Method for synthesizing ginsenoside in tomatoes

Abstract

The invention belongs to the technical field of saponin synthesis, and particularly relates to a method for synthesizing ginsenoside in tomatoes. The invention aims to provide a new choice for synthesizing ginsenoside. According to the technical scheme, the method for synthesizing the ginsenoside in the tomato is realized by increasing the expression quantity of genes PnSE, PnDS, CYP716A47 and GT95 in the tomato. According to the invention, the PnSE / PnDS / CYP450A47 / GT95 gene of panax notoginseng is co-overexpressed in the plant chassis tomato for the first time, heterologous synthesis of ginsenoside CK in plants is realized, and a new way is provided for extraction of ginsenoside CK.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of ginsenoside synthesis, and particularly relates to a method for synthesizing ginsenosides in tomatoes. BACKGROUND

[0002] Panax notoginseng is a perennial herb of the Araliaceae Panax genus, and its main bioactive components are ginsenosides, including protopanax diols (ginsenosides Rb1, Rb2, Rc and Rd) and protopanax triols (ginsenosides Rg1 and Re), with a content of more than 90% of ginsenoside extract. However, the main ginsenoside active ingredients are difficult to be absorbed by the gastrointestinal tract of the human body due to their high molecular weight. Panax notoginseng also contains a class of ginsenosides with high biological activity and medical value but with a very low content, which are referred to as rare ginsenosides. These ginsenosides have less sugar groups, better activity, are more beneficial to the body absorption, and have more prominent effects of nerve repair, tumor resistance, and promotion of cell differentiation and regeneration. For example, the rare ginsenosides Rg3, Rh2, F2, Rk1, Rg5, Rh1 and CK have stronger pharmacological activities than the main ginsenosides. The rare ginsenoside CK is a metabolite of protopanax diol, and has good pharmacological activity in the treatment of cancer, thrombosis, diabetes, photoaging, inflammation, oxidation and improvement of the immune system.

[0003] Due to the low content of rare ginsenosides in Panax notoginseng and other plants of the Araliaceae family (in common ginseng Panax ginseng, for example, ginseng produced in Jilin (3 years old or younger), the content of (medicinal parts) is very low, and can be considered as almost none), chemical methods such as thermal degradation, acid degradation and alkali degradation are commonly used in industry to convert rare ginsenosides. These chemical methods have complex process conditions, strict requirements for equipment, large environmental load, and low yield. The prototype ginsenosides need to be extracted from natural plants of the Araliaceae family such as Panax notoginseng and ginseng. Not only is the extraction efficiency very low, but also the uncontrolled production of a large amount will lead to resource shortage. In addition, the long growth cycle of these plants is also a major bottleneck for the development and utilization of rare ginsenosides.

[0004] Therefore, the gradual rise of synthetic biology is expected to improve the aforementioned difficulties. Synthetic biology is a multidisciplinary discipline guided by traditional biology, engineering, computer science and other disciplines to artificially design and modify the genome core. Breakthroughs have been made in medical health, food, energy and other aspects. This method constructs standardized elements and modules based on systems biology, modifies existing natural systems, or synthesizes completely new artificial biological systems from scratch.

[0005] At present, most of the research on the synthesis of specific metabolites of medicinal compounds uses microorganisms as the chassis. Microorganisms have a high degree of genomic complexity, and during biosynthesis, they retain exogenous DNA sequences in their own genomes by absorbing them, which increases the genomic capacity and causes metabolic burden. In actual production processes, microbial chassis consumes a large amount of carbon sources such as glucose and glycerol, and requires a strict sterile environment. Moreover, microorganisms often have difficulty in heterologous synthesis of enzymes derived from plants, such as cytochrome P450, which are involved in metabolic and regulatory pathways. Therefore, the use of microorganisms to synthesize medicinal compounds such as ginsenosides has low production efficiency, high production cost, and is difficult to achieve industrialization of ginsenoside synthesis.

