Recombinant microorganism having modulated expression of alkyl hydroperoxide reductase and method for producing o-phosphoriene,

Abstract

The present disclosure relates to a recombinant microorganism in which the activity of an alkyl hydroperoxide reductase is modulated, and a method for producing O-phosphoserine, cysteine, and cysteine derivatives using the microorganism.

Description

Technical Field

[0001] This disclosure relates to a recombinant microorganism with regulated expression of alkyl hydroperoxide reductase, and a method for producing O-phosphoserine, cysteine ​​and cysteine ​​derivatives using the microorganism. Background Technology

[0002] L-cysteine ​​is an amino acid that plays an important role in sulfur metabolism in all organisms. It is used not only to synthesize biological proteins (such as hair keratin), glutathione, biotin, methionine and other sulfur-containing metabolites, but also as a precursor for coenzyme A biosynthesis.

[0003] Known methods in the art for producing L-cysteine ​​using microorganisms include: 1) a method for bioconverting D,L-2-aminothiazoline-4-carboxylic acid (D,L-ATC) into L-cysteine ​​using microorganisms; 2) a method for producing L-cysteine ​​by direct fermentation using Escherichia coli (EP0885962B; Wada M and Takagi H, Appl. Microbiol. Biochem., 73:48-54, 2006); and 3) a method for producing O-phosphoserine (hereinafter “OPS”) by fermentation using microorganisms, and then converting O-phosphoserine into L-cysteine ​​by reacting it with sulfides under the catalysis of O-phosphoserine sulfhydrylase (hereinafter “OPSS”) (US 8557549 B2), etc.

[0004] In particular, in order to produce cysteine ​​in high yield via method 3), the precursor OPS should be overproduced. Summary of the Invention

[0005] Technical issues

[0006] The technical problem of this disclosure is to provide a recombinant microorganism with regulated alkyl hydroperoxide reductase expression, and a method for using it to produce O-phosphoserine, cysteine ​​and cysteine ​​derivatives.

[0007] Technical solution

[0008] One object of this disclosure is to provide a recombinant microorganism that produces O-phosphoserine, wherein the activity of alkyl hydroperoxide reductase (Ahp) is enhanced compared to endogenous activity.

[0009] Another object of this disclosure is to provide a method for producing O-phosphoserine using the recombinant microorganisms for producing O-phosphoserine disclosed herein.

[0010] Another object of this disclosure is to provide a method for producing cysteine ​​or cysteine ​​derivatives using the recombinant microorganisms that produce O-phosphoserine as disclosed herein.

[0011] Beneficial effects

[0012] When O-phosphoserine is produced using the recombinant microorganisms of this disclosure (in which the activity of alkyl hydroperoxide reductase (Ahp) is enhanced compared to endogenous activity), O-phosphoserine can be produced in high yields compared to using existing unmodified strains. Detailed Implementation

[0013] This disclosure will now be described in detail. Furthermore, each description and embodiment disclosed herein can be applied to other descriptions and embodiments. That is, all combinations of the various elements disclosed herein fall within the scope of this disclosure. Moreover, the scope of this disclosure is not limited by the specific descriptions below. In addition, numerous papers and patent documents are cited throughout this specification. The contents of the cited papers and patent documents are incorporated herein by reference in their entirety and will more clearly describe the level of the technical field to which this disclosure pertains and the content of this disclosure.

[0014] One aspect of this disclosure provides a recombinant microorganism for producing O-phosphoserine, wherein the activity of alkyl hydroperoxide reductase (Ahp) is enhanced compared to endogenous activity.

[0015] As used herein, the term “O-phosphoserine (hereinafter “OPS”)” refers to the phosphate ester of serine, which is a component of many proteins. OPS is a precursor of L-cysteine ​​and can be converted to cysteine ​​by reaction with sulfides under the catalysis of OPS hydrogen sulfide hydrolase (hereinafter “OPSS”), but is not limited thereto (US2012-0190081A1).

[0016] As used herein, the term "alkyl hydroperoxide reductase (Ahp)" refers to enzymes that convert NADH to NAD. + An active protein. Alkyl hydroperoxide reductase can be used interchangeably with Ahp protein and Ahp.

[0017] The Ahp protein can be composed of alkyl hydroperoxide reductase subunit C (AhpC) and alkyl hydroperoxide reductase subunit F (AhpF). The amino acid sequences of AhpC or AhpF can be obtained from known databases such as NCBI GenBank.

[0018] In one instance, the AhpC or AhpF of this disclosure may be derived from a microorganism. The microorganism may specifically be derived from, but is not limited to, microorganisms of the genus *Escherichia*.

[0019] In another example, the amino acid sequence of AhpC disclosed herein may be UMQ15446.1 derived from *Escherichia coli* (E. coli), and the amino acid sequence of AhpF may be WP_000979839.1 derived from *E. coli*. Clearly, the amino acid sequences may include proteins from different sources possessing AhpC or AhpF activity. In one example, AhpC may be UMQ15446.1, EFF4225430.1, or WP_000052796.1, and AhpF may be NCBI accession number ANK05951.1, EFS6382721.1, or HCD8516410.1.

[0020] In this disclosure, AhpC may have, include, or consist of the amino acid sequence of SEQ ID NO:1, or may consist substantially of the above-described amino acid sequence. In this disclosure, AhpF may have, include, or consist of the amino acid sequence of SEQ ID NO:3, or may consist substantially of the above-described amino acid sequence.

[0021] In this disclosure, the amino acid sequence of AhpC may include an amino acid sequence having at least 70% or more, 75% or more, 76% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.5% or more, 99.7% or more, or 99.9% or more homology or identity with the amino acid sequence of SEQ ID NO:1. In this disclosure, the amino acid sequence of AhpF may include an amino acid sequence having at least 70% or more, 75% or more, 76% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.5% or more, 99.7% or more, or 99.9% or more homology or identity with the amino acid sequence of SEQ ID NO:3. Furthermore, it is evident that any protein having partially deleted, modified, substituted, conservedly substituted, or added amino acid sequences may also fall within the scope of this disclosure, provided that the amino acid sequences exhibit such homology or identity and demonstrate efficacy corresponding to proteins including the amino acid sequences of SEQ ID NO:1 and / or 3. In one example, AhpC may consist of 187 to 193 amino acids, including the amino acid sequence of SEQ ID NO:1. In another example, AhpF may consist of 521 to 531 amino acids, including the amino acid sequence of SEQ ID NO:3.

[0022] For example, it could be a sequence addition, naturally occurring mutation, its silent mutation, or a conserved substitution that does not alter the function of the protein disclosed herein, within the N-terminus, C-terminus, and / or amino acid sequence.

[0023] As used herein, the term "conservative substitution" refers to the replacement of an amino acid with another amino acid having similar structure and / or chemical properties. Such amino acid substitutions can typically occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphiphilicity of the residues. Generally, conserved substitutions have little or no effect on the activity of the protein or peptide.

[0024] As used herein, the terms “homology” or “identity” refer to the degree of correlation between two given amino acid sequences or nucleotide sequences and can be expressed as a percentage. The terms homology and identity are generally used interchangeably.

[0025] Sequence homology or identity of conserved polynucleotides or polypeptides can be determined by standard alignment algorithms, and can be used together with default gap penalties established by the program used. Essentially, homologous or identical sequences are generally expected to hybridize with all or part of the sequence under moderate to highly stringent conditions. Obviously, hybridization with polynucleotides containing universal or degenerate codons is also included.

[0026] Whether any two polynucleotide or polypeptide sequences are homologous, similar, or identical can be determined by a known computer algorithm such as the “FASTA” program, using the default parameters in Pearson et al. (1988) Proc. Natl. Acad. Sci. USA 85:2444. Alternatively, it can be determined by the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), which uses the following execution: Needleman program (version 5.0.0 or later) in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (GCG package (Devereux, J. et al., Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, SF et al., J MOLECBIOL 215: 403 (1990); Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994, and CARILLO et al. (1988) SIAM J Applied Math (48:1073). For example, BLAST or ClustalW from the National Center for Biotechnology Information can be used to determine homology, similarity, or identity.

