Severe fever with thrombocytopenia syndrome virus mRNA vaccine as well as preparation method and application thereof

Abstract

The invention provides a chimeric bivalent SFTSV (severe fever with thrombocytopenia syndrome virus) mRNA (messenger ribonucleic acid) vaccine, which is characterized in that the vaccine co-expresses an SFTSV envelope protein precursor GPC and a nucleoprotein NP in series through a flexible joint. Through humoral immunity, cellular immunity and challenge protection effect evaluation, the effectiveness of the mRNA vaccine provided by the invention is verified. Research results show that the prepared SFTSV mRNA vaccine can generate a good immune protection effect by only needing one mRNA, has the characteristics of simple industrial production, easy quality control and the like, and is an ideal choice of the SFTSV vaccine.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, and particularly relates to a chimeric bivalent severe fever with thrombocytopenia syndrome virus mRNA vaccine and a preparation method and application thereof. BACKGROUND

[0002] Severe fever with thrombocytopenia syndrome (SFTS) is a new viral hemorrhagic fever transmitted by insects in the 21st century, and the main clinical manifestations are fever, thrombocytopenia and leukopenia, accompanied by gastrointestinal symptoms and other flu-like symptoms. Severe cases can lead to multiple organ dysfunction and even death, with a mortality rate of up to 27%. SFTS is caused by infection with severe fever with thrombocytopenia syndrome virus (SFTSV). The Heartland virus (HRTV) found in the United States is close to SFTSV in phylogenetic evolution, indicating that the epidemic area is expanding. At the same time, SFTSV has a high risk of variation and can rapidly mutate in the host or vector arthropod. SFTS not only poses a great threat to the health of the Chinese people, but also is a great challenge to international public health. The World Health Organization (WHO) listed SFTSV as a priority pathogen requiring urgent attention in 2018. However, there is currently no specific vaccine or therapeutic drug approved for SFTSV infection, and the main treatment is conservative supportive therapy for symptomatic treatment. As one of the most effective means of preventing and controlling infectious diseases, the development of a safe and effective SFTSV vaccine is of great significance.

[0003] mRNA vaccines, as a new vaccine technology platform, have shown significant advantages in rapid research and development, easy mass production, and strong immunogenicity. mRNA vaccines have immeasurable potential applications in many medical fields such as preventing infectious diseases and treating tumors. It is a vaccine synthesized by in vitro transcription technology to code antigens, and transported to specific tissues and cells through a delivery system. The mRNA vaccine is translated by the host cell's own translation system, and can induce humoral immunity and cellular immunity, and can effectively protect the body through multiple mechanisms. Compared with other types of vaccines, mRNA vaccines are easier to design and produce. For example, the mRNA vaccines BNT162b2 of Pfizer / BioNTech and mRNA-1273 of Moderna are designed for the surface spike protein of SARS-CoV-2 coronavirus (COVID-19), and the results show that the protection of the two vaccines is greater than 94.0%. SUMMARY

[0004] In the development of SFTSV vaccine, the field usually adopts the "mixing" strategy, that is, mRNA of different antigen proteins is prepared respectively, and then mixed and used. However, direct mixing of vaccines needs to control the purity, concentration, LNP encapsulation rate and mixing ratio of different mRNAs at the same time, and any factor may affect the vaccine effect, and the quality control is difficult. The present application provides a SFTSV mRNA vaccine, which can produce good immune protection effect only with one mRNA, and only one mRNA needs to be detected for quality, the index is single and easy to standardize, has the characteristics of simple industrial production, easy quality control, etc., and is an ideal choice for SFTSV vaccine.

[0005] Since GPC is a viral surface antigen, mainly inducing neutralizing antibodies, and NP is an internal nucleocapsid protein, mainly activating cellular immunity, the significant difference between the two functions and the design of the linker make it difficult for those skilled in the art to think of co-expressing the glycoprotein precursor GPC and the nucleoprotein NP of SFTSV in a mRNA through the linker-(G4S1)4. The technical scheme of the present application provides a SFTSV mRNA vaccine in which the envelope protein precursor GPC and the nucleoprotein NP of SFTSV are co-expressed in a mRNA through the linker-(G4S1)4. In vivo, through humoral immune response detection and cellular immune response detection, and challenge protection effect evaluation experiments, it is proved that the vaccine has good immunogenicity, can protect mice from SFTSV infection, has stronger cellular immunity and humoral immunity effect compared with the Mix group, and is more thorough in clearing the virus from the tissue.

[0006] Specifically, the present application provides the following technical solutions:

[0007] 1. A fever with thrombocytopenia syndrome virus mRNA vaccine, comprising mRNA of a fever with thrombocytopenia syndrome virus GPC protein and mRNA of a fever with thrombocytopenia syndrome virus NP protein, wherein the mRNA of the fever with thrombocytopenia syndrome virus GPC protein and the mRNA of the fever with thrombocytopenia syndrome virus NP protein are connected in series through a flexible linker.

[0008] 2. The mRNA vaccine according to item 1, characterized in that the amino acid sequence of the flexible linker is (G4S1);

[0009] Optionally, the linker amino acid sequence is (G4S1)3, (G4S1)4, (G4S1)5, (G4S1)6;

[0010] Preferably, the linker amino acid sequence is (G4S1)4;

[0011] Wherein, the (G4S1) is GGGGS, and the (G4S1)n n GGGGS.

[0012] 3. The mRNA vaccine of item 1 or 2, wherein the sequence of the mRNA expressing GPC protein is shown as SEQ ID NO: 12.

[0013] 4. The mRNA vaccine of any one of items 1-3, wherein the sequence of the mRNA expressing NP protein is shown as SEQ ID NO: 13.

[0014] 5. The mRNA vaccine of any one of items 1-4, having a sequence shown as SEQ ID NO: 5, wherein the mRNA of GPC protein and the mRNA of NP protein connected in series by flexible linker are encapsulated in a lipid nanoparticle.

[0015] 6. The mRNA vaccine of any one of items 1-5, further comprising 5’ UTR and 3’ UTR sequences, and a poly(A) modification at the 3’ end.

[0016] 7. The mRNA vaccine of item 6, wherein the nucleotide sequence of the 5’ UTR is shown as SEQ ID NO: 9, the nucleotide sequence of the 3’ UTR is shown as SEQ ID NO: 10, and the nucleotide sequence of the poly(A) is shown as SEQ ID NO: 11.

[0017] 8. The mRNA vaccine of any one of items 5-7, wherein the lipid nanoparticle comprises ionizable lipid SM-102, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), cholesterol, and DMG-PEG 2000, at a molar ratio of 50:10:38.5:1.5.

[0018] 9. A pharmaceutical composition comprising the mRNA vaccine of any one of items 1-8 and a pharmaceutically acceptable carrier.

[0019] 10. Use of the mRNA vaccine of any one of items 1-8 in the preparation of a medicament for preventing infection of fever with thrombocytopenia syndrome.

[0020] Definitions (please refer to the following definitions of terms in the invention)

[0021] Gn: Glycoprotein N-terminal, N segment glycoprotein, SFTSV surface target for a neutralizing antibody.

[0022] Gc: Glycoprotein C-terminal, C segment glycoprotein, SFTSV surface target of a neutralizing antibody.

[0023] NP: SFTSV internal nucleocapsid protein.

[0024] LNP: Lipid nanoparticles, a kind of mRNA delivery system, which contains at least one kind of lipid.

[0025] mRNA vaccine: mRNA is a naturally occurring molecule that carries the "blueprint" of human cells, which can produce target proteins or immunogens to activate immune responses in the body to fight various pathogens. The mRNA vaccine uses the genetic sequence of the virus rather than the virus itself, so the mRNA vaccine does not contain viral components and has no risk of infection.

[0026] Beneficial results

[0027] The research of the present application shows that the mRNA vaccine for co-expressing SFTSV envelope protein precursor GPC and nucleoprotein NP through flexible linker in series can produce good humoral immunity and cellular immunity after immunizing mice, and protect mice from SFTSV infection. The vaccine successfully encodes GPC and NP antigen proteins through a single-chain mRNA with a flexible linker, which has the advantages of more complete immune protection source and stronger immune protection effect compared with single GPC vaccine; compared with simple mixed vaccine, it has the advantages of low production cost, simple production process and stronger immune protection effect, which provides technical reserves for SFTS epidemic prevention. Therefore, the SFTSV mRNA vaccine provided by the present application is more suitable for clinical application and has potential value for new drug development. BRIEF DESCRIPTION OF DRAWINGS

[0028] Figure 1 Molecular sequence design mode diagram.