[0006] Plant synthetic biology is developed on the basis of plant genetic engineering and transgenic technology. Compared with single-cell microorganisms, plant chassis has natural advantages. Plants are rich in various membrane systems and organelles, complex spatial features, and fine division and coordination of different organs, which provide possible conditions for the synthesis of different complex metabolites. Plants can use CO2 and water as raw materials to synthesize complex natural products through photosynthesis, without the need for high-oxygen and high-energy fermentation processes. Moreover, plants can overcome the limitations of poor expression and poor tolerance of active products derived from plants in microorganisms. These advantages enable synthetic biology research to gradually expand from the initial microbial system to complex multicellular eukaryotic systems, and plant synthetic metabolic engineering has the potential for sustainable development.

[0007] Patent document CN113493795 discloses a preparation method of ginsenoside Rh2. The method is to introduce genes DS and transcription factor gene PnWRKY into tobacco to obtain transgenic tobacco that synthesizes ginsenoside Rh2. The transgenic plant obtained by this method can synthesize ginsenoside Rh2, but cannot synthesize more valuable rare ginsenosides.

[0008] Patent document CN115725620 discloses a method for synthesizing notoginsenoside in Panax notoginseng cells. The method is to construct an RNAi expression vector of PnDS gene and introduce it into Panax notoginseng cells to obtain Panax notoginseng cells that synthesize notoginsenoside. This method starts from the perspective of reverse regulation, inhibits the expression of PnDS gene, which is the first key enzyme gene involved in the synthesis branch of dammarane-type triterpene saponins in Panax notoginseng saponin biosynthesis pathway, reduces the synthesis of dammarane-type triterpene saponins, and thus promotes Panax notoginseng cells to synthesize zygospermine-type saponin notoginsenoside, which is not originally contained.

[0009] The following disadvantages exist in the use of cells to generate saponins: cell synthesis requires a large amount of modern equipment, high water and electricity fees for maintaining operation, and technical personnel to manage the equipment operation, and the production cost is high. At the same time, the yield of cell synthesis is generally much lower than that of plant synthesis; in the case that the product is not secreted by the cell, the cell is suspended in a liquid culture system, and the fresh solid density is extremely low. While the tissue cells of natural plants are compact, and the fresh solid density is close to 100%; in the case that the product is secreted by the cell, the product is secreted by the cell into the liquid culture system, and in this case, the product reaches a certain concentration and is toxic to the cell, and the concentration and purification process also requires economic cost.

[0010] At present, there is no related report on the successful synthesis of rare ginsenoside CK in tomatoes. SUMMARY

[0011] The purpose of the present application is to provide a new choice for synthesizing ginsenosides.

[0012] The technical scheme of the present application provides a method for creating a tomato variety with high ginsenoside content, which is achieved by increasing the expression amount of genes PnSE, PnDS, CYP716A47 and GT95 in tomatoes.

[0013] Specifically, the way to increase the expression amount of genes PnSE, PnDS, CYP716A47 and GT95 in tomatoes is to construct a plant expression vector expressing genes PnSE, PnDS, CYP716A47 and GT95, and transform the tomatoes.

[0014] Further, the way to increase the expression amount of genes PnSE, PnDS, CYP716A47 and GT95 in tomatoes is to construct PnSE and PnDS genes to the expression vector backbone to obtain recombinant vector 1, and to construct CYP716A47 and GT95 genes to the expression vector backbone to obtain recombinant vector 2; and to transform the tomatoes with the recombinant vector 1 and the recombinant vector 2.

[0015] Specifically, the expression vector backbone is pPZP212.

[0016] Further, the promoter used in the plant expression vector is a fruit-specific promoter.

[0017] Specifically, the fruit-specific promoter is E8.

[0018] Specifically, the ginsenoside is rare ginsenoside CK.