[0027] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information using computer programs such as GAP, as disclosed in Needleman et al. (1970), J Mol Biol. 48:443, and Smith and Waterman, Adv. Appl. Math (1981) 2:482. In summary, the GAP program defines homology, similarity, or identity as a value obtained by dividing the number of similar alignment symbols (i.e., nucleotides or amino acids) by the total number of symbols in the shorter sequence of the two sequences. The default parameters of the GAP procedure may include: (1) a binary comparison matrix (including a value of 1 for identity and a value of 0 for non-identity) and a weighted comparison matrix (or an EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix) as disclosed in Atlas Of Protein Sequence And Structure, edited by Schwartz and Dayhoff, National Biomedical Research Foundation, pp. 353-358 (1979); (2) a penalty of 3.0 per vacancy and an additional penalty of 0.10 per symbol in each vacancy (or a penalty of 10 for vacancy opening and 0.5 for vacancy extension); and (3) no penalty for terminal vacancy.

[0028] The AhpC and AhpF disclosed herein can be encoded by the ahpCF operon gene.

[0029] As used herein, an "operon" refers to a functional unit of DNA that comprises a group of genes whose expression is regulated by a single expression regulatory sequence, specifically a single promoter. The mRNA transcribed from an operon can be a polycistronic mRNA, in which a single mRNA molecule encodes one or more proteins, or a monocistronic mRNA, in which a single mRNA molecule encodes one protein.

[0030] "ahpCF operon gene" can be used interchangeably with "ahpCF operon", "ahpCF gene" or "ahp gene".

[0031] The ahpCF operon gene can include the ahpC gene and the ahpF gene.

[0032] In one instance, the ahpC gene may be a polynucleotide encoding UMQ15446.1 or part of CP101971.1 from Escherichia coli, and the ahpF gene may be a polynucleotide encoding WP_000979839.1 from Escherichia coli, but the genes are not limited to these, and may include ahpC and / or ahpF genes encoding proteins from various sources that have AhpC and / or AhpF activities.

[0033] As used herein, the term "polynucleotide" is a polymer of nucleotides composed of nucleotide monomers linked together by covalent bonds to form a long chain, which is a DNA or RNA chain of at least a certain length. More specifically, it can refer to a polynucleotide segment that encodes a protein.

[0034] The polynucleotide encoding Ahp of this disclosure may include a nucleotide sequence encoding the amino acid sequence of SEQ ID NO:1 and / or 3. In one example of this disclosure, the polynucleotide may have or include the nucleotide sequence of SEQ ID NO:2 and / or 4. Furthermore, the polynucleotide of this disclosure may consist of or substantially consist of the nucleotide sequence of SEQ ID NO:2 and / or 4. Specifically, Ahp may be encoded by the polynucleotide shown in the nucleotide sequence of SEQ ID NO:2 and / or 4.

[0035] Due to codon degeneracy or considering preferred codons in the organism to which Ahp is to be expressed, the polynucleotides of this disclosure can be modified in various ways in the coding region without altering the amino acid sequence of Ahp. Specifically, the polynucleotides of this disclosure may have or include nucleotide sequences having 70% or more, 75% or more, 76% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity with the sequences of SEQ ID NO:2 and / or 4, or may consist of or substantially consist of nucleotide sequences having 70% or more, 75% or more, 76% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity with the sequences of SEQ ID NO:2 and / or 4, but are not limited thereto.

[0036] Furthermore, the polynucleotides disclosed herein may include probes that can be prepared from known gene sequences, such as any polynucleotide sequence that can hybridize with all or part of the complementary sequence of the polynucleotide sequence disclosed herein under stringent conditions, without limitation. “Stringent conditions” refers to conditions that enable specific hybridization between polynucleotides. Such conditions are disclosed in detail in the literature (see J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Usubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). For example, stringent conditions may include: polynucleotides with high homology or identity, i.e., polynucleotides with 70% or more, 75% or more, 76% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity, hybridizing with each other, while polynucleotides with lower homology or identity do not hybridize with each other; or may include typical Southern hybridization washing conditions, i.e., washing once, particularly two to three times, at a salt concentration and temperature corresponding to 60°C, 1×SSC, 0.1% SDS, specifically 60°C, 0.1×SSC, 0.1% SDS, more specifically 68°C, 0.1×SSC, 0.1% SDS.

[0037] Hybridization requires two nucleic acids to have complementary sequences, although mismatches between bases are possible depending on the strictness of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Therefore, the polynucleotides of this disclosure may also include isolated nucleic acid fragments complementary to the whole sequence, as well as nucleic acid sequences substantially similar to them.

[0038] Specifically, T can be used. m The hybridization conditions, with a value of 55°C, were used to detect polynucleotides homologous or identical to those disclosed herein under the conditions described above. Furthermore, T... m The value can be 60°C, 63°C or 65°C, but is not limited to these, and can be appropriately adjusted by those skilled in the art for their purposes.

[0039] The appropriate stringency of hybrid polynucleotides depends on the length and complementarity of the polynucleotides, and these variables are well known in the art (e.g., J. Sambrook et al., above).

[0040] Furthermore, as mentioned above, an operon is a group of genes whose expression is regulated by a single promoter, and the expression of ahpC and ahpF in the ahpCF operon can be regulated by the ahpC promoter. Therefore, in one embodiment of this disclosure, the ahpCF operon promoter (ahp operon promoter) can be the ahpC promoter.

[0041] As used herein, the term "vector" refers to a DNA construct containing a nucleotide sequence encoding a target protein, which is operatively linked to a suitable expression regulatory sequence to enable expression of the target protein in a suitable host cell. The expression regulatory sequence may include a promoter capable of initiating transcription, any operon sequence regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and sequences regulating transcription and translation termination. Once transformed into a suitable host cell, the vector can replicate or function independently of the host genome, or it can integrate into its genome.

[0042] There are no particular limitations on the vectors used in this disclosure, as long as they can replicate in host cells, and any vector known in the art can be used. Examples of commonly used vectors can include natural or recombinant plasmids, granules, viruses, and phages. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or granule vectors; those based on pDZ, pBR, pUC, pBluescriptII, pGEM, pTZ, pCL, and pET can be used as plasmid vectors. Specifically, vectors such as pSKH130 (US Patent Application Publication No. 2020-0048619), pSK, pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, and pCC1BAC can be used.

[0043] Insertion of the polynucleotide into the chromosome can be performed by any method known in the art, such as homologous recombination, but is not limited thereto.

[0044] As used herein, the term "transformation" refers to the introduction of a recombinant vector containing a polynucleotide encoding a target protein into a host cell, thereby enabling the expression of the protein encoded by said polynucleotide in the host cell. It is not important whether the transformed polynucleotide is integrated into and located within or outside the host cell's chromosome, as long as the transformed polynucleotide can be expressed in the host cell; both are acceptable. Methods for transforming vectors include any method of introducing nucleic acids into cells and can be performed by selecting appropriate standard techniques known in the art based on the host cell. For example, transformation can be performed by electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) technology, DEAE-dextran technology, cationic liposome technology, lithium acetate-DMSO technology, etc., but is not limited to these methods.

[0045] Furthermore, as used herein, the term "operably ligated" refers to the functional ligation of a polynucleotide sequence to a promoter sequence or expression regulatory region that initiates and mediates transcription of the polynucleotide encoding the target protein of this disclosure. Operable ligations can be prepared using gene recombination techniques known in the art, and site-specific DNA cutting and ligation can be prepared using, but are not limited to, cutting enzymes and ligases known in the art.

[0046] The microorganisms disclosed herein are not limited by type, as long as they can produce OPS, and can be any prokaryotic or eukaryotic microorganism, specifically, prokaryotic microorganisms. In one instance, it may include strains of microorganisms belonging to the genera *Escherichia*, *Erwinia*, *Serratia*, *Providencia*, *Corynebacterium*, and *Brevibacterium*, specifically microorganisms belonging to the genus *Escherichia*, more specifically, *Escherichia coli*, but not limited thereto. For example, in the case of microorganisms belonging to the genus Escherichia, OPS and L-serine can be produced by SerA, SerC and SerB, which are enzymes in the L-serine biosynthesis pathway (Ahmed Zahoor, Computational and structural biotechnology journal, vol 3, October 2012; Wendisch VF et al., Curr Opin Microbiol. June 2006; 9(3):268-74; Peters-Wendisch P et al., Appl Environ Microbiol. November 2005; 7 1(ll):7 139-44).

[0047] As used herein, the term "O-phosphoserine (OPS) producing microorganism" refers to a microorganism with the natural ability to produce O-phosphoserine, or a microorganism in which the ability to produce O-phosphoserine has been conferred upon a parent strain that does not have the ability to produce O-phosphoserine. Specifically, the microorganism can be an OPS producing microorganism with enhanced Ahp activity due to natural or artificial genetic modification. For the purposes of this disclosure, an OPS producing microorganism can be any microorganism capable of producing O-phosphoserine by enhancing Ahp activity using the methods disclosed herein. As used herein, "O-phosphoserine (OPS) producing microorganism" may be used interchangeably with "microorganism producing O-phosphoserine (OPS)" or "microorganism with the ability to produce O-phosphoserine."