[0029] Figure 2 The expression of Gn of 0901-GPC, Gn of 0902-GPC, Gc of 0901-GPC and Gc of 0902-GPC proteins is shown by immunofluorescence method and flow cytometry. Figure 2 A shows the expression of Gn of 0901-GPC, Gn of 0902-GPC, Gc of 0901-GPC and Gc of 0902-GPC proteins by immunofluorescence method, Figure 2 B shows the expression of Gn of 0901-GPC, Gn of 0902-GPC, Gc of 0901-GPC and Gc of 0902-GPC proteins by flow cytometry.

[0030] Figure 3A shows the expression of NP protein of 0903-NP, 0904-NP by immunofluorescence method, Figure 3 A shows the expression of NP protein of 0903-NP, 0904-NP by immunofluorescence method, Figure 3 B shows the expression of NP protein of 0903-NP, 0904-NP by flow cytometry.

[0031] Figure 4 A shows the expression of NP protein of 0903-NP, 0904-NP by immunofluorescence method, Figure 4 A shows the expression of NP protein of 0903-NP, 0904-NP by immunofluorescence method, Figure 4 B shows the expression of NP protein of 0903-NP, 0904-NP by flow cytometry.

[0032] Figure 5 A shows the expression of NP protein of 0903-NP, 0904-NP by immunofluorescence method, Figure 5 A shows the expression of NP protein of 0903-NP, 0904-NP by immunofluorescence method, Figure 5 B shows the expression of NP protein of 0903-NP, 0904-NP by flow cytometry.

[0033] Figure 6Characterization of SFTSV mRNA vaccine is shown. Figure 6 A shows the particle size of SFTSV mRNA vaccine, Figure 6 B shows the polydispersity index of SFTSV mRNA vaccine, Figure 6 C shows the encapsulation efficiency of SFTSV mRNA vaccine.

[0034] Figure 7 The Gn, Gc and NP-specific IgG antibody levels produced in mice after immunization with SFTSV mRNA vaccine are shown. Figure 7 A shows the Gn-IgG antibody levels produced in mice after immunization with SFTSV mRNA vaccine, Figure 7 B shows the Gc-IgG antibody levels produced in mice after immunization with SFTSV mRNA vaccine, Figure 7 C shows the NP-IgG antibody levels produced in mice after immunization with SFTSV mRNA vaccine.

[0035] Figure 8 The Gn, Gc and NP-binding antibody titers stimulated by SFTSV mRNA vaccine after booster immunization are shown. Figure 8 A shows the Gn-IgG antibody titers stimulated by mRNA vaccine after booster immunization, Figure 8 B shows the Gc-IgG antibody titers stimulated by mRNA vaccine after booster immunization, Figure 8 C shows the NP-IgG antibody titers stimulated by mRNA vaccine after booster immunization.

[0036] Figure 9 The neutralizing antibody levels of SFTSV in mouse serum at day 10 after booster immunization with SFTSV mRNA vaccine are shown.

[0037] Figure 10 The cytokine secretion of mouse spleen cells after stimulation with GPC peptide library in different groups of mice is shown. Figure 10 A shows the number of IFN-γ secreting cells of mouse spleen cells after stimulation with GP peptide library in different groups of mice, Figure 10 B shows the number of TNF-α secreting cells of mouse spleen cells after stimulation with GPC peptide library in different groups of mice, Figure 10 C shows the number of IL-2 secreting cells of mouse spleen cells after stimulation with GPC peptide library in different groups of mice, Figure 10 D shows the number of mouse spleen cell cytokine IL-4 secreting cells of mouse spleen cells after stimulation with GPC peptide library in different groups of mice.

[0038] Figure 11 The cytokine secretion of mouse spleen cells after stimulation with NP peptide library in different groups of mice is shown. Figure 11A shows the number of IFN-γ secreting cells after stimulation of spleen cells of different groups of mice with NP peptide library, Figure 11 B shows the number of TNF-α secreting cells after stimulation of spleen cells of different groups of mice with NP peptide library, Figure 11 C shows the number of IL-2 secreting cells after stimulation of spleen cells of different groups of mice with NP peptide library, Figure 11 D shows the number of IL-4 secreting cells after stimulation of spleen cells of different groups of mice with NP peptide library.

[0039] Figure 12 shows the monitoring of body weight and survival rate of the groups of mice within 21 days after SFTSV infection. Figure 12 A shows the body weight change of the groups of mice within 21 days after SFTSV infection, Figure 12 B shows the survival rate of the groups of mice within 21 days after SFTSV infection.

[0040] Figure 13 shows the viral copies of the main internal organs of the groups of mice on day 4 after SFTSV infection. Figure 13 A shows the viral copies of the spleen of the groups of mice on day 4 after SFTSV infection, Figure 13 B shows the viral copies of the kidney of the groups of mice on day 4 after SFTSV infection, Figure 13 C shows the viral copies of the lung of the groups of mice on day 4 after SFTSV infection, Figure 13 D shows the viral copies of the heart of the groups of mice on day 4 after SFTSV infection, Figure 13 E shows the viral copies of the liver of the groups of mice on day 4 after SFTSV infection, Figure 13 F shows the viral copies of the blood of the groups of mice on day 4 after SFTSV infection, Figure 13 G shows the viral copies of the brain of the groups of mice on day 4 after SFTSV infection.

[0041] Figure 14 shows the viral titers of the main internal organs of the groups of mice on day 4 after SFTSV infection. Figure 14 A shows the viral titers of the spleen of the groups of mice on day 4 after SFTSV infection, Figure 14 B shows the viral titers of the kidney of the groups of mice on day 4 after SFTSV infection, Figure 14 C shows the viral titers of the lung of the groups of mice on day 4 after SFTSV infection, Figure 14 D shows the viral titers of the heart of the groups of mice on day 4 after SFTSV infection, Figure 14 E shows the viral titers of the liver of the groups of mice on day 4 after SFTSV infection, Figure 14F shows the viral titers in the blood of each group of mice on day 4 after SFTSV infection, Figure 14 G shows the viral titers in the brain of each group of mice on day 4 after SFTSV infection.

[0042] Figure 15 The immunohistochemical images of each group of mice are shown.

[0043] Figure 16 The blood routine indicators of mice on day 4 after SFTSV infection are shown. Figure 16 A shows the platelet indicators of mice on day 4 after SFTSV infection, Figure 16 B shows the percentage of lymphocytes of mice on day 4 after SFTSV infection, Figure 16 C shows the percentage of neutrophils of mice on day 4 after SFTSV infection. DETAILED DESCRIPTION

[0044] In order to make the purpose, technical solutions and advantages of the present application clearer, the present application is further described in detail below in combination with specific examples and with reference to the accompanying drawings.

[0045] Example 1 Preparation of SFTSV mRNA

[0046] 1. Recombinant plasmid construction and synthesis

[0047] The GPC (GenBank: YP_009666134.1) and NP (GenBank: YP_009666136.1) genomic sequences of the SFTSV HNXH strain were selected, different expression modes of antigen proteins were designed (as shown in Table 1), and codon optimization was performed on the peptide codon optimization website (https: / / www.peptide2.com / peptide_reverse_translation_of_aminoacid_sequences.php) and the Jcat codon optimization website (http: / / www.jcat.de / ) respectively (the difference between peptide-serine UCC / arginine CGG; Jcat-serine AGC / arginine CGC). After optimization, the sequences (as shown in Table 1) were connected with 5'UTR sequence (SEQ ID NO: 9), 3'UTR sequence (SEQ ID NO: 10) and poly(A) sequence (SEQ ID NO: 11) respectively, and then full gene synthesis was performed (Shanghai Bioengineering Co., Ltd.) with pUC57 (obtained from Shanghai Bioengineering Co., Ltd.) as the cloning vector, i.e. the template plasmid (design pattern as shown in Figure 1

[0048] Table 1 SFTSV mRNA sequence information​

[0049]

[0050] Note: (G4S1)4— GGGGSGGGGSGGGGSGGGGS

[0051] T2A— GSGEGRGSLLTCGDVEENPGP

[0052] GFN: refers to the mRNA sequence encoding GPC-(G4S1)4-NP (corresponding to 0905-GFN, 0906-GFN)

[0053] GTN: refers to the mRNA sequence encoding GPC-T2A-NP (corresponding to 0907-GTN, 0908-GTN)

[0054] 2. Preparation and purification of SFTSV mRNAs

[0055] Take the enzyme-free tube, add reagents in the following order in the clean bench: 10 x transcription buffer (containing 600 mM Tris-HCl, 500 mM magnesium acetate, 50 mM TECP and 60 mM spermidine, pH 7.5), ATP (100 mM), CTP (100 mM), GTP (100 mM), UTP (100 mM), Cap1 analog (100 mM), T7 RNA Polymerase Mix, and add each linearized template (0901-GPC, 0902-GPC, 0903-NP, 0904-NP, 0905-GFN, 0906-GFN, 0907-GTN and 0908-GTN) respectively. Table 2 shows the amount of each component added to the 20 μl system. After adding, mix well by blowing with a pipette for 10 sec, press the cap tightly, and centrifuge at low speed for 30 sec to collect the liquid on the tube wall. Place the labeled enzyme-free tube in the intelligent constant temperature oscillator / PCR instrument and react at 37±3℃ for 2~5 h. Precipitate the mRNA at 2.5 M lithium chloride at 20℃ for 30 min, then resuspend in water, centrifuge at 16 000 x g at 43℃ for 20 min, and recover the 8 purified mRNAs (0901-GPC, 0902-GPC, 0903-NP, 0904-NP, 0905-GFN, 0906-GFN, 0907-GTN and 0908-GTN).