[0019] The present application also provides the application of the tomato fruit obtained by the above-mentioned method in generating ginsenoside CK.

[0020] The application also provides a method for synthesizing ginsenoside in tomatoes, which is achieved by increasing the expression amount of genes PnSE, PnDS, CYP716A47 and GT95 in tomatoes.

[0021] Specifically, the way for increasing the expression amount of genes PnSE, PnDS, CYP716A47 and GT95 in tomatoes is to construct a plant expression vector expressing genes PnSE, PnDS, CYP716A47 and GT95, and to transform tomatoes.

[0022] Further, the way for increasing the expression amount of genes PnSE, PnDS, CYP716A47 in tomatoes is to construct two genes PnSE and PnDS to a recombinant vector 1, and to construct two genes CYP716A47 and GT95 to a recombinant vector 2; and to transform tomatoes with the recombinant vector 1 and the recombinant vector 2.

[0023] Specifically, the expression vector skeleton is pPZP212.

[0024] Further, the promoter used in the plant expression vector is a fruit-specific promoter.

[0025] Specifically, the fruit-specific promoter is E8.

[0026] Specifically, the ginsenoside is rare ginsenoside CK.

[0027] In particular, the method further comprises extracting ginsenoside after the transformation of tomatoes and after the maturation of the transgenic tomato plants.

[0028] Specifically, the operation of extracting ginsenoside is as follows: taking the mature period of tomatoes 7 days after breaking the color, grinding into powder after quick freezing with liquid nitrogen; adding methanol for soaking; ultrasonic treatment; centrifugation, collecting supernatant.

[0029] The methanol soaking time is 0.5-12h.

[0030] Preferably, the methanol soaking time is 3h.

[0031] Specifically, the ultrasonic treatment condition is: 50-500W, ultrasonic 1-8s, intermittent 1-30s, a total of 0.5-6h.

[0032] Preferably, the ultrasonic treatment condition is: 100W, ultrasonic 4s, intermittent 2s, a total of 1.5h.

[0033] Specifically, the centrifugation condition is: 12000rpm, 10min.

[0034] The application also provides a method for synthesizing dammarendiol-II in tomatoes, which is realized by increasing the expression amount of genes PnSE and PnDS in tomatoes.

[0035] Specifically, the method for increasing the expression amount of genes PnSE and PnDS in tomatoes is that: a plant expression vector for expressing genes PnSE and PnDS is constructed, and the tomatoes are transformed.

[0036] Further, the method for increasing the expression amount of genes PnSE and PnDS in tomatoes is that: genes PnSE and PnDS are constructed into an expression vector skeleton to obtain a recombinant vector 1, and the tomatoes are transformed; or genes PnSE and PnDS are respectively constructed into expression vector skeletons to obtain a recombinant vector 2 and a recombinant vector 3, and the tomatoes are transformed.

[0037] Specifically, the expression vector skeleton is pPZP212.

[0038] Further, the promoter used in the plant expression vector is a fruit-specific promoter.

[0039] Specifically, the fruit-specific promoter is E8.

[0040] The application has the following beneficial effects:

[0041] The application first co-overexpresses PnSE / PnDS / CYP450A47 / GT95 genes in a plant chassis tomato, realizes the heterologous synthesis of the rare ginsenoside CK in plants, and provides a new way for extracting ginsenoside CK. In the transgenic lines obtained in the application, the content of ginsenoside CK reaches a high content of 4.327 ng / g FW. In addition, the method of the application can also efficiently obtain the intermediate product dammarendiol-II of ginsenoside CK synthesis. After obtaining the tomato variety with high ginsenoside content by the method of the application, the planting cost is the same as that of ordinary tomatoes, which can effectively reduce the production cost. Unlike cell synthesis, it does not require a large number of modern equipment, high water and electricity fees for operation, and high-tech personnel to manage the equipment and operation. Panax notoginseng, ginseng and other ginseng plants are very rare in wild resources, and the artificial planting area is also very small and limited to a few provinces and regions in China. Moreover, they are perennial, and generally need to be planted for more than 3 years before harvesting. The biomass yield of roots, stems and leaves is very low. Tomatoes are a major agricultural product, and are widely planted in a large area. The plants are tall, especially the fruits, and the yield is high. They are annual plants. Therefore, producing the rare ginsenoside CK in a tomato chassis can effectively shorten the production cycle and improve the production efficiency. The method of the application not only can effectively reduce the production cost, but also can obtain a large amount of high-activity rare ginsenoside CK. In addition, the application constructs a synthesis pathway of the rare ginsenoside CK in a plant chassis tomato, which lays a foundation for synthesizing other monomer ginsenosides in a plant chassis. Attached Figure Description