[0048] In one embodiment, the OPS-producing microorganism of this disclosure may be a genetically modified microorganism or a recombinant microorganism, wherein the activity of Ahp is enhanced, thereby increasing the desired OPS production capacity, but is not limited thereto. The recombinant microorganism may be a microorganism with enhanced O-phosphoserine production capacity compared to endogenous O-phosphoserine production capacity.

[0049] The microorganisms disclosed herein may have increased Ahp activity compared to the endogenous activity of Ahp. Specifically, the microorganisms disclosed herein may be microorganisms in which Ahp or the ahpCF operator gene encoding it is enhanced; or microorganisms that have been genetically modified to enhance Ahp or the ahpCF operator gene encoding it (e.g., recombinant microorganisms), but are not limited thereto.

[0050] As used herein, “enhancement” of the term polypeptide (e.g., protein specified by the name of each enzyme) refers to an increase in the activity of the polypeptide compared to its endogenous activity. Enhancement can be used interchangeably with terms such as activation, upregulation, overexpression, and increase. Specifically, activation, enhancement, upregulation, overexpression, and increase can include both exhibiting activity not originally present, or activity enhanced compared to endogenous or unmodified activity. “Endogenous activity” refers to the activity of a specific polypeptide originally present in the unmodified parental strain or unmodified microorganism when the trait is altered through genetic modification caused by natural or artificial factors, and can be used interchangeably with “unmodified activity.” “Enhancement,” “upregulation,” “overexpression,” or “increase” of polypeptide activity compared to its endogenous activity means that the activity and / or concentration (expression level) of the polypeptide is enhanced compared to the specific polypeptide originally present in the unmodified parental strain or unmodified microorganism.

[0051] Enhancement can be achieved by introducing exogenous peptides or by increasing the activity and / or concentration (expression level) of endogenous peptides. Enhancement of peptide activity can be confirmed by an increase in peptide activity level, expression level, or the amount of the peptide's secreted product.

[0052] For the purposes of this disclosure, the microorganisms of this disclosure possess enhanced Ahp activity, thereby enhancing OPS production capacity. The unmodified microorganisms without enhanced Ahp activity (which are the target strains used to compare OPS production capacity or increased Ahp activity) may be CA07-0012 (KCCM 11121P, US 8557549B2), an OPS-producing strain in which endogenous phosphatase (SerB) is missing, thus weakening OPS degradation capacity, and strain (CA07-4821 of this disclosure), in which the expression of YhhS, which has OPS export capacity, is enhanced in strain CA07-0012, but not limited thereto.

[0053] Enhancement of peptide activity can be achieved by a variety of methods well known in the art, and the method is not limited as long as it enhances the activity of the target peptide compared to the unmodified microorganism. Specifically, genetic engineering and / or protein engineering, which are well known to those skilled in the art and are routine methods in molecular biology, can be used, but the methods are not limited thereto (e.g., Sitnicka et al., Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16; Sambrook et al., Molecular Cloning 2012, etc.).

[0054] Specifically, the enhanced activity of the polypeptides disclosed herein can be achieved through the following:

[0055] 1) Increase the copy number of polynucleotides encoding polypeptides within cells;

[0056] 2) Modify the expression regulatory sequences of genes encoding polypeptides on chromosomes;

[0057] 3) Modify the nucleotide sequence or 5'-UTR of the transcription of the gene encoding the polypeptide;

[0058] 4) Modifying the amino acid sequence of a polypeptide enhances its activity;

[0059] 5) Modifying the polynucleotide sequence encoding the polypeptide enhances the polypeptide activity (e.g., modifying the polynucleotide sequence of a polypeptide gene to encode the modified polypeptide to enhance polypeptide activity);

[0060] 6) Introduce exogenous peptides that exhibit peptide activity or exogenous polynucleotides encoding such peptides;

[0061] 7) Codon optimization for polynucleotides encoding polypeptides;

[0062] 8) Analyze the tertiary structure of the peptide and thereby select and modify the exposed sites or chemically modify them;

[0063] 9) Regulating the cellular localization of peptides; or

[0064] 10) Selected from two or more of the above 1) to 9), but not specifically limited thereto.

[0065] More specifically,

[0066] 1) Increasing the copy number of polynucleotides encoding polypeptides within cells can be achieved by introducing a vector into a host cell that is operatively linked to the polynucleotide encoding the polypeptide and is capable of replicating and functioning independently of the host cell. Alternatively, this can be achieved by introducing one or two copies of the polynucleotide encoding the polypeptide into the chromosome of the host cell. Introduction into the chromosome can be accomplished by introducing a vector capable of inserting the polynucleotide into the host cell's chromosome, but is not limited to this method.

[0067] 2) Replacing the expression regulatory region (or expression regulatory sequence) of a gene encoding a polypeptide on a chromosome with a highly active sequence can be achieved, for example, by introducing modifications to the sequence through deletion, insertion, non-conservative substitution, or conserved substitution, or a combination thereof, to further enhance the activity of the expression regulatory region, or by replacing the sequence with a more active sequence. The expression regulatory region may include, but is not specifically limited to, promoters, operon sequences, sequences encoding ribosome binding sites, and sequences regulating transcription and translation termination. This method may specifically include, but is not limited to, inserting a strong promoter downstream of the original promoter.

[0068] Examples of known strong promoters may include CJ1 to CJ7 promoters (US 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, λ phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13(sm3) promoter (US10584338 B2), O2 promoter (US10273491 B2), tkt promoter, yccA promoter, rmf promoter, serC promoter, etc., but strong promoters are not limited to these.

[0069] 3) Modifying the nucleotide sequence or 5'-UTR of the transcript encoding the start codon of the gene encoding the polypeptide can be achieved, for example, by replacing the nucleotide sequence with a nucleotide sequence encoding another start codon, which has a higher polypeptide expression rate than the endogenous start codon, but is not limited thereto.

[0070] 4) and 5) The methods of modifying amino acid sequences or polynucleotide sequences can be achieved by inducing sequence modifications to enhance the activity of the polypeptide through deletion, insertion, non-conservative or conserved substitution, or a combination thereof, of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide, or by replacing the sequence with a modified amino acid sequence or polynucleotide sequence that has stronger activity, or a modified amino acid sequence or polynucleotide sequence that enhances activity, but are not limited thereto. Specifically, substitution can be achieved by inserting polynucleotides into the chromosome through homologous recombination, but is not limited thereto.

[0071] The vectors used in this paper may also contain selection markers to confirm insertion into the chromosome. Selection markers are used to select cells to be transformed by the vector; that is, to confirm the insertion of the gene to be introduced. Markers that provide selectable phenotypes (such as drug resistance, auxotrophic phenotypes, cytotoxic agent resistance, or surface protein expression) can be used, but are not limited to these. Furthermore, only cells expressing the selection markers can survive or exhibit different phenotypes under conditions treated with the selection agent, thus allowing for the selection of transformed cells.

[0072] 6) The method of introducing exogenous polynucleotides exhibiting peptide activity can be achieved by introducing exogenous polynucleotides encoding peptides exhibiting the same or similar activity as the peptide into host cells. Exogenous polynucleotides can be used without restriction, regardless of their source or sequence, as long as they exhibit the same or similar activity as the peptide. Introduction can be carried out by transformation methods known in the art, appropriately selected by those skilled in the art, and the expression of the introduced polynucleotide in the host cells can produce a peptide, thereby enhancing its activity.

[0073] 7) Codon optimization of polynucleotides encoding polypeptides can be achieved by: optimizing the codons of endogenous polynucleotides to increase transcription or translation within the host cell, or by optimizing the codons to enable optimized transcription and translation of exogenous polynucleotides within the host cell.

[0074] 8) Methods for analyzing the tertiary structure of a polypeptide and thereby selecting and modifying exposed sites or chemically modifying them can be achieved by, for example, comparing the sequence information of the polypeptide to be analyzed with a database storing known protein sequence information to determine template protein candidates based on the degree of sequence similarity, and thus confirming the structure based on this information, thereby selecting and transforming or modifying exposed sites to be modified or chemically modified.

[0075] 9) Methods for regulating the cellular localization of peptides can be achieved by targeting the peptide to specific organelles or specific spaces within the cell. For example, this can be achieved by adding or removing a leader sequence that functions in the targeting peptide, thus targeting the periplasm or cytoplasm, but is not limited to this.