[0056] Table 2 Reagents and volumes

[0057]

[0058] Example 2 In vitro verification of SFTSV mRNA

[0059] SFTSV mRNA sequence transfection

[0060] Eight SFTSV mRNA (0901-GPC, 0902-GPC, 0903-NP, 0904-NP, 0905-GFN, 0906-GFN, 0907-GTN and 0908-GTN) sequences obtained from Example 1 were transfected on HEK293T cells (ATCC: ACS-4500) according to the Lipofectamine™ 2000 Transfection Reagent (Thermo Scientific, 11668019) instructions, the specific steps are as follows: 1) cell preparation: the day before transfection, the well-grown HEK293T cells (ATCC: ACS-4500) were transferred to 48-well cell plates, which were treated with polylysine solution (Bi Yun Tian, ST508) when indirect immunofluorescence verification of protein expression was performed, and the cells were transfected when they reached 80%~90% confluence; 2) mRNA and liposome mixing: 1 μg of each mRNA sequence (0901-GPC, 0902-GPC, 0903-NP, 0904-NP, 0905-GFN, 0906-GFN, 0907-GTN and 0908-GTN) was added to 50 μl of Opti-MEM medium, and at the same time, 2 μl of lip2000 (Thermo Scientific, 11668019) was added to 50 μl of Opti-MEM medium, the liposome and mRNA were mixed and incubated at room temperature for 5 min; 3) cell washing: the cells were washed with sterile PBS solution slowly for 3 times, 1 mL / time, and then 400 μl / well of Opti-MEM solution was added; 4) liposome and mRNA mixture added to cells: the mRNA and liposome mixture incubated at room temperature were gently added to the cell culture wells; 5) cell culture: the cells were cultured in a 37°C cell incubator for 24~36 h.

[0061] 1. Indirect immunofluorescence verification of protein expression

[0062] After transfecting HEK293T cells with SFTSV mRNA sequences for 24 h, the cells were fixed and subjected to indirect immunofluorescence assay, with the following steps: 1) cell fixation: discard the cell culture supernatant, add tissue fixation fluid containing 4% PFA, and fix at room temperature for 30 min; 2) washing: wash with PBST for 3 times, 5 min each time; 3) membrane penetration: discard the washing solution, add membrane penetration solution (0.1% Triton X-100 in PBS), 100 μL / well, at room temperature for 20 min; 4) washing: wash with PBST for 3 times, 5 min each time; 5) blocking: discard the washing solution, and incubate with blocking buffer (PBS, 5% skim milk powder) at 4°C overnight; 6) incubation of primary antibody: discard the washing solution, dilute SFTSV-Gn, SFTSV-Gc and SFTSV-NP rabbit hyperimmune serum (SFTSV-Gn and SFTSV-Gc rabbit hyperimmune serum was obtained from Prof. Gao Fu and Dr. Wu Yan of the Institute of Microbiology, Chinese Academy of Sciences, and was prepared after immunizing healthy adult New Zealand white rabbits with 293F cell-expressed and purified proteins; SFTSV-NP rabbit polyclonal antibody was prepared by expressing and purifying NP protein in E. coli and immunizing healthy adult New Zealand white rabbits; the SFTSV-Gn, SFTSV-Gc and SFTSV-NP rabbit hyperimmune serum can be prepared by routine operation by those skilled in the art) (1:1000 dilution) and add to the wells, 100 μL / well, at room temperature for 1 h; 7) washing: wash with PBST for 3 times, 5 min each time; 8) incubation of secondary antibody: discard the washing solution, add FITC-labeled goat anti-rabbit IgG (H + L) antibody (purchased from Proteintech company, SA00003-02) (1:1000 dilution), 100 μL / well, avoid light for 1 h; 9) washing: wash with PBST for 3 times, 5 min each time; 10) cell nucleus staining: discard the washing solution, add DAPI solution (1:1000 dilution), avoid light for 15 min; 11) washing: wash with PBST for 3 times, 5 min each time; 12) observation and analysis: observe and take pictures of the fluorescence of the cells under a fluorescence microscope. Use ImageJ software to dataize the image results and calculate and analyze.

[0063] 2. Flow cytometry analysis

[0064] 293T cells (ATCC: ACS-4500) were seeded into 24-well cell plates one day before transfection. When the cells reached 80-90% confluence, they were transfected. 1 μg of each mRNA sequence (0901-GPC, 0902-GPC, 0903-NP, 0904-NP, 0905-GFN, 0906-GFN, 0907-GTN, and 0908-GTN) was added to a 1.5 mL centrifuge tube containing Opti-MEM medium (Thermo Fisher Scientific, 11995065) to a final volume of 25 μl. Meanwhile, 2 μl of Lipofectamine™ 2000 (Thermo Fisher Scientific, 11668019) was added to a 1.5 mL centrifuge tube containing 25 μl of Opti-MEM medium, mixed gently, and incubated at room temperature for 15 min. The 293T cells were washed slowly with sterile PBS solution 3 times, 1 mL each time, and then 450 μl of Opti-MEM medium was added to each well. The mRNA and liposome mixture incubated at room temperature was added to the cell culture wells. The cells were incubated at 37°C for 18-24 h. The cells were collected for subsequent experiments.

[0065] In this study, the indirect immunofluorescence assay (IFA) and flow cytometry method were used to evaluate the effect of codon optimization strategies based on Peptide (0901-GPC) and Jcat (0902-GPC) on the protein expression efficiency of GPC mRNA. Since GPC (glycoprotein precursor) is hydrolyzed into Gn and Gc heterodimers after intracellular expression, the protein expression efficiency of Gn and Gc represents the protein expression efficiency of GPC mRNA. The IFA detection results showed that both codon-optimized GPC mRNAs successfully induced Gn and Gc protein expression after transfecting HEK293T cells. Figure 2 A). Flow cytometry quantitative analysis results showed that after the FITC-labeled antibody specifically recognized Gn or Gc protein, the Gn and Gc positive cell rates of the Peptide codon-optimized group were 28.47% and 30.16%, respectively, which were higher than the 23.30% and 25.78% of the Jcat codon-optimized group. Figure 2 B). The above results showed that the codon optimization strategy of Peptide improved the protein expression efficiency of GPC mRNA, and its effect was slightly better than that of the Jcat optimization strategy.

[0066] The effects of codon optimization strategies based on Peptide (0903-NP) and Jcat (0904-NP) on NP mRNA protein expression efficiency were evaluated using IFA and flow cytometry. IFA results showed that both codon-optimized NP mRNAs successfully induced NP protein expression in HEK293T cells. Figure 3 A). Flow cytometry quantitative analysis showed that after the FITC-labeled antibody specifically recognized the NP protein, the NP-positive cell rate was 43.54% in the Peptide codon-optimized group and 45.85% in the Jcat codon-optimized group. Figure 3 B). The above results indicate that both the Peptide and Jcat codon optimization strategies can successfully express the target protein from NP mRNA. The similar protein expression efficiency between the two optimization strategies suggests consistency in NP gene sequence optimization across different codon optimization methods. This phenomenon may be related to the high conservation of NP proteins and the insensitivity of their mRNA sequence translation efficiency to codon bias.