[0042] Figure 1 The structural diagram of the recombinant vector pPZP212-PnSE-PnDS.

[0043] Figure 2 The structural diagram of the recombinant vector pPZP212-CYP716A47-GT95.

[0044] Figure 3 PCR level detection of transgenic tomato genome. WT represents non-transgenic wild-type tomatoes. 1–18 represent tomato lines co-transformed with pPZP212-PnSE-PnDS and pPZP212-CYP716A47-GT95. Electrophoresis diagrams labeled with corresponding gene names represent the PCR level identification results of each line's genome. A band indicates that the gene has been successfully transformed into the genome of that tomato line. As shown in the figure, among tomato lines 1–18, lines 2 and 8 have been successfully transformed to possess the four genes SE, DS, CYP716A47, and GT95. Figure 4 The SDCG-2 and SDCG-8 genes were present; line 15 was successfully transformed to possess only the SE and DS genes, i.e. Figure 4 In the SD-15 strain, lines 7 and 17 were successfully transformed to possess only two genes: CYP716A47 and GT95. Figure 4 CG7 and CG-17 in the series.

[0045] Figure 4 The transcriptional level of the target gene in mature fruits of wild-type WT and transgenic tomatoes, with CG-7 being... Figure 3 In strain 7, genome-level analysis showed that the CG-7 strain only successfully transformed the CYP716A47 and GT95 genes. Therefore, in... Figure 4 The quantitative assay only detected the expression levels of the genes CYP716A47 and GT95. A: Transcriptional level of PnSE in WT and transgenic tomatoes; ordinate: relative expression level of PnSE; abscissa: transgenic lines. B: Transcriptional level of PnDS in WT and transgenic tomatoes; ordinate: relative expression level of PnDS; abscissa: transgenic lines. C: Transcriptional level of CYP716A47 in WT and transgenic tomatoes; ordinate: relative expression level of CYP716A47; abscissa: transgenic lines. D: Transcriptional level of GT95 in WT and transgenic tomatoes; ordinate: relative expression level of GT95; abscissa: transgenic lines.

[0046] Figure 5Analysis of dammarenediol-II in mature fruits of wild type (WT) and transgenic tomato. A: Chromatograms of dammarenediol-II in mature fruits of WT and transgenic tomato. The vertical axis represents relative abundance, and the horizontal axis represents time (min). The characteristic peak in the figure is marked as dammarenediol-II. B: Contents of dammarenediol-II in mature fruits of WT and transgenic tomato. The vertical axis represents dammarenediol-II (ng / g FW), and the horizontal axis represents transgenic lines.