[0076] In one implementation, the enhancement of protein activity can be achieved by modifying the expression regulatory region of the gene encoding the polypeptide on the chromosome as described in 2) above.

[0077] In any of the above embodiments, the enhancement of Ahp activity disclosed herein may be an increase in the expression of the gene encoding Ahp. In any of the above embodiments, the enhancement of Ahp activity may include a gene expression regulatory sequence with enhanced activity upstream of the gene encoding it. Specifically, the upstream of the gene encoding Ahp may be upstream of the ahpC gene. In one embodiment, the enhancement of Ahp activity may be achieved by enhancing the expression of the gene sequence by modifying the expression regulatory sequence of the ahpC gene. Specifically, the modification of the expression regulatory sequence may involve the additional insertion of a gene expression regulatory sequence with enhanced activity between the endogenous promoter and the ahp operon gene of the ahpC gene; for example, the gene expression regulatory sequence may be a promoter, but is not limited thereto.

[0078] In any of the above embodiments, the enhancement of Ahp activity of this disclosure may be an enhancement of the activity of any one or more proteins selected from AhpC and AhpF.

[0079] This enhancement of peptide activity may mean an increase in the activity or concentration of the corresponding peptide relative to the activity or concentration of the peptide expressed in the wild-type strain or the unmodified microbial strain, or an increase in the amount of product produced by the peptide, but is not limited thereto.

[0080] As used herein, the terms "pre-modification strain" or "pre-modification microorganism" do not exclude strains containing mutations that may occur naturally in microorganisms, and can refer to the natural strain itself, or the strain before its traits are altered due to genetic modifications caused by natural or artificial factors. In this disclosure, the alteration of traits can be an enhancement of Ahp activity. "Pre-modification strain" or "pre-modification microorganism" may be used interchangeably with "unmutated strain," "unmodified strain," "unmutated microorganism," "unmodified microorganism," or "reference microorganism."

[0081] The modification of some or all polynucleotides in microorganisms disclosed herein can be achieved by: (a) homologous recombination using a vector for chromosomal insertion in microorganisms or genome editing using engineered nucleases (e.g., CRISPR-Cas9), and / or (b) by induction by light such as ultraviolet light and irradiation and / or chemical treatment, but is not limited thereto. Methods for modifying some or all genes can include methods using DNA recombination technology. For example, some or all genes can be deleted by inducing homologous recombination by injecting a nucleotide sequence or vector containing a nucleotide sequence homologous to the target gene into a microorganism. The injected nucleotide sequence or vector may contain a dominant selection marker, but is not limited thereto.

[0082] The microorganisms disclosed herein may be microorganisms with enhanced OPS production capabilities.

[0083] For the purposes of this disclosure, the recombinant microorganisms of this disclosure may be, but are not limited to, microorganisms that enhance the OPS production capacity of natural wild-type microorganisms or OPS-producing microorganisms (which contain Ahp or polynucleotides encoding the protein) by increasing the Ahp or polynucleotides encoding the protein in them compared to natural wild-type microorganisms or OPS-producing microorganisms (which contain Ahp or polynucleotides encoding the protein). For example, natural wild-type microorganisms or OPS-producing microorganisms (which contain Ahp or polynucleotides encoding the protein) may be target strains used to compare the increase in OPS production capacity or Ahp activity.

[0084] In one instance, a recombinant strain with increased OPS production capacity compared to the parental strain before modification or the unmodified microorganism may have an increase of about 1% or more, specifically about 2% or more, about 3% or more, about 3.2% or more, about 4% or more, about 4.4% or more, about 5% or more, about 6% or more, about 7% or more, about 8% or more, about 9% or more, or about 10% or more (there is no particular upper limit, such as about 200% or less, about 150% or less, about 100% or less, about 50% or less, about 40% or less, about 30% or less, about 20% or less, or about 15% or less), but is not limited thereto, as long as there is a positive increase compared to the production capacity of the parental strain before modification or the unmodified microorganism. In another instance, compared to the OPS production capacity of the parental strain before modification or the unmodified microorganism, the microorganism with increased OPS production capacity may have an increased OPS production capacity of about 1.01 times or more, about 1.02 times or more, about 1.03 times or more, about 1.032 times or more, about 1.04 times or more, about 1.044 times or more, about 1.05 times or more, about 1.06 times or more, about 1.07 times or more, about 1.08 times or more, about 1.09 times or more, or about 1.10 times or more (there is no particular upper limit, for example, about 10 times or less, about 5 times or less, about 3 times or less, or about 2 times or less), but is not limited thereto.

[0085] The production capacity can be assessed by measuring the yield of the desired product obtained from cultivation in the culture medium. The yield of the desired product can be assessed using suitable methods known in the art. For example, HPLC (High Performance Liquid Chromatography), GC (Gas Chromatography), GC / MS (Gas Chromatography-Mass Spectrometry), LC / MS (Liquid Chromatography-Mass Spectrometry), GPC (Gel Permeation Chromatography), or combinations thereof can be used, and the yield of the desired product can be measured using suitable methods known in the art.

[0086] The microorganisms disclosed herein may further enhance the ability to produce OPS and / or export OPS from cells; or may include modifications that enhance the ability to decompose and / or import OPS.

[0087] Examples of modifications that enhance the ability to produce and / or export OPS from cells; or enhance the ability to break down and / or import OPS may include, but are not limited to, attenuating the activity of phosphoserine phosphatase (SerB); enhancing the activity of phosphoserine export protein (YhhS); or combinations of these modifications.

[0088] As used herein, the term “attenuation” of peptide activity is a broad concept, encompassing reduced or absent activity compared to its intrinsic activity. Attenuation can be used interchangeably with terms such as inactivation, lack, downregulation, reduction, decrease, and weakening.

[0089] Attenuation can also include: a decrease or elimination of peptide activity compared to the original peptide activity of the microorganism due to mutations in the polynucleotide encoding the peptide; a decrease in the overall level of intracellular peptide activity and / or concentration (expression level) compared to the natural strain due to inhibition of gene expression of the polynucleotide encoding the peptide or inhibition of translation into the peptide; complete absence of polynucleotide expression; and / or no observation of peptide activity even when polynucleotides are expressed. As used herein, the term "endogenous activity" refers to the activity of a specific peptide originally present in the parental strain, wild-type, or unmodified microorganism before transformation, when the trait is altered by genetic modification caused by natural or artificial factors, and can be used interchangeably with "pre-modification activity." The description of peptide activity as "attenuated, inactivated, lacking, reduced, downregulated, decreased, or weakened" compared to its endogenous activity means that the peptide activity is reduced compared to the activity of a specific peptide originally present in the parental strain or unmodified microorganism before transformation.

[0090] The attenuation of peptide activity can be achieved by any method known in the art, but is not limited to this method, and can be achieved by applying a variety of methods well known in the art (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014; 15(2):2773-2793; Sambrook et al., Molecular Cloning 2012; etc.).

[0091] Specifically, the reduction of peptide activity disclosed herein can be achieved through the following:

[0092] 1) Missing part or all of the gene encoding the polypeptide;

[0093] 2) Modify the expression regulatory region (expression regulatory sequence) to reduce the expression of the gene encoding the polypeptide;

[0094] 3) Modify the amino acid sequence that makes up the polypeptide to eliminate or weaken the polypeptide activity (e.g., by deleting / replacing / adding one or more amino acids in the amino acid sequence);

[0095] 4) Modify the gene sequence encoding the polypeptide to eliminate or reduce the polypeptide activity (e.g., delete / replace / add one or more nucleotides in the nucleotide sequence of the polypeptide gene to encode the modified polypeptide to eliminate or reduce the polypeptide activity).

[0096] 5) The nucleotide sequence of the gene transcript encoding the polypeptide that modifies the start codon, the Shine-Dalgarno (SD) sequence, or the 5'-UTR;

[0097] 6) Introduce antisense oligonucleotides (e.g., antisense RNA) that bind complementary to the gene transcript encoding the polypeptide;

[0098] 7) A sequence complementary to the Shine-Dalgarno (SD) sequence of the gene encoding the polypeptide is added to the front of the SD sequence to form a secondary structure, thereby inhibiting ribosome attachment;

[0099] 8) Reverse transcription engineering (RTE), which adds the promoter to be reverse transcribed to the 3' end of the open reading frame (ORF) of a gene sequence encoding a polypeptide;

[0100] 9) Regulating the cellular localization of peptides; or

[0101] 10) A combination of two or more of the methods 1) to 9) above, but not specifically limited thereto.