[0067] The effects of codon optimization strategies based on Peptide (0905-GFN) and Jcat (0906-GFN) on the expression efficiency of Gn, Gc, and NP proteins in GFN sequences (GPC-(G4S1)4 –NP sequences in Table 1) were systematically evaluated using IFA and flow cytometry. IFA results showed ( Figure 4 A) Both codon-optimized GFN mRNA transfections successfully induced the expression of the target protein in HEK293T cells. Flow cytometry quantitative analysis showed that ( Figure 4 In group B, the percentages of Gn, Gc, and NP positive cells in the Peptide-optimized group were 14.55%, 23.97%, and 30.78%, respectively, while those in the Jcat-optimized group were 17.37%, 19.79%, and 36.86%. Notably, both optimization strategies achieved efficient co-expression of the three proteins in the GFN sequence, with protein expression efficiency exhibiting a gradient characteristic of NP>Gc>Gn. This phenomenon may be related to the translation initiation efficiency of each protein, differences in mRNA secondary structure, and host cell translation preferences. The results of this study not only validate the effectiveness of codon optimization strategies in GFN mRNA vaccine design but also provide important reference for improving the efficiency of multi-protein co-expression during vaccine design.

[0068] The effects of the codon optimization strategies based on Peptide (0907-GTN) and Jcat (0908-GTN) on the expression efficiency of Gn, Gc, NP proteins in GTN sequence (the Peptide codon-optimized GPC-T2A-NP sequence and the Jcat codon-optimized GPC-T2A-NP sequence in Table 1) were evaluated by IFA and flow cytometry methods. The IFA detection results showed that Gn, Gc, NP proteins were successfully induced to express after the two codon-optimized GTN mRNA were transfected into HEK293T cells Figure 5 A). The flow cytometry quantitative analysis results showed that the percentage of Gn, Gc, NP positive cells in the Peptide optimization group was 17.00%, 26.43% and 29.61% respectively, and the corresponding values in the Jcat optimization group were 12.58%, 21.43% and 22.61% respectively, which were significantly higher than those in the blank LNP control group Figure 5 B). The above results showed that the codon optimization strategies of Peptide and Jcat could make GTN mRNA successfully express Gn, Gc, NP proteins. It is worth noting that the Peptide optimization strategy had certain advantages in the expression efficiency of the three proteins, indicating that the Peptide optimization strategy was more suitable for the sequence design of GTN mRNA. The above experimental results verified the effectiveness of the codon optimization strategy in improving the expression efficiency of mRNA vaccine candidate molecules, and provided important theoretical basis for subsequent animal experiments.

[0069] According to the above codon optimization strategy evaluation results of the present study, four mRNA sequences (0901-GPC, 0903-NP, 0905-GFN, 0907-GTN) based on the Peptide algorithm optimization were included in the subsequent experimental research.

[0070] Example 3 Preparation of SFTSV mRNA vaccine preparation

[0071] Organic phase (lipid) preparation: four lipid components were selected, namely ionizable cationic lipid SM-102, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), cholesterol and DMG-PEG 2000. These lipids were dissolved in anhydrous ethanol according to the molar ratio of 50:10:38.5:1.5 to obtain the organic phase. Aqueous phase (nucleic acid) preparation: each mRNA sequence was dissolved in a weakly acidic citric acid buffer (pH = 4.5) to obtain the aqueous phase. Microfluidic device preparation: the organic phase pump and the aqueous phase pump of the microfluidic instrument were cleaned with anhydrous ethanol and citric acid buffer, respectively. Microfluidic mixing: the organic phase solution and the aqueous phase solution were injected into the injection pumps of the microfluidic chip, and the two-phase solution was uniformly mixed by the microfluidic chip according to the flow rate ratio of 5:1 of the aqueous phase and the organic phase, and the mixed solution (i.e. LNP solution) was collected. Dilution: the collected LNP solution was diluted with purified water to 10 times the original volume. Ultrafiltration concentration: the diluted LNP solution was further subjected to an ultrafiltration concentration step to remove residual ethanol and unencapsulated free mRNA. The concentrated LNP solution was temporarily stored at 2-8°C for standby. Dynamic light scattering method was used to detect the particle size and polydispersity index (PDI) of the LNP. Fluorescent dye method was used to detect the encapsulation efficiency of the LNP.

[0072] Based on the research of Example 2, 0901-GPC, 0903-NP, 0905-GFN and 0907-GTN SFTSV mRNA sequences were selected, and after being wrapped with nanoliposomes, GPC-LNP (0901), NP-LNP (0903), GFN-LNP (0905) and GTN-LNP (0907) vaccines were prepared. The nanoliposome without wrapping mRNA was used as a control (LNP), and the particle size was determined by Malvern laser particle size analyzer and the encapsulation efficiency was determined by fluorescence quantitative detection method. The experimental results are shown in Figure 6 A and Figure 6 B, the average particle size of the prepared LNP, GPC-LNP, NP-LNP, GFN-LNP and GTN-LNP was 91.0 nm, 93.6 nm, 86.6 nm, 87.5 nm and 85.8 nm, respectively, and the particle size dispersion index was less than 0.3. The encapsulation efficiency of SFTSV mRNA vaccine is shown in Figure 6 C, the average encapsulation efficiency of the prepared GPC-LNP, NP-LNP, GFN-LNP and GTN-LNP was 96.23%, 97.73%, 95.97% and 96.35%, respectively. The above results show that the prepared SFTSV mRNA vaccine has appropriate particle size, uniform particle size distribution and high encapsulation efficiency.

[0073] Example 4 Immunogenicity analysis of SFTSV mRNA vaccine formulation

[0074] 1. Animal grouping and immunization

[0075] Two batches of mice were used to verify the immunogenicity of the SFTSV mRNA candidate vaccine formulation, as follows:

[0076] First batch: To verify the immunogenicity of the prepared SFTSV mRNA candidate vaccine formulation with different antigen expression forms, 18 healthy female 6-week-old SPF C57BL / 6J mice (Jiangsu Huacheng Xinnuo Pharmaceutical Technology Co., Ltd.) were selected, 3 mice per group, divided into GPC-LNP group, NP-LNP group, GFN-LNP group and GTN-LNP group, Mix group (GPC-LNP and NP-LNP mixed at a molar ratio of 1:1), and LNP control group. The mice were adaptively fed in the SPF animal room of the Department of Life Sciences and Medicine, University of Science and Technology of China, for one week. The vaccine formulation was inoculated by intramuscular injection, 10 μg / 100 μL per mouse. The mice were boosted once by the same immunization route and dose at 21 days after the first immunization. Peripheral venous blood was collected by orbital venous longitudinal collection before immunization, and at 4 weeks and 10 weeks after the first immunization. After the serum was separated, the SFTSV-Gn, SFTSV-Gc and SFTSV-NP specific IgG antibody titers in the serum were detected by enzyme-linked immunosorbent assay (ELISA).

[0077] Second batch: Based on the first batch of animal experiments, the mice were immunized to verify the humoral and cellular immune effects of the SFTSV mRNA candidate vaccine formulation. Thirty-five healthy female 6-week-old SPF C57BL / 6J mice were selected, 5 mice per group, divided into GPC-LNP group (1 μg per mouse), NP-LNP group (1 μg per mouse), GFN-LNP high-dose group (5 μg per mouse), GFN-LNP medium-dose group (1 μg per mouse), GFN-LNP low-dose group (0.2 μg per mouse), Mix group (GPC-LNP and NP-LNP mixed at a molar ratio of 1:1), and LNP control group. The mice were adaptively fed in the SPF animal room of the Department of Life Sciences and Medicine, University of Science and Technology of China, for one week. The vaccine formulation was inoculated by intramuscular injection. The mice were boosted once by the same immunization route and dose at 21 days after the first immunization. Peripheral venous blood was collected by orbital venous longitudinal collection before immunization, and at 31 days after the first immunization. After the serum was separated, the SFTSV-Gn, SFTSV-Gc and SFTSV-NP specific IgG antibody titers in the serum were detected, as well as the SFTSV neutralizing antibody titer. At 10 days after the booster, the mice were sacrificed after anesthesia, and the spleen lymphocytes were isolated to detect the cellular immunology index.