[0047] Figure 6 Analysis of ginsenoside CK in mature fruits of wild type (WT) and transgenic tomato. A: Chromatograms of ginsenoside CK in mature fruits of WT and transgenic tomato. The vertical axis represents relative abundance, and the horizontal axis represents time (min). The characteristic peak in the figure is marked as ginsenoside CK. B: Contents of ginsenoside CK in mature fruits of WT and transgenic tomato. The vertical axis represents ginsenoside CK (ng / g FW), and the horizontal axis represents transgenic lines. Figure 7 Structure map of pPZP212 plasmid. DETAILED DESCRIPTION

[0048] The biosynthetic pathway of ginsenosides in Panax notoginseng is a complex metabolic process involving the synergistic action of multiple key enzymes. These enzymes are mainly involved in the synthesis of terpenoid skeleton, cyclization of triterpenoid skeleton, oxidative modification, and glycosylation reaction, ultimately forming ginsenosides with biological activity. Both the MVA pathway and the MEP pathway of the terpenoid synthesis pathway in Panax notoginseng are involved in the biosynthesis of ginsenosides, with the MVA pathway playing a major role. In this pathway, PnSE catalyzes the formation of 2,3-oxidosqualene, a key precursor for ginsenoside synthesis, PnDS catalyzes the formation of dammarenediol-II, the basic triterpenoid skeleton of ginsenosides, from 2,3-oxidosqualene, cytochrome P450 enzyme CYP716A47 catalyzes the formation of protopanaxadiol from dammarenediol-II, and glycosyltransferase GT95 catalyzes the formation of ginsenoside CK from protopanaxadiol.

[0049] According to the ITAG5.0 version of tomato genome (https: / / phytozome-next.jgi.doe.gov / info / Slycopersicum_ITAG5_0), although there is a coding gene of SE enzyme (EC 1.14.13.132) in tomato, only one, and the protein sequence (388 amino acids) coded by it and the SE enzyme of Panax notoginseng (537 amino acids) have a large gap, the consistent rate of the similar part of the protein sequences is 83%, and the sequence length difference is large; therefore, the coding gene of the SE enzyme of Panax notoginseng is also transformed into the tomato. And there is no coding gene of the enzyme downstream of PnSE in the ginsenoside CK synthesis pathway in the tomato. Therefore, the PnSE, PnDS, CYP716A47 and GT95 genes are selected to be transformed into the tomato.

[0050] The PnSE, PnDS, CYP716A47 and GT95 genes in Panax notoginseng are transformed into the tomato by the Agrobacterium-mediated method, and a fruit-specific promoter (for example, E8) is selected to drive the expression of the genes, so that the vegetative growth of other parts of the tomato is not affected (otherwise, the vegetative growth of the plant may be inhibited to cause plant dwarfing and the like). Finally, the four genes are expressed in the mature fruit of the tomato, the ginsenoside CK is synthesized only in the fruit, and the edible health-care functional fruit and vegetable are obtained. Some other species with a mature transformation system, for example, tobacco and Arabidopsis, are not suitable for direct consumption.

[0051] In actual operation, the difficulty of successful transformation increases with each additional gene. Meanwhile, due to the complexity of the plant genome, it is more difficult to achieve the co-expression of multiple genes in plants than in microorganisms. However, through screening at the genome and transcriptome levels, the four genes are simultaneously expressed in two transgenic tomato lines, SDCG-2 and SDCG-8. The expression amounts of the PnSE, PnDS, CYP716A47 and GT95 genes in the SDCG-2 line are all high. The content of ginsenoside CK in the SDCG-2 and SDCG-8 lines is 4.327 ng / g FW and 0.470 ng / g FW, respectively.

[0052] It can be seen that the synthesis pathway of the rare ginsenoside CK is constructed in the plant chassis tomato, which lays a foundation for synthesizing other monomer ginsenosides in the plant chassis. The rare ginsenoside CK is synthesized in the tomato, and a tomato variety with higher nutritional value is also developed. The edibility of the tomato determines its potential advantage of being developed into a medicine or a health-care food. Even if the ginsenoside CK is not extracted, it can be directly consumed to achieve the purpose of homology of medicine and food, and has a good application prospect.

[0053] Based on the above achievements, a series of technical solutions of the present application are further obtained.

[0054] A method for creating a tomato variety with high ginsenoside content is achieved by increasing the expression amount of genes PnSE, PnDS, CYP716A47 and GT95 in tomatoes.