[0102] For example,

[0103] 1) The method of deleting part or all of the gene encoding the polypeptide can be achieved by deleting all polynucleotides encoding the endogenous target polypeptide within the chromosome, or by replacing the polynucleotide with a polynucleotide that has partially deleted the nucleotide or by replacing the polynucleotide with a marker gene.

[0104] 2) Modification of the expression regulatory region (expression regulatory sequence) can be achieved by inducing modification of the expression regulatory region (expression regulatory sequence) through deletion, insertion, non-conservative substitution, or conserved substitution, or a combination thereof; or by replacing the sequence with a sequence of weaker activity. The expression regulatory region may contain, but is not limited to, promoters, operon sequences, sequences encoding ribosome binding sites, and sequences regulating transcription and translation termination.

[0105] 3) and 4) The methods of modifying amino acid sequences or polynucleotide sequences can be achieved by inducing sequence modification through deletion, insertion, non-conservative or conserved substitution, or a combination thereof, of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to weaken the activity of the polypeptide, or by replacing the sequence with a modified amino acid sequence or polynucleotide sequence that has weaker activity or a modified amino acid sequence or polynucleotide sequence that is inactive, but are not limited thereto. For example, gene expression can be suppressed or weakened by introducing mutations into the polynucleotide sequence to form a stop codon, but are not limited thereto.

[0106] 5) Modifying the nucleotide sequence or 5'-UTR of a gene transcript encoding a polypeptide can be achieved, for example, by replacing the nucleotide sequence with a nucleotide sequence encoding another start codon that has a lower polypeptide expression rate than the endogenous start codon, but is not limited thereto.

[0107] 6) The method of introducing antisense oligonucleotides (e.g., antisense RNA) that are complementary to the transcript of the gene encoding the polypeptide can be found in the literature (Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews-Trends in Genetics, Vol. 1(1) 1986).

[0108] 7) Adding a sequence complementary to the Shine-Dalgarno (SD) sequence of the gene encoding the polypeptide to the front of the SD sequence to form a secondary structure, thereby inhibiting ribosome attachment, can be achieved by inhibiting mRNA translation or slowing down its rate.

[0109] In addition, 8) reverse transcription engineering (RTE), which adds the promoter to be reverse transcribed to the 3' end of the open reading frame (ORF) of the gene sequence encoding the polypeptide, can be achieved by forming an antisense nucleotide complementary to the gene transcript encoding the polypeptide to reduce activity.

[0110] 9) Methods for regulating the cellular localization of peptides can be achieved by targeting the peptide to specific organelles or specific spaces within the cell. For example, this can be achieved by adding or removing a leader sequence that functions in the targeting peptide, thus targeting the periplasm or cytoplasm, but is not limited to this.

[0111] This reduction in peptide activity may mean that the activity or concentration of the corresponding peptide is lower than that of the peptide expressed in the wild-type strain or the unmodified microbial strain, or that the amount of product produced by the peptide is lower, but is not limited thereto.

[0112] In any of the above embodiments, the recombinant microorganism disclosed herein may be a microorganism in which SerB activity is weakened.

[0113] The "SerB" of this disclosure has the activity of converting OPS to L-serine, therefore microorganisms modified to attenuate SerB activity have the property of accumulating OPS therein, which can be used for OPS production. The SerB of this disclosure may be a protein having or including the amino acid sequence shown in SEQ ID NO:5, or may be a protein composed of or substantially composed of the amino acid sequence shown in SEQ ID NO:5, but is not limited thereto. Furthermore, the SerB of this disclosure may have or include an amino acid sequence having at least 70%, 80%, 90%, 95%, or 99% or more homology or identity with the amino acid sequence shown in SEQ ID NO:6, as long as it exhibits SerB activity. Furthermore, the SerB of this disclosure may be composed of or substantially composed of an amino acid sequence having at least 70%, 80%, 90%, 95%, or 99% or more homology or identity with the amino acid sequence shown in SEQ ID NO:5, but is not limited thereto. Furthermore, the polynucleotide encoding SerB may have or include a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:5. Furthermore, the polynucleotide encoding SerB can consist of, or substantially consist of, a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:5. Due to codon degeneracy or considering preferred codons in the organism to which the SerB protein is to be expressed, the polynucleotide encoding SerB of this disclosure can be modified in various ways in the coding region without altering the amino acid sequence of the SerB protein. The polynucleotide encoding SerB of this disclosure can have or include nucleotide sequences having at least 70%, 80%, 90%, 95%, or 99% or more and less than 100% homology or identity with the nucleotide sequence of SEQ ID NO:6, but is not limited thereto.

[0114] In any of the above embodiments, the recombinant microorganism of this disclosure may be a microorganism in which the activity of the O-phosphoserine export protein is enhanced. For example, it may be a microorganism in which the activity of YhhS is enhanced.

[0115] The "YhhS" disclosed herein possesses OPS-exporting activity; therefore, microorganisms modified to enhance YhhS activity possess the property of exporting OPS, which can be used for OPS production. The YhhS of this disclosure may be a protein having or including the amino acid sequence shown in SEQ ID NO:7, or may be a protein composed of or substantially composed of the amino acid sequence shown in SEQ ID NO:7, but is not limited thereto. Furthermore, the YhhS of this disclosure may have or include amino acid sequences having at least 70%, 80%, 90%, 95%, or 99% or more homology or identity with the amino acid sequence shown in SEQ ID NO:8, provided it exhibits YhhS activity. Furthermore, the YhhS of this disclosure may be composed of or substantially composed of amino acid sequences having at least 70%, 80%, 90%, 95%, or 99% or more homology or identity with the amino acid sequence shown in SEQ ID NO:7, but is not limited thereto. Furthermore, the polynucleotide encoding YhhS may have or include nucleotide sequences encoding the amino acid sequence shown in SEQ ID NO:7. Furthermore, the polynucleotide encoding YhhS can consist of or substantially consist of a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:7. Due to codon degeneracy or considering preferred codons in the organism to which the YhhS protein is to be expressed, the polynucleotide encoding YhhS of this disclosure can be modified in various ways in the coding region without altering the amino acid sequence of the YhhS protein. The polynucleotide encoding YhhS of this disclosure can have or include a nucleotide sequence having at least 70%, 80%, 90%, 95%, or 99% or more and less than 100% homology or identity with the nucleotide sequence of SEQ ID NO:8. Furthermore, the polynucleotide encoding YhhS of this disclosure can consist of or substantially consist of a nucleotide sequence having at least 70%, 80%, 90%, 95%, or 99% or more and less than 100% homology or identity with the nucleotide sequence of SEQ ID NO:8, but is not limited thereto.

[0116] In one embodiment, the modified microorganisms that enhance the ability to produce OPS and / or export OPS from cells; or enhance the ability to decompose and / or import OPS, may be CA07-0012 (KCCM 11121P; US2012-0190081A) or CA07-4821, but are not limited thereto. Regarding the content of the OPS-producing microorganisms, in addition to those mentioned above, the disclosures of Korean Patent Publication No. 1381048 or US Application Publication No. 2012-0190081, etc., may be used as references in this disclosure, but are not limited thereto.

[0117] Another aspect of this disclosure provides a method for producing O-phosphoserine, comprising culturing in a culture medium a recombinant microorganism for producing O-phosphoserine in which the activity of alkyl hydroperoxide reductase (Ahp) is enhanced compared to endogenous activity.

[0118] Ahp, endogenous activity, enhancement, O-phosphoserine, and microbes are as described above.

[0119] As used herein, the term "culture" refers to the growth of microorganisms under appropriately controlled environmental conditions. The culture process of this disclosure can be carried out in suitable culture media and culture conditions known in the art. Such a culture process can be readily adapted for use by those skilled in the art according to the strain to be selected. Specifically, the culture can be a batch culture, a continuous culture, or a fed-batch culture, but is not limited thereto.

[0120] When culturing microorganisms, the culture medium may also contain glycine or serine. Glycine can be provided in the form of purified glycine, glycine-containing yeast extract, or tryptone. The concentration of glycine in the culture medium is typically from 0.1 g / L to 10 g / L, specifically from 0.5 g / L to 3 g / L. Similarly, serine can be provided in the form of purified serine, serine-containing yeast extract, or tryptone. The concentration of serine in the culture medium is typically from 0.1 g / L to 5 g / L, specifically from 0.1 g / L to 1 g / L.