[0078] 2. Serum binding antibody titer determination

[0079] The specific IgG antibody titers of SFTSV Gn, Gc and NP proteins in the serum of mice at different time points after the first immunization were detected by indirect ELISA method, and the specific steps were as follows: 1) coating the enzyme-labeled plate: SFTSV Gn (GenBank: KY440776.1, 20-340 aa), Gc (GenBank: KY440776.1, 563-996 aa) and NP (GenBank: OM451688.1, 1-245 aa) proteins (Gn, Gc and NP proteins were expressed by HEK293F cells (obtained from Professor JinTengchuan of China University of Science and Technology) in the laboratory, and were obtained after nickel column (Bio-Works, 40653001) purification, wherein the SFTSV-Gn, SFTSV-Gc and SFTSV-NP proteins can be prepared by a person skilled in the art through conventional operation) were diluted to 1 μg / mL with PBS solution, added to the enzyme-labeled plate, 100 μL / well, and incubated at 4°C overnight; 2) washing the plate: discard the liquid in the hole, wash the plate with PBST solution 3 times, 200 μL / well each time; 3) blocking: add 200 μL of blocking buffer (PBS + 5% skimmed milk powder) to each well, and block at room temperature for 1 h; 4) serum sample incubation: dilute the serum sample, the initial dilution is 1:50, and then dilute by 3 times gradient, add the diluted serum sample, 100 μL / well, and incubate at room temperature for 1 h; 5) washing the plate: discard the liquid in the hole, wash the plate with PBST solution 3 times, 200 μL / well each time; 6) secondary antibody incubation: add the diluted HRP-labeled goat anti-mouse IgG (H+L) antibody solution (proteintech, SA00001-1) (1:10 000 dilution), 100 μL / well, and incubate at room temperature for 1 h; 7) washing the plate: discard the liquid in the hole, wash the plate with PBST solution 3 times, 200 μL / well each time; 8) color development: add TMB color developing solution, 100 μL / well, avoid light, incubate for 10 min, then add 2M H2SO4 to terminate the reaction, 50 μL / well; 9) plate reading: use the enzyme-labeled instrument to read the OD450 value of each well. The absorbance value greater than 2.1 times the OD450 value of the negative control well is considered to be positive.

[0080] The first batch was to verify the immunogenicity of the prepared different antigen expression form SFTSV mRNA candidate vaccine preparation. The experimental results are shown in Figure 7 Table 2, the OD450 values of SFTSV-Gn and SFTSV-Gc specific IgG antibodies in the serum of GPC-LNP group, GFN-LNP group, GTN-LNP group and Mix group mice at 1:300 dilution were extremely significantly higher than those of LNP control group mice at 4 weeks and 10 weeks after the first immunization (p<0.0001)Figure 7 A and Figure 7 B). The OD450 values of the sera of the GPC-LNP group, the NP-LNP group, the GFN-LNP group and the Mix group mice at 4 weeks and 10 weeks after the first immunization were extremely significantly higher than the OD450 values of the sera of the LNP control group mice (p<0.0001), but there was no significant difference between the OD450 values of the sera of the GTN-LNP group mice and the LNP control group (p>0.05) (Fig. 2C). Figure 7 C). The above results show that the GPC-LNP, the NP-LNP, the GFN-LNP and the Mix vaccines can all successfully produce specific IgG antibodies against the target antigens in mice, while the GTN-LNP vaccine only produces specific IgG antibodies against SFTSV-Gn and SFTSV-Gc, but does not produce SFTSV-NP specific IgG antibodies. Therefore, the GPC-LNP, the NP-LNP and the GFN-LNP vaccines are selected for further experimental research.

[0081] Further, on the basis of the first batch of animal experiments, mice were immunized to verify the humoral and cellular immune effects of the SFTSV mRNA candidate vaccine formulations. The SFTSV-Gn, SFTSV-Gc and SFTSV-NP specific IgG antibody titers in the sera of mice at 31 days after immunization with the SFTSV mRNA vaccine were determined by ELISA. As shown in Fig. 3, Figure 8 The GPC-LNP, the NP-LNP, the Mix and the GFN-LNP vaccines can all successfully produce specific IgG antibodies against the target antigens in mice, which is consistent with the results of the first batch of mice experiments. At the same time, the levels of SFTSV-Gn, SFTSV-Gc and SFTSV-NP specific IgG antibodies produced by the mice in the different GFN-LNP immunization dose groups have a certain dose dependence. Among them, the level of SFTSV-Gn specific IgG antibodies gradually increases with the increase of the GFN-LNP immunization dose, and the serum IgG antibody level of the 5 μg / mice group is significantly higher than that of the 0.2 μg / mice group (p<0.05) (Fig. 3A). Figure 8 A). The levels of SFTSV-Gc and SFTSV-NP specific IgG antibodies gradually increase with the increase of the GFN-LNP immunization dose, and the serum SFTSV-Gc specific IgG antibody level of the 1 μg / mice group is extremely significantly higher than that of the 0.2 μg / mice group (p<0.0001) (Fig. 3B), and the serum SFTSV-NP specific IgG antibody level of the 1 μg / mice group is extremely significantly higher than that of the 0.2 μg / mice group (p<0.01) (Fig. 3B). Figure 8 B), and the serum SFTSV-NP specific IgG antibody level of the 1 μg / mice group is extremely significantly higher than that of the 0.2 μg / mice group (p<0.01) (Fig. 3B). Figure 8C). However, there was no significant difference in the levels of SFTSV-Gc and SFTSV-NP specific IgG antibodies between the 5 μg / mouse group and the 1 μg / mouse group (p>0.05) Figure 8 B and Figure 8 C). The above results indicate that the GPC-LNP, NP-LNP, Mix, and GFN-LNP vaccines can successfully produce specific IgG antibodies against the antigens of interest in mice at an immunization dose of 1 μg / mouse. In addition, at the same dose, the levels of SFTSV-Gn, SFTSV-Gc, and SFTSV-NP specific IgG antibodies produced by the GFN-LNP group mice were significantly higher than those of the Mix group.

[0082] 3. Serum neutralizing antibody titer assay

[0083] The neutralizing antibody titer level of the serum of the immunized mouse is determined by indirect immunofluorescence-high content analysis system, and the specific steps are as follows: 1) serum inactivation: after the mouse serum is taken out from the-80℃ refrigerator, it is inactivated in a 56℃ water bath for 30 min and then centrifuged instantaneously; 2) cell observation: the Vero cells (Biodivision Biotech Co., Ltd., C5168) cultured overnight are observed under a microscope, and the experiment is started when the cell confluence reaches about 70-80%; 3) serum dilution: 5 μL of the inactivated serum is taken and added into a 96-well U-shaped plate containing 145 μL of DMEM medium, mixed well, and then 50 μL is added into the next well containing 100 μL of DMEM medium for 3-fold dilution, 50 μL is added into the next well containing 100 μL of DMEM medium, and the 3-fold dilution is sequentially performed to the 6th well, and then 50 μL of the 6th well is discarded; 4) virus liquid dilution: the virus liquid (SFTSV HB29 strain obtained from the Wuhan Institute of Virology, Chinese Academy of Sciences, and stored in the Laboratory of New Vaccine and Antiviral Drug Research and Development, China University of Science and Technology) is diluted to a final concentration of 200 TCID50 / 50 μL; 5) incubation: the diluted virus liquid is added into the diluted serum solution at a ratio of 1:1, 100 μL / well, and incubated at 37℃ for 1 h; 6) cell infection: the cell culture supernatant is discarded, and the serum-virus mixed solution after incubation is added, 50 μL / well, 3 repeats / dilution, and virus control and cell control are made, and incubated at 37℃ for 1 h; 7) medium replacement: the serum-virus mixed solution is discarded, and incomplete medium is added, 50 μL / well; 8) culture: the cell plate is placed in a 5% carbon dioxide incubator for culture for 48-72 h; 9) cell fixation: the culture supernatant of the 96-well plate is discarded, and general tissue fixing solution is added, 200 μL / well, and the cells are fixed at room temperature for 30 min; 10) cell washing: the cells are washed with PBST for 3 times, 200 μL / well; 11) blocking: the cells are blocked with PBS solution containing 5% skimmed milk powder (blocking solution), 100 μL / well, and incubated at 37℃ for 30 min; 12) cell washing: the cells are washed with PBST for 3 times, 200 μL / well; 13) incubation of primary antibody: the SFTSV-NP rabbit hyperimmune serum obtained in Example 2 is diluted with the blocking solution containing 2% skimmed milk powder (1:1000 dilution), 50 μL / well, and incubated at 37℃ for 1 h; 14) cell washing: the cells are washed with PBST for 3 times, 200 μL / well; 15) incubation of secondary antibody: the washing solution is added with FITC-labeled goat anti-rabbit IgG (H+L) antibody (purchased from Proteintech Co., Ltd., SA00003-02) (1:1000 dilution), 50 μL / well, and incubated at 37℃ for 1 h; 16) cell washing: the cells are washed with PBST for 3 times, 200 μL / well; 17) DAPI staining: DAPI is diluted with PBS (1:1000 dilution), 50 μL / well, and incubated at room temperature for 5 min;18) Observation and analysis: Take and analyze images using a high-content cell imaging analysis system.