[0055] Specifically, the way to increase the expression amount of genes PnSE, PnDS, CYP716A47 and GT95 in tomatoes is to construct a plant expression vector expressing genes PnSE, PnDS, CYP716A47 and GT95, and transform tomatoes.

[0056] Further, the way to increase the expression amount of genes PnSE, PnDS, CYP716A47 and GT95 in tomatoes is to construct PnSE and PnDS genes to the expression vector backbone to obtain recombinant vector 1, and construct CYP716A47 and GT95 genes to the expression vector backbone to obtain recombinant vector 2; transform tomatoes with recombinant vector 1 and recombinant vector 2.

[0057] Specifically, the expression vector backbone is pPZP212.

[0058] Further, the promoter used in the plant expression vector is a fruit-specific promoter.

[0059] Specifically, the fruit-specific promoter is E8.

[0060] Specifically, the ginsenoside is the rare ginsenoside CK.

[0061] The present application also provides the application of the tomato fruit obtained by the above method in the generation of ginsenoside CK.

[0062] The present application also provides a method for synthesizing ginsenoside in tomatoes, which is achieved by increasing the expression amount of genes PnSE, PnDS, CYP716A47 and GT95 in tomatoes.

[0063] Specifically, the way to increase the expression amount of genes PnSE, PnDS, CYP716A47 and GT95 in tomatoes is to construct a plant expression vector expressing genes PnSE, PnDS, CYP716A47 and GT95, and transform tomatoes.

[0064] Further, the method for increasing the expression of the genes PnSE, PnDS, CYP716A47 and GT95 in tomato is as follows: PnSE and PnDS are constructed into an expression vector backbone to obtain recombinant vector 1, and CYP716A47 and GT95 are constructed into an expression vector backbone to obtain recombinant vector 2; the recombinant vector 1 and the recombinant vector 2 are transformed into tomato. After transformation, tomato plants expressing PnSE, PnDS, CYP716A47 and GT95 genes of Panax notoginseng are obtained.

[0065] Specifically, the expression vector backbone is pPZP212.

[0066] Further, the promoter used in the plant expression vector is a fruit-specific promoter.

[0067] Specifically, the fruit-specific promoter is E8.

[0068] Specifically, the ginsenoside is rare ginsenoside CK.

[0069] In particular, the method further comprises: after the tomato is transformed, ginsenosides are extracted after the transgenic tomato plants mature.

[0070] Specifically, the operation of extracting ginsenosides is as follows: the mature tomato fruits 7 days after the color is broken are quickly frozen with liquid nitrogen and ground into powder; methanol is added for soaking; ultrasonic treatment is performed; centrifugation is performed, and the supernatant is collected.

[0071] The methanol soaking time is 0.5-12 h.

[0072] Preferably, the methanol soaking time is 3 h.

[0073] Specifically, the ultrasonic treatment condition is: 50-500 W, ultrasonic treatment for 1-8 s, intermittent for 1-30 s, and a total treatment time of 0.5-6 h.

[0074] Preferably, the ultrasonic treatment condition is: 100 W, ultrasonic treatment for 4 s, intermittent for 2 s, and a total treatment time of 1.5 h.

[0075] Specifically, the centrifugation condition is: 12000 rpm, 10 min.

[0076] In order to further illustrate the technical means and effects adopted by the present application to achieve the predetermined object, the specific embodiments, structures, features and effects according to the present application are described in detail below with reference to the drawings and preferred embodiments.

[0077] Example 1: Construction of overexpression vector

[0078] 1. Total RNA extraction and cDNA synthesis of Panax notoginseng

[0079] With the two-year-old Panax notoginseng leaves as the template, the total RNA in Panax notoginseng was extracted by using the TIANGEN polysaccharide polyphenol plant total RNA extraction kit. After extraction, the RNA integrity, purity and concentration were detected; the detected RNA was stored in a -80°C refrigerator.