[0121] Examples of carbon sources that can be contained in a culture medium may include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These carbon sources may be used alone or in combination, but are not limited thereto.

[0122] Examples of nitrogen sources contained in culture media may include organic nitrogen sources such as peptone, yeast extract, meat broth, malt extract, corn steep liquor, and bean flour; and inorganic nitrogen sources such as urea, ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. These nitrogen sources may be used alone or in combination, but are not limited thereto.

[0123] Examples of phosphorus sources contained in the culture medium may include, but are not limited to, potassium dihydrogen phosphate, dipotassium hydrogen phosphate and their corresponding sodium salts.

[0124] In addition, the culture medium may contain metal salts, such as magnesium sulfate or ferric sulfate, and may also contain amino acids, vitamins, and appropriate precursors. These media or precursors may be added to the culture in batch or continuous culture, but are not limited thereto.

[0125] The pH of the culture can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid in an appropriate manner during the culture process. Furthermore, antifoaming agents such as fatty acid polyethylene glycol esters can be used during the culture process to prevent bubble formation. Additionally, oxygen or oxygen-containing gases can be injected into the culture to maintain aerobic conditions; or nitrogen, hydrogen, or carbon dioxide can be injected, or no gas can be injected, to maintain anaerobic or microaerophilic conditions. The culture temperature can be in the range of 25°C to 40°C, specifically 30°C to 35°C. The culture can continue until the production of useful substances can be obtained, specifically from 10 hours to 100 hours, but is not limited to these illustrative examples.

[0126] The method for producing OPS disclosed herein may also include the steps of preparing the microorganisms of the present disclosure, preparing a culture medium for culturing the microorganisms, or a combination thereof (in any order, regardless of the sequence), for example prior to the culturing step.

[0127] The method for producing OPS disclosed herein may further include a step of recovering OPS from a culture medium (on which the culture is grown) or from cultured microorganisms. A recovery step may also be included after the culturing step.

[0128] In the recovery step, the methods for culturing the microorganisms disclosed herein can be used, for example, according to batch culture, continuous culture, or fed-batch culture methods, using suitable methods known in the art to collect the desired OPS. For example, methods such as centrifugation, filtration, treatment with a protein crystallizing precipitant (salting out), extraction, ultrasonic disruption, ultrafiltration, dialysis, various types of chromatography (such as molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, etc.), HPLC, or combinations thereof, can be used, and the desired OPS can be recovered from the culture medium or microorganisms using suitable methods known in the art.

[0129] Furthermore, the method for producing OPS disclosed herein may also include a purification step, which may be performed using suitable methods known in the art. In one example, when the method for producing OPS disclosed herein includes both a recovery step and a purification step, the recovery step and the purification step may be performed continuously or intermittently without regard to the order, or they may be performed simultaneously, or they may be integrated into a single step, but the method is not limited thereto. Therefore, the recovered OPS may be in a purified state or a microbial fermentation broth containing OPS. Additionally, OPS recovery can be effectively performed by adding suitable methods known in the art before and after the cultivation step and before and after the recovery step.

[0130] Another aspect of this disclosure provides a method for producing cysteine ​​or a derivative thereof, comprising:

[0131] a) Culturing recombinant microorganisms that produce O-phosphoserine in a culture medium in which the activity of alkyl hydroperoxide reductase (Ahp) is enhanced compared to endogenous activity, to produce O-phosphoserine or in a culture medium containing O-phosphoserine; and

[0132] b) In the presence of O-phosphoserine hydrogen sulfide hydrolase (OPSS) or microorganisms containing it, react the O-phosphoserine produced in step a) or the culture medium containing it with sulfide.

[0133] Steps a) and b) are not necessarily restricted by order (i.e., performed consecutively or sequentially), and there is no time interval between these steps. These steps can be performed simultaneously or at intervals of seconds, minutes, hours or days.

[0134] Ahp, endogenous activity, enhancement, O-phosphoserine (OPS), and microorganisms are as described above.

[0135] As used herein, the term "derivative" refers to a similar compound obtained by chemically modifying a portion of any compound. The term generally refers to a compound in which a hydrogen atom or a particular group of atoms is replaced by another atom or group of atoms.

[0136] As used herein, the term "cysteine ​​derivative" refers to a compound in which a hydrogen atom or a specific group of atoms in cysteine ​​is replaced by another atom or group of atoms. For example, cysteine ​​derivatives may have a form in which the nitrogen atom of the amino group (-NH2) or the sulfur atom of the thiol group (-SH) of cysteine ​​has another atom or group attached thereto. Examples of cysteine ​​derivatives may include, but are not limited to, N-acetylcysteine ​​(NAC), S-carboxymethylcysteine ​​(SCMC), BOC-CYS(ME)-OH, (R)-S-(2-amino-2-carboxyethyl)-L-homocysteine, (R)-2-amino-3-sulfopropionic acid, D-2-amino-4-(ethylthio)butyric acid, 3-sulfinyl-L-alanine, Fmoc-Cys(BOC-methyl)-OH, seleno-L-cysteine, S-(2-thiazolyl)-L-cysteine, S-(2-thienyl)-L-cysteine, S-(4-tolyl)-L-cysteine, etc.

[0137] As long as cysteine ​​is produced according to the method of this disclosure, its conversion into cysteine ​​derivatives can be readily achieved by methods well known in the art.

[0138] In this disclosure, the method for producing cysteine ​​derivatives may further include converting the cysteine ​​produced in step b) into a cysteine ​​derivative.

[0139] Specifically, in this disclosure, the method for producing cysteine ​​derivatives may include the steps of producing cysteine ​​according to the method of this disclosure described above and converting the produced cysteine ​​into cysteine ​​derivatives.

[0140] The conversion of produced cysteine ​​into cysteine ​​derivatives can be carried out by methods well known in the art. For example, according to methods known in the art, cysteine ​​can be synthesized into N-acetylcysteine ​​(NAC) by reacting with an acetylation agent, or into S-carboxymethylcysteine ​​(SCMC) by reacting with haloacetic acid under alkaline conditions, but examples are not limited thereto.

[0141] These cysteine ​​derivatives are mainly used as pharmaceutical materials for antitussives, cough suppressants, and treatments for bronchitis, bronchial asthma, pharyngitis, etc., but are not limited to these applications.

[0142] As used herein, the term “O-phosphoserine hydrogen sulfide hydrolase (OPSS)” refers to an enzyme that catalyzes the conversion of OPS to cysteine ​​by donating a thiol group (SH group) to OPS. This enzyme was likely first discovered in thermophilic archaea (Aeropyrum pernix), Mycobacterium tuberculosis, Mycobacterium smegmatics, and Trichomonas vaginalis (Mino K and Ishikawa K, FEBS Letters, 551:133-138, 2003; Burns KE et al., J.Am.Chem.Soc., 127:11602-11603, 2005). In addition, OPSS can include not only wild-type OPSS proteins, but also variant proteins in which a portion of the sequence is missing, substituted, or added in the polynucleotide sequence encoding OPSS, exhibiting biological activity equal to or greater than that of wild-type OPSS proteins. It can also include all OPSS proteins and their variant proteins disclosed in Korean Application Publication No. 2012-0041115 and Korean Patent Publication No. 1208267.

[0143] The sulfide can be any sulfide, provided not only in the solid form commonly used in the art, but also in liquid or gaseous form due to differences in pH, pressure, and solubility, and therefore can be in the form of sulfide (S 2- ), thiosulfate (S2O3) 2-The sulfide can be converted to a thiol group (SH) in various forms, without limitation. Specifically, the sulfide may include Na2S, NaSH, (NH4)2S, H2S, or Na2S2O3, which can provide a thiol group to the OPS, but are not limited thereto. In this reaction, a single thiol group is supplied to a single reactive OPS group to produce a single cysteine ​​or a derivative thereof. In this document, based on the molar concentration of OPS, the sulfide may be added in an amount of 0.1 to 3 molar equivalents, specifically 1 to 2 molar equivalents, but is not limited thereto.

[0144] Furthermore, methods for producing cysteine ​​derivatives may also include a step of recovering cysteine ​​produced by the reaction steps. In this document, the desired cysteine ​​can be collected by separating and purifying cysteine ​​from the reaction solution using suitable reactions known in the art.

[0145] Another aspect of this disclosure provides a composition for producing O-phosphoserine, cysteine, or a cysteine ​​derivative, comprising: a recombinant microorganism for producing O-phosphoserine, wherein the activity of an alkyl hydroperoxide reductase (Ahp) is enhanced compared to endogenous activity; a culture medium for culturing the microorganism; or a combination thereof.