[0084] The results are as follows Figure 9 As shown, on day 31 after the initial immunization (i.e., 10 days after the booster immunization), the serum SFTSV neutralizing antibody titers in mice immunized with different doses of GPC-LNP, Mix, and GFN-LNP were 1:2113, 1:832, 1:60 (detection line), 1:162, and 1:3973, respectively. The SFTSV neutralizing antibody titers produced by mice immunized with different doses of GFN-LNP showed a dose-dependent effect. Specifically, the serum SFTSV neutralizing antibody titer in the 5 μg / mouse group was significantly higher than that in the 1 μg / mouse and 0.2 μg / mouse groups (p < 0.0001), and no SFTSV neutralizing antibody was detected in the serum of mice immunized with the 0.2 μg / mouse group (detection line). These results indicate that GP-LNP, Mix, and GFN-LNP vaccines can successfully produce high levels of SFTSV neutralizing antibodies in mice, and the level of neutralizing antibodies produced by mice immunized with the GFN-LNP vaccine is dose-dependent. Furthermore, at the same dose, the neutralizing antibody level of the GFN-LNP vaccine was significantly better than that of the Mix group.

[0085] 4. Detection of cellular immune responses

[0086] On day 10 after booster immunization, three mice were randomly selected from each group, euthanized by cervical dislocation, and their spleen lymphocytes were isolated after soaking in 75% alcohol for 10 min. The specific steps were as follows: 1) Spleen collection: In a biosafety cabinet, the abdominal skin was cut open with scissors, and the spleen tissue was separated and placed in PBS solution containing 2% FBS; 2) Spleen tissue grinding: PBS solution containing 2% FBS was added to a 6-well cell plate, 1 mL / well. The spleen tissue was ground on a sterile filter using a 5 mL syringe core to separate spleen lymphocytes, and the filter membrane was washed with 1 mL PBS solution; 3) Centrifugation: The washed solution was transferred to a 15 mL centrifuge tube and centrifuged at 800 g for 8 min at 4°C. The supernatant was discarded; 4) Red blood cell lysis: The supernatant was aspirated, and red blood cell lysis buffer was added, 1 mL / sample. Lysis was performed at room temperature for 8 min, and lysis was terminated with 11 mL PBS solution; 5) Centrifugation: Centrifugation was performed at 800 g for 8 min at 4°C. The supernatant was discarded; 6) Cell counting: The cell pellet was resuspended in PBS solution, and 1 mL / well was used to count the cells. mL / sample, filtered and transferred to a 1.5 mL EP tube, 10 μL / sample was added to 1000 μL of PBS solution (100-fold dilution), and the cell concentration was determined using a cell counting instrument.

[0087] Mouse IFN-γ (Mabtech, 3321-4HPW-2), TNF-a (Mabtech, 3511-4HPW-2), IL-2 (Mabtech, 3441-4HPW-2) and IL-4 ELISpot (Mabtech, 3311-4HPW-2) kits were used to detect the cytokine secretion of splenocytes according to the instructions. The specific steps are as follows: 1) washing: wash the ELISpot plate with sterile PBS solution 4 times, 200 μL / well; 2) incubation: discard the PBS solution, add RPMI1640 culture solution containing 10% FBS, 200 μL / well, incubate at room temperature for 30 min; 3) add cells: discard the culture solution, add the spleen lymphocyte suspension with a cell density of 2.5×10 6 cells / mL, 200 μL / well, and add SFTSV-GP and SFTSV-NP peptide library (Kings River Biotechnology Co., Ltd., 15 polypeptides / strip, 10 amino acid repeats, purity > 85%), with a final concentration of 2 μg / mL per polypeptide, and set up negative control wells without stimulants and positive control wells with PMA (Phorbol ester) as stimulants, and incubate in a 37°C, 5% CO2 cell incubator for 24-36 h; 4) washing: discard the culture solution and wash with PBS 5 times, 200 μL / well; 5) incubate the primary antibody: dilute the detection antibody (in the kit) to a final concentration of 1 μg / mL, 100 μL / well, and incubate at room temperature for 2 h; 6) washing: discard the liquid and wash the plate with PBS 5 times, 200 μL / well; 7) incubate the secondary antibody: dilute the alkaline phosphatase (ALP) and streptavidin (Streptavidin-ALP) conjugate (1:1 000 dilution) (in the kit), 100 μL / well, and incubate at room temperature for 1 h; 8) washing: discard the liquid and wash the plate with PBS 5 times, 200 μL / well; 9) color development: take the filtered BCIP / NBT-plus substrate solution, 100 μL / well, and incubate at room temperature in the dark until obvious spots appear; 10) termination: terminate color development by washing the plate with tap water and air dry at room temperature; 11) read the plate: use the ELISpot plate reader to collect and read the spots in each well.

[0088] ELISpot assay (as described above) was used to analyze the cytokine secretion of splenocytes Figure 10 and Figure 11As shown in Figure 6, the spleen cells of mice immunized with GFN were able to significantly secrete various cytokines, including IL-2, IL-4, IFN-γ and TNF-α, when stimulated by GPC peptide pool. This indicates that GFN immunization can effectively activate the immune response of mice, promoting the synergistic effect of Th1 and Th2 type immune response. In addition to IL-4, the spleen of mice immunized with GP can also significantly secrete various cytokines after being stimulated by the peptide pool. In addition, it is noted that the SFC of GFN-5 group is lower than that of GFN-1 group, indicating that GFN immunization can inhibit the activation of immune cells stimulated by the peptide pool to a certain extent. In addition, under the same dose, the GFN-LNP vaccine secretes various cytokines significantly better than the Mix group.

[0089] Example 5 Evaluation of the protection effect of SFTSV mRNA vaccine preparation challenge

[0090] 1. Mouse immunization and challenge

[0091] Forty-eight 6-10 week old healthy female A129 mice (obtained from the Wuhan Institute of Virology, Chinese Academy of Sciences, after biological purification and gene screening by the Experimental Animal Center of the University of Science and Technology of China, and bred and bred in the SPF animal room of the Department of Life Sciences and Medicine of the University of Science and Technology of China) were randomly divided into 6 groups, 8 mice per group, namely GPC-LNP group, NP-LNP group, GFN-LNP group, Mix group, LNP group and PBS group. Vaccines were inoculated by intramuscular injection, 5 μg / 100 μL / mouse. The same immunization route and dose were used for booster immunization 21 days after the first immunization. Fourteen days after the booster immunization, 10,000 LD50 of SFTSV HB29 strain virus liquid (GenBank: GCA_000897355.1, 100 TCID50) was infected by intraperitoneal injection, and the strain was obtained from the Wuhan Institute of Virology, Chinese Academy of Sciences. After virus infection, the clinical symptoms of mice were observed every day, the body weight change and survival rate of mice were monitored, etc. Three mice were randomly selected from each group on the 4th day after infection, and anticoagulated blood was collected from the orbital venous plexus. Hematology index changes were detected by animal blood routine analysis instrument; mice were sacrificed under isoflurane anesthesia and decapitated, and their spleen, liver, heart, lung, kidney, brain were taken, 2 parts / sample, one part was used for tissue fixation for H&E and immunohistochemistry, and the other part was used for tissue grinding to determine tissue virus copy and tissue virus titer.

[0092] 2. Clinical symptoms after infection

[0093] The changes in body weight and survival rate of mice in each vaccine preparation group after SFTSV infection are as follows Figure 12The body weight of mice in the PBS group, LNP group and NP-LNP group rapidly decreased after SFTSV infection, and the body weight of mice in the NP-LNP group gradually increased on the 4th day after infection, while the body weight of mice in the other two groups continuously decreased to more than 20% of the initial body weight (the animals were euthanized). The body weight of mice in the GPC-LNP group, GFN-LNP group and Mix group did not significantly decrease after SFTSV infection, and the body weight change was in a stable state Figure 12 A). Meanwhile, the mice in the PBS group, LNP group and NP-LNP group died on the 4th day after SFTSV infection. On the 6th day after infection, all mice in the PBS group and LNP group died, with a mortality rate of 100% (5 / 5). During the entire monitoring period, the mortality rate of mice in the NP-LNP group was 80% (4 / 5), and no death was observed in mice in the GPC-LNP group, GFN-LNP group and Mix group, and all mice survived. The above results show that the GPC-LNP vaccine, GFN-LNP vaccine and Mix vaccine can protect mice from body weight loss after SFTSV infection and resist SFTSV lethal dose challenge, with a survival rate of 100%.