[0080] 2, Acquisition of Panax notoginseng cDNA

[0081] The total RNA of Panax notoginseng leaves was taken out from the -80°C refrigerator, and the RT-PCR reaction was carried out by using the Promega reverse transcription kit. 2 μg of reverse transcription RNA template was obtained to obtain cDNA. The whole process wore a mask and gloves, and the experimental table and tools were sprayed with RNAerasers, and an RNase-free gun head was used to prevent RNA degradation. The specific steps are as follows: dissolve GoScript TM Reverse Transcription Mix components on ice, gently mix, and centrifuge briefly for standby. The reverse transcription system is as follows: GoScript TM Reaction Buffer Oligo(dT)4μL, GoScript TM Enzyme Mix 2μL, RNA template 2μg, Nuclease-Free Water to a final volume of 20μL. The reaction system was placed in a PCR instrument for reverse transcription reaction. The reaction program is as follows: 25℃ for 5min; 42℃ for 60min; 70℃ for 15min; 4℃∞. The obtained reaction product was stored in a -20℃ refrigerator.

[0082] 3, Cloning and recovery of target gene and promoter

[0083] According to the currently reported PnSE (NCBI: KC422651.1), PnDS (NCBI: MZ288740.1), CYP716A47 (NCBI: KJ995703.1), GT95 (NCBI: MT551199.1) gene sequences, the CDS region amplification primers of the target gene fragment were designed, and the vector homologous arms were introduced into the upper and lower primers respectively. The commonly used plasmid containing fruit-specific promoter E8 and terminator NOS in the laboratory was used as a template, and E8 and NOS were amplified, and a restriction enzyme site was introduced between E8 and NOS. The amplification primers are shown in Table 1. With cDNA as the template, 25μL system PCR amplification was carried out by using TaKaRa's PrimeSTAR Max Premix (2×) high-fidelity enzyme, and each reaction system was prepared on ice. The amount of each reagent in the system is as follows: template cDNA 1μL or plasmid 0.5μL, F primer 1μL, R primer 1μL, PrimeSTAR Max Premix (2×) 12.5μL, sterilized water to 25μL.

[0084] Table 1 Primer sequences of CDS sequences and promoters and terminators of target genes

[0085] Primer name Sequence (5'-3'), underlined part is homology arm Sequence ID No. PnSE-F CACAGTGCAAAAGAAGGAGCTATGAATTCATCTTCTTCTACTAGTAC SEQ ID No. 1 PnSE-R TCCACGAAAATATCCGAACCCTTAGCGAATGGGGGGAGCTCT SEQ ID No. 2 PnDS-F CACAGTGCAAAAGAAGGAGCTATGTGGAAGCTGAAGGTTGC SEQ ID No. 3 PnDS-R TCCACGAAAATATCCGAACCCTTAAATTTTGAGCTGCTGGTGCT SEQ ID No. 4 CYP716A47-F CACAGTGCAAAAGAAGGAGCTATGGTGTTGTTTTTCTCCCTATCT SEQ ID No. 5 CYP716A47-R TCCACGAAAATATCCGAACCCTTAATTGTGGGGATGTAGATGAAT SEQ ID No. 6 GT95-F CACAGTGCAAAAGAAGGAGCTATGAAGTCAGAATTGATATTCTTGC SEQ ID No. 7 GT95-R TCCACGAAAATATCCGAACCCTTACATAATTTCCTCAAATAGCTTCG SEQ ID No. 8 E8-F CTATGACATGATTACGAATTCTGATAAGAAAAGAGTCAGAAAACGT SEQ ID No. 9 E8-R CGAACCCGGGTACCGAGCTCCTTCTTTTGCACTGTGAATGATTAG SEQ ID No. 10 NOS-F AGAAGGAGCTCGGTACCCGGGTTCGGATATTTTCGTGGAGTT SEQ ID No. 11 NOS-R CAGGTCGACTCTAGAGGATCCGATCTAGTAACATAGATGACACCG SEQ ID No. 12

