, but their specific mechanisms of action remain unclear. To further investigate the potential mechanisms by which catalytically active nanozyme materials regulate stem cell fate, we surface-modified cerium nanozymes to deliver microRNA and induce stem cell differentiation into hepatocytes, and explored the molecular mechanisms by which cerium nanozymes regulate stem cell fate. Cerium oxide nanoparticles possess excellent catalytic activity and biosafety. Furthermore, the surface of cerium dioxide nanozymes is easily modified, endowing them with various functional properties for drug delivery. First, we surface-modified synthesized cerium dioxide nanozymes to load miRNA, obtaining a cerium nanozyme composite active material, RCN-miRNA, for regulating in vitro stem cell differentiation. During in vitro stem cell differentiation, we found that cerium nanozymes promoted cell differentiation by increasing mitochondrial biogenesis and regulating redox homeostasis, and exhibited an inhibitory effect on TCF7L2. TA possesses natural anti-inflammatory and antioxidant activities and can cross-link with Ce4+ through coordination to form a stable metal polyphenol material. Therefore, modifying the surface of hepatocytes obtained through in vitro induced differentiation with a TA-Ce backbone holds promise for enhancing cell transplantation efficacy. Finally, the therapeutic effect of the modified hepatocytes (MP-iHLCs) in a mouse model of liver failure was evaluated.

[0127] In summary, this chapter successfully constructed a cerium nanozyme composite material (RCN-miRNA) that can be used to induce stem cell differentiation into hepatocytes in vitro. During cell differentiation, cerium dioxide nanoparticles can efficiently deliver miRNA into stem cells, achieving directed stem cell differentiation by regulating hepatic differentiation-related pathways. Simultaneously, cerium dioxide also possesses biological activities that inhibit TCF7L2 expression and protect mitochondria, promoting mitochondrial biogenesis and replication by downregulating TCF7L2 expression, thus driving stem cell hepatic differentiation and enhancing differentiation efficiency. RCN-miRNA-induced hepatocytes were used for in vivo therapy. To enhance the viability and function of transplanted cells, their surface was modified with a metallopolyphenol network structure. In vivo experiments demonstrated that transplantation of hepatocytes modified with the metallopolyphenol network structure effectively alleviated oxidative stress and inflammatory responses in mice with liver failure, reduced tissue necrosis, and promoted cell proliferation, exhibiting good therapeutic effects. These findings not only reveal the intrinsic mechanism by which inorganic nanozymes regulate stem cell fate but also provide new insights into hepatic differentiation strategies, possessing potential clinical application value in the treatment of liver failure.

[0128] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A method for preparing a cerium nanozyme composite active material, characterized in that, Includes the following steps: (1) Synthesis of RCN: 1.3-1.4 mmol of cerium(III) acetate hydrate and 3-3.5 g of oleylamine were added to 10-20 mL of xylene. After stirring at room temperature for 22-26 hours, the mixture was heated to 88-92 °C at a rate of 1-3 °C / min. Then, 0.8-1.2 mL of deionized water was added, and the resulting solution was stirred at 88-92 °C for 2.5-3.5 hours. Then, 45-55 mL of ethanol was added to precipitate the nanoparticles. The cerium dioxide nanoparticles CN were collected by centrifugation. 14-16 mg of CN, 2.8-3.2 mg of 2-bromo-2-methylpropionic acid, and 0.2-0.3 mg of citric acid were added to a mixed solution of 14-16 mL of chloroform and DMF, wherein the volume ratio of chloroform to DMF was 0.8-1.2:0.8-1.

2. The mixture was then stirred at 28-32 °C. Stir at ℃ for 5-7 hours, centrifuge to collect CN with 2-bromo-2-methylpropionic acid end-capped, disperse 14-16 mg CN, 36-40 mg EDC and 21-25 mg NHS with 2-bromo-2-methylpropionic acid end-capped in 14-16 mL of deionized water, then activate the mixture by stirring at room temperature for 25-35 minutes, then add 3-5 mL of 8-12 mg / mL nonamericine CR9 aqueous solution dropwise to the above mixture, and stir at room temperature for another 5-7 hours, centrifuge to collect CR9-functionalized cerium dioxide nanoparticles RCN; (2) Synthesis of RCN-miRNA complex: The RCN and miR122 obtained in step (1) are mixed in water at a mass ratio of 1:5-7, wherein the concentration of miR122 is 4-6 μM, and then the mixture is incubated at 36-38 °C with shaking for 0.8-1.2 hours to obtain the RCN-miRNA complex, which is the cerium nanozyme composite active material.

2. The preparation method according to claim 1, characterized in that, In step (2), the mass ratio of RCN to miR122 is 1:

6.

3. The preparation method according to claim 2, characterized in that, In step (2), the concentration of miR122 is 5 μM.

4. A cerium nanozyme composite active material prepared by the preparation method according to any one of claims 1-3.

5. The application of the cerium nanozyme composite active material according to claim 4 in the preparation of stem cell differentiation inducers.

6. A method for preparing hepatocytes for treating liver failure, characterized in that, Includes the following steps: (1) The cerium nanozyme composite active material of claim 4 is added to a culture medium containing stem cells, wherein the concentration of miR122 is 70-90 nM, and the induction is performed for 13-15 days; (2) Wash the cells with 1×DPBS, then add 1 mL of tannic acid (TA) solution and shake for a few seconds, then add 1 mL of Ce(SO4)2 solution and mix well. React for 25-35 seconds, then wash away the reaction solution to obtain hepatocytes modified with metal polyphenol network structure. The concentration of the TA solution is 110-130 μg / mL, and the concentration of the Ce(SO4)2 solution is 65-75 μg / mL.

7. The preparation method according to claim 6, characterized in that, The induction time in step (1) is 14 days.

8. The preparation method according to claim 7, characterized in that, In step (2), the concentration of the TA solution is 120 μg / mL and the concentration of the Ce(SO4)2 solution is 70.3 μg / mL.

9. Hepatocytes prepared by the preparation method according to any one of claims 6-8.

10. The use of the hepatocyte-like cells according to claim 9 in the preparation of products for treating liver failure.

Citation Information

Patent Citations

  • Cerium oxide-zirconium oxide and arginine nano-composite medicine for targeting arterial vulnerable plaque microenvironment as well as preparation and application of cerium oxide-zirconium oxide and arginine nano-composite medicine

    CN118436804A

  • Injectable heterogeneous cascade nano-enzyme antibacterial hydrogel as well as preparation method and application thereof

    CN119818718A