[0094] 3. Viral copy determination

[0095] Take 50 μL of the supernatant of the centrifuged tissue, add 200 μL of Trizol reagent, and inactivate the virus; use the automatic nucleic acid extractor and the DNA / RNA extraction kit according to the instructions for automatic RNA extraction; qRT-PCR method for detecting lung tissue viral load: use the dye method qRT-PCR reagent kit HiScript II One Step qRT-PCR SYBR Green Kit of Nanjing Novelz Biological Technology Co., Ltd., and the steps are as follows:

[0096] ① Dilution of standard plasmid

[0097] Take 6 clean RNase-Free 1.5 mL centrifuge tubes, label tubes 1-6, dilute the plasmid using the fluorescent PCR special template diluent, and 6 tubes contain 1x10 8 copies / μL of standard NP plasmid (pUC57-NP, NP gene from GenBank: OM451688.1), and sequentially dilute by 10 times, to finally prepare 6 gradient-diluted standard samples.

[0098] ② Preparation of qRT-PCR reaction system

[0099] Prepare the reaction system in an RNase-free centrifuge tube, with a volume of 20 μL (Table 3). After preparation, mix thoroughly, and centrifuge momentarily to make the sample at the bottom of the tube.

[0100] Table 3 qRT-PCR reaction system

[0101]

[0102] Specific primer F: 5'-ACCTGTCTCCTTCAGCTTCT-3';

[0103] Specific primer R: 5'-TGTCAGAGTGGTCCAGGATT-3';

[0104] ③ Set qRT-PCR reaction program

[0105] Place the reaction system in the fluorescence quantitative PCR instrument hole plate, mark the position of the sample, set the reaction program according to the following parameters, and export the data for analysis after amplification.

[0106] Table 4 qRT-PCR reaction program

[0107]

[0108] The changes of SFTSV virus copies in major internal organs such as spleen, kidney, lung, heart, liver and brain, and blood are shown in Table 4. Figure 13 As shown in Table 4, high copies of SFTSV virus genes were detected in all tissue samples of the PBS group and the LNP group, among which the virus content in the spleen tissue was the highest, about 10 10 copies / g, and the virus content in the brain tissue was the lowest, about 10 6 copies / g; The virus copies in each tissue sample (except blood and brain) of the GPC-LNP vaccine, GFN-LNP vaccine and Mix vaccine immunized mice were significantly lower than those of the PBS group and the LNP group; In the spleen, kidney, lung and liver of the GFN-LNP vaccine group mice, no SFTSV virus genes were detected (lower than the detection line 1920); In the spleen, lung and liver of the GP-LNP vaccine group mice, no SFTSV virus genes were detected; In the spleen and lung of the Mix vaccine group mice, no SFTSV virus genes were detected; The SFTSV virus gene copies in the spleen of the NP-LNP vaccine group mice were significantly lower than those of the PBS group (p<0.05) and the LNP group (p<0.05). The above results show that the GPC-LNP vaccine, GFN-LNP vaccine and Mix vaccine immunized mice can reduce the virus copies in the major internal organs after SFTSV infection, and the GFN-LNP vaccine is better than the GPC-LNP vaccine.

[0109] 4. Virus content in tissues

[0110] To detect the protective effect of different vaccine preparations on SFTSV infection after immunization, the viral content in the tissues was determined by indirect immunofluorescence method, and the specific steps were as follows:

[0111] On the 4th day after infection of the mice, 3 mice / group were randomly selected, anesthetized with isoflurane, and their spleen, liver, heart, lung, kidney, brain were taken, respectively, and put into 2 mL EP tubes, and a steel ball and 1 mL DMEM medium were added. After grinding, the supernatant was collected after centrifugation at 13,000 g for 10 min at 4°C.

[0112] Vero cells (Biodot Biotech Co., Ltd., C5168) cultured overnight were observed under a microscope, and the experiment was started when the cell confluence reached about 70-80%; 30 μL / sample of tissue supernatant after centrifugation was added to a 96-well U-shaped plate containing 270 μL of DMEM medium, mixed well, and 30 μL was added to the next well containing 270 μL of DMEM medium for 10-fold dilution, 30 μL was added to the next well containing 270 μL of DMEM medium, and the 10-fold dilution was sequentially performed to the 4th well; the cell culture solution was discarded, and 50 μL / well of the supernatant after dilution of the sample was added, with 4 replicates / dilution; the cells with diluted virus solution were placed in a 37°C cell incubator for 1 h; the serum-virus mixed solution was discarded, and 50 μL / well of incomplete medium was added; the cell plate was placed in a 5% carbon dioxide incubator for culture for 48-72 h; the culture supernatant of the 96-well plate was discarded, 200 μL / well of general tissue fixative was added, and the cells were fixed at room temperature for 30 min; the cells were washed with PBST 3 times, 200 μL / well; the cells were blocked with PBS containing 5% skimmed milk powder (blocking solution), 100 μL / well, at 37°C for 30 min; the cells were washed with PBST 3 times, 200 μL / well; the SFTSV-NP rabbit hyperimmune serum obtained in Example 2 was diluted with the blocking solution containing 2% skimmed milk powder (1:1000 dilution), 50 μL / well, and reacted at 37°C for 1 h; the cells were washed with PBST 3 times, 200 μL / well; the washing solution was added, FITC-labeled goat anti-rabbit IgG (H+L) antibody (purchased from Proteintech Co., Ltd., SA00003-02) was diluted (1:1000 dilution), 50 μL / well, and reacted at 37°C for 1 h; the cells were washed with PBST 3 times, 200 μL / well; DAPI was diluted with PBS (1:1000 dilution), 50 μL / well, and reacted at room temperature for 5 min; whether there was fluorescence in each well was recorded under a fluorescence microscope, and the fluorescence was marked "+" and the non-fluorescence was marked "-"; and the virus titer was calculated by the Reed-Muench method.

[0113] The changes of SFTSV virus titers in the main internal organs such as spleen, kidney, lung, heart, liver and brain, and blood were as followsFigure 14 As shown in FIG. 6, infectious SFTSV virus particles were detected in the major internal organs of the PBS group and LNP group mice, including the spleen, kidney, lung, and heart, with the highest viral titer in the spleen, about 10 5 TCID50 / g. No infectious SFTSV virus particles were detected in the major internal organs of the GPC-LNP vaccine, GFN-LNP vaccine, and Mix vaccine immunized mice, which were significantly lower than the corresponding tissues of the PBS group and LNP group (p<0.0001). The above results show that the GPC-LNP vaccine, GFN-LNP vaccine, and Mix vaccine immunized mice can significantly reduce the viral titer of the major internal organs after SFTSV infection.

[0114] 5. Histopathological changes and viral distribution

[0115] The isolated tissues were immediately fixed in a 4% paraformaldehyde solution (Servicebio, G1101-500ML), then dehydrated with an ethanol gradient, and embedded in paraffin. Sections (4 μM thick) were cut from the paraffin, dried at 60°C, then deparaffinated, and treated with 3% hydrogen peroxide water solution for 10 min to inactivate endogenous peroxidase. The anti-SFTSV NP protein rabbit hyperimmune serum obtained in Example 2 was then used as a primary antibody, diluted at a ratio of 1:1000, and added to the sections, and incubated for 30 min. Color development was performed using an Envision®+ anti-rabbit horseradish peroxidase (HRP) labeled polymer detection system (Dako, USA), with diaminobenzidine (DAB) as the color development substrate, and finally, Gill's hematoxylin was used for counterstaining.

[0116] The major internal organs, including the spleen, kidney, lung, and heart, were detected for SFTSV NP protein positive reactions by IHC staining. The experimental results are shown in FIG. 7. Figure 15 As shown in FIG. 7, the major internal organs of the LNP group mice, including the spleen, kidney, lung, and heart, showed dark brown color, with the spleen tissue having a larger dark brown area. The spleen and heart tissues of the Mix group mice showed dark brown color, and the remaining tissues did not show dark brown color. The heart tissue of the GPC-LNP vaccine immunized mice showed a small amount of dark brown color. No dark brown color was detected in the internal organs of the GFN-LNP vaccine mice. The above results show that the GPC-LNP vaccine, GFN-LNP vaccine, and Mix vaccine immunized mice can reduce the infiltration of the major internal organs after SFTSV infection, and the GFN-LNP vaccine is superior to the GPC-LNP vaccine and Mix vaccine.