[0146] The compositions disclosed herein may also include any suitable excipients commonly used in compositions for the production of O-phosphoserine, cysteine, or cysteine ​​derivatives, and such excipients may include, but are not limited to, preservatives, wetting agents, dispersants, suspending agents, buffers, stabilizers, or isotonic agents.

[0147] Another aspect of this disclosure provides a method for producing recombinant microorganisms for the production of O-phosphoserine, comprising enhancing the activity of alkyl hydroperoxide reductase (Ahp) compared to endogenous activity.

[0148] Another aspect of this disclosure provides the use of recombinant microorganisms that produce O-phosphoserine, wherein the activity of alkyl hydroperoxide reductase (Ahp) is enhanced compared to endogenous activity, in the production of O-phosphoserine, cysteine, or cysteine ​​derivatives.

[0149] Ahp, endogenous activity, enhancement, O-phosphoserine (OPS), cysteine, cysteine ​​derivatives, and microorganisms are as described above.

[0150] Mode of implementing the present invention

[0151] The present disclosure will now be described in detail by way of embodiments. However, these embodiments are merely preferred embodiments given for illustrative purposes, and therefore, the scope of the present disclosure is not intended to be limited to or restricted by these embodiments. Furthermore, those skilled in the art or similar fields will fully understand and readily implement technical features not described herein.

[0152] Example 1: Preparation of a strain for producing O-phosphoserine (OPS) with enhanced YhhS expression.

[0153] 1-1. Preparation of vectors for enhancing YhhS expression

[0154] Using wild-type Escherichia coli ATCC 27325 chromosomal DNA as a template, PCR was performed using primer pairs SEQ ID NO:11 and 12 to obtain the gene fragment upstream of the wild-type promoter of the yhhS gene (SEQ ID NO:8) that underwent homologous recombination on the chromosome. PCR was then performed using primer pairs SEQ ID NO:15 and 16 to obtain the gene fragment downstream of the wild-type promoter of the yhhS gene. Furthermore, using pCL_Ptrc-gfp (WO 2016-024771 A1) as a template, PCR was performed using primer pairs SEQ ID NO:13 and 14 to obtain the Ptrc promoter (SEQ ID NO:37).

[0155] Use Solg TM Pfu-X DNA polymerase was used for PCR, and PCR was performed under the following PCR amplification conditions: denaturation at 95°C for 2 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and polymerization at 72°C for 60 seconds, and then polymerization at 72°C for 5 minutes.

[0156] The upstream and downstream fragments of the yhhS promoter, as well as the Ptrc promoter fragment obtained by the above method, were cloned using an in-fusion cloning kit (Clontech Laboratories, Inc.), along with the pSKH130 vector (SEQ ID NO:36, US Patent Publication No. 2020-0048619) digested with the restriction enzyme EcoRV for chromosome transformation, thereby obtaining a recombinant plasmid, which was named pSKH_Ptrc-yhhS.

[0157] The primer sequences used are shown in Table 1.

[0158] [Table 1]

[0159]

[0160] 1-2. Preparation of strains with enhanced YhhS expression

[0161] The pSKH_Ptrc-yhhS prepared in Example 1-1 was introduced into CA07-0012 (KCCM 11121P, US Patent Publication No. 8557549 B2) (CA07-0012 is an OPS-producing strain in which the OPS degradation ability is weakened by the deletion of endogenous phosphatase (SerB) in wild-type Escherichia coli K-12W3110) to enhance the expression of YhhS (SEQ ID NO:7) (YhhS is a protein with OPS output capability), thereby further enhancing the OPS output capability.

[0162] The pSKH_Ptrc-yhhS prepared in Example 1-1 was transformed into strain CA07-0012 by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), followed by a first crossover using R6K and kanamycin to obtain the desired strain. Subsequently, a second crossover was performed on the strain in a sucrose-containing medium to obtain a strain in which the kanamycin resistance gene was deleted and the nucleotide sequence of the Ptrc promoter was inserted at the end of the wild-type promoter sequence of the yhhS gene. The insertion of the Ptrc promoter nucleotide sequence was confirmed by genome sequencing and PCR amplification using primer pairs SEQ ID NO:17 and 18, which were capable of amplifying the upstream and downstream regions of the homologous recombination, respectively. The resulting strain was named CA07-4821 (CA07-0012ΔPn_yhhS::Ptrc_yhhS).

[0163] The primer sequences used are shown in Table 2.

[0164] [Table 2]

[0165]

[0166] Example 2: Preparation of strains with enhanced or weakened Ahp expression

[0167] 2-1. Preparation of vectors for enhancing Ahp expression

[0168] As a result of previous studies, the average transcription levels of the ahpC, rhtB, serC, and rmf genes in the host strains producing OPS were found to be 11123, 1391, 24861, and 32205, respectively, as shown in Table 3. This confirms that the average transcription level of the rmf gene is 2.9 times higher than that of the ahpC gene, and the average transcription level of the serC gene is 2.2 times higher. In contrast, the average transcription level of the rhtB gene is confirmed to be 0.1 times that of the ahpC gene. Therefore, it is confirmed that the rmf gene promoter and the serC gene promoter are relatively strong promoters compared to the Ahp operon promoter, while the rhtB gene promoter is a relatively weak promoter.

[0169] [Table 3]

[0170] Gene name Early Index Mid-term index Late-stage index Stablize average ahpC 11925 10860 11580 10128 11123 rhtB 1711 1842 1212 799 1391 serC 21542 21941 21352 34609 24861 rmf 30725 28192 28109 41792 32205

[0171] Therefore, by further inserting the rmf promoter and serC promoter (SEQ ID NO:10), which were found to have strong activity, into the promoter terminus of the ahpCF operon in the OPS-producing microorganism, a strain with enhanced Ahp expression was prepared.

[0172] Using wild-type Escherichia coli ATCC27325 chromosomal DNA as a template, PCR was performed using primer pairs SEQ ID NO:19 and 20 to obtain the gene fragment upstream of the wild-type promoter of the ahpC gene (SEQ ID NO:2), and PCR was performed using primer pairs SEQ ID NO:21 and 22 to obtain the gene fragment downstream of the wild-type promoter of the ahpC gene. Furthermore, using wild-type Escherichia coli ATCC27325 chromosomal DNA as a template, PCR was performed using primer pairs SEQ ID NO:23 and 24 to obtain the promoter region of the rmf gene.

[0173] Use Solg TM Pfu-X DNA polymerase was used for PCR, and PCR was performed under the following PCR amplification conditions: denaturation at 95°C for 2 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and polymerization at 72°C for 60 seconds, and then polymerization at 72°C for 5 minutes.

[0174] The upstream and downstream fragments of the ahmpC promoter, as well as the rmf promoter fragment obtained by the above method, were cloned using an in-fusion cloning kit, along with pSKH130 cut with the restriction enzyme EcoRV for chromosome transformation, to obtain a recombinant plasmid, which was named pSKH130_Prmf-ahp.

[0175] Using wild-type *E. coli* ATCC27325 chromosomal DNA as a template, PCR was performed using primer pairs SEQ ID NO:19 and 25 to obtain the gene fragment in the upstream region of the wild-type promoter of the *ahpC* gene, and using primer pairs SEQ ID NO:22 and 26 to obtain the gene fragment in the downstream region of the wild-type promoter of the *ahpC* gene. Furthermore, using wild-type *E. coli* ATCC27325 chromosomal DNA as a template, PCR was performed using primer pairs SEQ ID NO:27 and 28 to obtain the promoter region of the *serC* gene.

[0176] Use Solg TM Pfu-X DNA polymerase was used for PCR, and PCR was performed under the following PCR amplification conditions: denaturation at 95°C for 2 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and polymerization at 72°C for 60 seconds, and then polymerization at 72°C for 5 minutes.

[0177] The upstream and downstream fragments of the ahpC promoter, as well as the serC promoter fragment obtained by the above method, were cloned using an in-fusion cloning kit, along with pSKH130 cut with the restriction enzyme EcoRV for chromosome transformation, to obtain a recombinant plasmid, which was named pSKH130_PserC-ahp.

[0178] 2-2. Preparation of vectors for attenuating Ahp expression

[0179] By further inserting the rhtB promoter (SEQ ID NO:35), which will show weaker activity, into the promoter terminus of the ahpCF operon in the OPS-producing microorganism, a strain with enhanced Ahp expression was prepared.

[0180] Using wild-type *E. coli* ATCC27325 chromosomal DNA as a template, PCR was performed using primer pairs SEQ ID NO:19 and 29 to obtain the gene fragment in the upstream region of the wild-type promoter of the *ahpC* gene, and using primer pairs SEQ ID NO:22 and 20 to obtain the gene fragment in the downstream region of the wild-type promoter of the *ahpC* gene. Furthermore, using wild-type *E. coli* ATCC27325 chromosomal DNA as a template, PCR was performed using primer pairs SEQ ID NO:31 and 32 to obtain the promoter region of the *rhtB* gene.

[0181] Use Solg TMPfu-X DNA polymerase was used for PCR, and PCR was performed under the following PCR amplification conditions: denaturation at 95°C for 2 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and polymerization at 72°C for 60 seconds, and then polymerization at 72°C for 5 minutes.

[0182] The upstream and downstream fragments of the aphpC promoter, as well as the rhtB promoter fragment obtained by the above method, were cloned using an in-fusion cloning kit, along with pSKH130 cut with the restriction enzyme EcoRV for chromosome transformation, to obtain a recombinant plasmid, which was named pSKH130_PrhtB-ahp.

[0183] The primer sequences used in Examples 2-1 and 2-2 are shown in Table 4 below.

[0184] [Table 4]

[0185]

[0186] 2-3. Preparation of strains with enhanced Ahp expression

[0187] The pSKH_Prmf-ahp and pSKH_PserC-ahp prepared in Example 2-1 were transformed into the CA07-4821 strain of Example 1-2, an OPS-producing strain with enhanced YhhS expression, by electroporation. A second exchange was then performed to obtain strains in which the nucleotide sequence of the serC or rmf gene promoter was inserted at the end of the nucleotide sequence of the wild-type promoter of the aphp gene, respectively. The insertion of the serC or rmf promoter nucleotide sequence was confirmed by genome sequencing and PCR amplification using primer pairs SEQ ID NO:33 and 34, which were capable of amplifying the upstream and downstream regions of homologous recombination, respectively. The strains obtained were named CA07-4888(CA07-4821ΔPn_ahpC-ahpF::PserC-ahpC-ahpF) and CA07-4887(CA07-4821ΔPn_ahpC-ahpF::Prmf_ahpC-ahpF), respectively.

[0188] 2-4. Preparation of strains with weakened Ahp expression

[0189] The pSKH130_PrhtB-ahp prepared in Example 2-2 was transformed into the CA07-4821 strain of Example 1-2, an OPS-producing strain with enhanced YhhS expression, by electroporation. A second exchange was then performed to obtain a strain in which the nucleotide sequence of the rhtB gene promoter was inserted at the end of the nucleotide sequence of the wild-type promoter of the aphp gene. The insertion of the rhtB promoter nucleotide sequence was confirmed by genome sequencing and PCR amplification using primer pairs SEQ ID NO:33 and 34, which were capable of amplifying the upstream and downstream regions of homologous recombination, respectively. The resulting strain was named CA07-4889 (CA07-4821ΔPn_ahpC-ahpF::PrhtB_ahpC-ahpF).

[0190] The primer sequences used in Examples 2-3 and 2-4 are shown in Table 5 below.

[0191] [Table 5]

[0192] SEQ ID NO: sequence name Sequence (5'->3') 33 Ahp Conf F ATATTAAGCGTTTTCTGATC 34 Ahp Conf R TTCTTTCGACGGATGACCAC

[0193] Example 4: Evaluation of the strain's OPS production capacity

[0194] To measure the OPS production capacity of strains CA07-4888 and CA07-4887 (which are strains with enhanced Ahp expression) in Examples 2-3, strain CA07-4889 (which is a strain with weakened Ahp expression) in Examples 2-4, parental strain CA07-0012 in Examples 1-2, and strain CA07-4821 in Examples 1-2 as a control strain, shake-flask fermentation titers were evaluated.

[0195] Each strain was plated on solid LB medium and incubated overnight at 33°C. The strains incubated overnight on solid LB medium were then inoculated into 25 mL of medium with a titer below the specified value, and then incubated at 33°C for 48 hours at 200 rpm. After incubation, the OPS concentration was measured using HPLC, and the results are shown in Table 6 below.

[0196] <Titer Culture Medium>

[0197] 40 g / L glucose, 6 g / L KH₂PO₄, 17 g / L (NH₄)₂SO₄, 1 g / L MgSO₄·7H₂O, 5 mg / L MnSO₄·4H₂O, 10 mg / L FeSO₄·7H₂O, 1.5 g / L L-glycine, 2.5 g / L yeast extract, 30 g / L CaCO₃, pH 6.8

[0198] [Table 6]

[0199] strain name Parental strain Gene type OPS concentration (g / L) CA07-0012 W3110 W3110ΔserB 5.54 CA07-4821 CA07-0012 ΔPn_yhhS::Ptrc_yhhS 7.73 CA07-4887 CA07-4821 ΔPn_ahpC-ahpF::Prmf_ahpC-ahpF 8.07 CA07-4888 CA07-4821 ΔPn_ahpC-ahpF::PserC-ahpC-ahpF 7.98 CA07-4889 CA07-4821 ΔPn_ahpC-ahpF::PrhtB_ahpC-ahpF 7.85

[0200] As shown in Table 6, the Ahp-enhanced CA07-4887 and CA07-4888 strains, using the YhhS-enhanced CA07-4821 strain as the parent strain, showed an increase in OPS production capacity of 4.4% and 3.2%, respectively, compared to the parent strain. The Ahp-weakened CA07-4889 strain showed the lowest OPS production capacity, with an increase of 1.5% compared to the parent strain.

[0201] Therefore, it is confirmed that the enhancement of Ahp increased OPS production capacity.

[0202] Based on the foregoing, those skilled in the art to which this disclosure pertains will understand that this disclosure may be implemented in other specific forms without modifying the technical concept or essential features of this disclosure. In this regard, the exemplary embodiments disclosed herein are for illustrative purposes only and should not be construed as limiting the scope of this disclosure. Rather, this disclosure is intended to cover not only the exemplary embodiments but also various alternatives, modifications, equivalent substitutions, and other embodiments that may be included within the spirit and scope of this disclosure as defined by the appended claims.

Claims

1. A recombinant microorganism that produces O-phosphoserine, wherein the activity of alkyl hydroperoxide reductase (Ahp) is enhanced compared to endogenous activity.

2. The microorganism according to claim 1, wherein the recombinant microorganism has enhanced O-phosphoserine production capacity compared to endogenous O-phosphoserine production capacity.

3. The microorganism according to claim 1, wherein the microorganism has enhanced activity selected from any one or more of the group consisting of alkyl hydroperoxide reductase subunit C (AhpC) and alkyl hydroperoxide reductase subunit F (AhpF).

4. The microorganism of claim 1, wherein the Ahp is encoded by the ahpCF operon gene.

5. The microorganism according to claim 3, wherein the AhpC consists of the amino acid sequence of SEQ ID NO:

1.

6. The microorganism according to claim 3, wherein the AhpF consists of the amino acid sequence of SEQ ID NO:

3.

7. The microorganism according to claim 1, wherein the recombinant microorganism is a microorganism in which the activity of the O-phosphoserine export protein is further enhanced compared with the endogenous activity.

8. The microorganism according to claim 1, wherein the recombinant microorganism belongs to the genus Escherichia.

9. A method for producing O-phosphoserine, comprising culturing in a culture medium a recombinant microorganism for producing O-phosphoserine in which the activity of alkyl hydroperoxide reductase (Ahp) is enhanced compared with endogenous activity.

10. The method of claim 9, wherein the method further comprises recovering O-phosphoserine from the culture medium or microorganism.

11. A method for producing cysteine ​​or a derivative thereof, comprising: a) Culturing recombinant microorganisms that produce O-phosphoserine in a culture medium in which the activity of alkyl hydroperoxide reductase (Ahp) is enhanced compared to endogenous activity, to produce O-phosphoserine or in a culture medium containing O-phosphoserine; and b) In the presence of O-phosphoserine hydrogen sulfide hydrolase (OPSS) or microorganisms containing it, react the O-phosphoserine produced in step a) or the culture medium containing it with sulfide.

12. The method according to claim 11, wherein the sulfide is at least one selected from the group consisting of Na2S, NaSH, (NH4)2S, H2S and Na2S2O3.

13. The use of recombinant microorganisms that produce O-phosphoserine, wherein the activity of alkyl hydroperoxide reductase (Ahp) is enhanced compared with endogenous activity, in the production of O-phosphoserine, cysteine ​​or cysteine ​​derivatives.

Images