[0117] 6. Changes in major blood routine indicators

[0118] On the 4th day after infection, 3 mice were randomly selected from each group, and the anticoagulated blood was collected from the orbital plexus. The hematological index changes were detected by animal blood routine analysis instrument.

[0119] Results as shown in Figure 16 The results showed that compared with the normal control group mice (Normal), the platelet count of the PBS group and the LNP group mice was extremely significantly reduced (p<0.0001), the percentage of lymphocytes was extremely significantly reduced (p<0.0001), and the percentage of neutrophils was extremely significantly increased (p<0.0001) after SFTSV infection; the percentage of lymphocytes and the percentage of neutrophils of the NP-LNP group mice had no significant difference (p>0.05) with the normal control group mice (Normal) except that the platelet count was extremely significantly reduced (p<0.0001); the platelet count and the percentage of lymphocytes of the GPC-LNP group mice were slightly reduced, and the percentage of neutrophils was slightly increased after SFTSV infection, but there was no significant difference (p>0.05) with the normal control group mice (Normal); the percentage of lymphocytes and the percentage of neutrophils of the GFN-LNP and Mix group mice had no change after SFTSV infection except that the platelet count was slightly reduced. The above results showed that the A129 mice could appear significant reduction of platelet count and percentage of lymphocytes, and significant increase of percentage of neutrophils after SFTSV infection, and the GPC-LNP, NP-LNP, GFN-LNP and Mix vaccines could reduce the changes of blood routine indexes after SFTSV infection, and the GFN-LNP had better effect than the Mix group.

[0120] SEQUENCE LISTING

[0121] SEQ ID NO: 1 0901-GPC base sequence

[0122]

[0123] SEQ ID NO:2 0902-GPC base sequence

[0124]

[0125] SEQ ID NO:3 0903-NP base sequence

[0126] ATGTCCGAGTGGTCCCGGATCGCCGTGGAGTTCGGCGAGCAGCAGCTGAACCTGACCGAGCTGGAGGACTTCGCCCGGGAGCTGGCCTACGAGGGCCTGGACCCCGCCCTGATCATCAAGAAGCTGAAGGAGACCGGCGGCGACGACTGGGTGAAGGACACCAAGTTCATCATCGTGTTCGCCCTGACCCGGGGCAACAAGATCGTGAAGGCCTCCGGCAAGATGTCCAACTCCGGCTCCAAGCGGCTGATGGCCCTGCAGGAGAAGTACGGCCTGGTGGAGCGGGCCGAGACCCGGCTGTCCATCACCCCCGTGCGGGTGGCCCAGTCCCTGCCCACCTGGACCTGCGCCGCCGCCGCCGCCCTGAAGGAGTACCTGCCCGTGGGCCCCGCCGTGATGAACCTGAAGGTGGAGAACTACCCCCCCGAGATGATGTGCATGGCCTTCGGCTCCCTGATCCCCACCGCCGGCGTGTCCGAGGCCACCACCAAGACCCTGATGGAGGCCTACTCCCTGTGGCAGGACGCCTTCACCAAGACCATCAACGTGAAGATGCGGGGCGCCTCCAAGACCGAGGTGTACAACTCCTTCCGGGACCCCCTGCACGCCGCCGTGAACTCCGTGTTCTTCCCCAACGACGTGCGGGTGAAGTGGCTGAAGGCCAAGGGCATCCTGGGCCCCGACGGCGTGCCCTCCCGGGCCGCCGAGGTGGCCGCCGCCGCCTACCGGAACCTGTGA

[0127] SEQ ID NO:4 0904-NP base sequence

[0128] ATGAGCGAGTGGAGCCGCATCGCCGTGGAGTTCGGCGAGCAGCAGCTGAACCTGACCGAGCTGGAGGACTTCGCCCGCGAGCTGGCCTACGAGGGCCTGGACCCCGCCCTGATCATCAAGAAGCTGAAGGAGACCGGCGGCGACGACTGGGTGAAGGACACCAAGTTCATCATCGTGTTCGCCCTGACCCGCGGCAACAAGATCGTGAAGGCCAGCGGCAAGATGAGCAACAGCGGCAGCAAGCGCCTGATGGCCCTGCAGGAGAAGTACGGCCTGGTGGAGCGCGCCGAGACCCGCCTGAGCATCACCCCCGTGCGCGTGGCCCAGAGCCTGCCCACCTGGACCTGCGCCGCCGCCGCCGCCCTGAAGGAGTACCTGCCCGTGGGCCCCGCCGTGATGAACCTGAAGGTGGAGAACTACCCCCCCGAGATGATGTGCATGGCCTTCGGCAGCCTGATCCCCACCGCCGGCGTGAGCGAGGCCACCACCAAGACCCTGATGGAGGCCTACAGCCTGTGGCAGGACGCCTTCACCAAGACCATCAACGTGAAGATGCGCGGCGCCAGCAAGACCGAGGTGTACAACAGCTTCCGCGACCCCCTGCACGCCGCCGTGAACAGCGTGTTCTTCCCCAACGACGTGCGCGTGAAGTGGCTGAAGGCCAAGGGCATCCTGGGCCCCGACGGCGTGCCCAGCCGCGCCGCCGAGGTGGCCGCCGCCGCCTACCGCAACCTGTGA

[0129] SEQ ID NO:5 0905-GFN base sequence

[0130]

[0131] SEQ ID NO:6 0906-GFN base sequence

[0132]

[0133] SEQ ID NO: 7 0907-GTN base sequence

[0134]

[0135] SEQ ID NO: 8 0908-GTN base sequence

[0136]

[0137] SEQ ID NO:9 5’UTR sequence

[0138] GCACTGAGCCTAAGCAGCCGGTGATGGCGGCAGCGGCTGTGGTGGCTGCGGCGGGTCCGGGCCC

[0139] SEQ ID NO:10 3’UTR sequence

[0140] GCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTG GGCGGCA

[0141] SEQ ID NO:11 PolyA

[0142] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0143] The above specific embodiments further illustrate the purpose, technical solutions and beneficial effects of the present application. It should be understood that the above description is only for specific embodiments of the present application and is not intended to limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included in the protection scope of the present application.

Claims

1. A fever-associated thrombocytopenia syndrome virus (FATHS) mRNA vaccine, comprising the mRNA of FATHSGPC protein and the mRNA of FATHSNP protein, wherein, The mRNA of the fever-associated thrombocytopenia syndrome virus (FAT) GPC protein and the mRNA of the fever-associated thrombocytopenia syndrome virus (FAT) NP protein are tandemly linked by a flexible adapter.

2. The mRNA vaccine according to claim 1, characterized in that, The amino acid sequence of the flexible connector is (G4S1); Optionally, the linker amino acid sequence is (G4S1)3, (G4S1)4, (G4S1)5, (G4S1)6; Preferably, the linker amino acid sequence is (G4S1)4; Wherein, (G4S1) is GGGGS, and (G4S1) n Let n GGGGS be connected end to end.

3. The mRNA vaccine according to claim 1 or 2, wherein the mRNA sequence of the GPC protein is shown in SEQ ID NO:

1.

4. The mRNA vaccine according to any one of claims 1-3, wherein the mRNA sequence of the NP protein is shown in SEQ ID NO:

3.

5. The mRNA vaccine according to any one of claims 1-4, wherein the sequence is shown in SEQ ID NO:5, The mRNA of the GPC protein and the mRNA of the NP protein, which are tandemly linked by a flexible connector, are encapsulated in lipid nanoparticles.

6. The mRNA vaccine according to any one of claims 1-5, characterized in that, The mRNA vaccine also includes 5'UTR and 3'UTR sequences, with Poly(A) added to the 3' end.

7. The mRNA vaccine according to claim 6, characterized in that, The nucleotide sequence of the 5'UTR is shown in SEQ ID NO: 9, the nucleotide sequence of the 3'UTR is shown in SEQ ID NO: 10, and the nucleotide sequence of the poly(A) is shown in SEQ ID NO:

11.

8. The mRNA vaccine according to any one of claims 5-7, characterized in that, The lipid nanoparticles comprise ionizable lipid SM-102, 1,2-distearate-sn-glycerol-3-phosphocholine (DSPC), cholesterol, and DMG-PEG 2000 in a molar ratio of 50:10:38.5:1.

5.

9. A pharmaceutical composition comprising the mRNA vaccine and pharmaceutically acceptable vector of any one of claims 1-8.

10. The use of the mRNA vaccine according to any one of claims 1-8 in the preparation of a medicament for the prevention of infection with fever and thrombocytopenia syndrome.

Images