[0086] PCR reaction conditions of PnSE fragment: 98℃ 2min; 98℃ 10s, 58℃ 15s, 72℃ 20s, 35 cycles; 72℃ 5min. PCR reaction conditions of PnDS fragment: 98℃ 2min; 98℃ 10s, 56℃ 15s, 72℃ 25s, 35 cycles; 72℃ 5min. PCR reaction conditions of CYP716A47 and GT95 fragments: 98℃ 2min; 98℃ 10s, 56℃ 15s, 72℃ 15s, 35 cycles; 72℃ 5min. PCR reaction conditions of E8 fragment: 98℃ 2min; 98℃ 10s, 55℃ 15s, 72℃ 30s, 35 cycles; 72℃ 5min. PCR reaction conditions of NOS fragment: 98℃ 2min; 98℃ 10s, 55℃ 15s, 72℃ 10s, 35 cycles; 72℃ 5min. After electrophoresis detection, the correct fragments were recovered.

[0087] 4. Construction of intermediate vector

[0088] The intermediate vector was constructed by homologous recombination. The pPZP212 empty plasmid preserved in the laboratory was double-digested with restriction endonucleases, and the restriction endonuclease sites were EcoR I and BamH I, and the amount of enzyme was 2 μg. The enzyme system and conditions were as follows: DNA 2 μg, Buffer 5 μL, EcoR I 1 μL, BamH I 1 μL, Nuclease-free Water to 50 μL; 37℃, incubation for 1 h. After electrophoresis verification of the enzyme digestion product, the pPZP212 linear vector was recovered and stored at -20℃. Figure 7 The intermediate vector was constructed by homologous recombination. The pPZP212 empty plasmid preserved in the laboratory was double-digested with restriction endonucleases, and the restriction endonuclease sites were EcoR I and BamH I, and the amount of enzyme was 2 μg. The enzyme system and conditions were as follows: DNA 2 μg, Buffer 5 μL, EcoR I 1 μL, BamH I 1 μL, Nuclease-free Water to 50 μL; 37℃, incubation for 1 h. After electrophoresis verification of the enzyme digestion product, the pPZP212 linear vector was recovered and stored at -20℃.

[0089] The intermediate vector was constructed by homologous recombination. The pPZP212 empty plasmid preserved in the laboratory was double-digested with restriction endonucleases, and the restriction endonuclease sites were EcoR I and BamH I, and the amount of enzyme was 2 μg. The enzyme system and conditions were as follows: DNA 2 μg, Buffer 5 μL, EcoR I 1 μL, BamH I 1 μL, Nuclease-free Water to 50 μL; 37℃, incubation for 1 h. After electrophoresis verification of the enzyme digestion product, the pPZP212 linear vector was recovered and stored at -20℃. Ultra One Step Cloning Kit C115 kit according to the instructions. The promoter E8 and terminator NOS obtained by recovering the above gel were connected with the linear pPZP212 vector digested by enzymes. The connection system was as follows: pPZP212 linear vector 2.64 μL, E8 fragment 1.28 μL, NOS fragment 1.7 μL, 2×ClonExpress Mix 10 μL, ddH2O 4.38 μL. Reaction conditions: 50℃, 30 min; after the reaction, it was reduced to 4℃ or immediately placed on ice to cool.

[0090] ​The above-described ligation plasmid was transformed into *E. coli* according to the *E. coli* DH5α instructions. Single colonies were picked and identified by colony PCR using 2×M5 Taq HiFi PCR Mix. The colony PCR reaction system was as follows: 1 μL of bacterial culture, 2×M5 Taq HiFi PCR Mix

[0091] 12.5 μL of vector primer-F (SEQ ID No. 13, TGATAAGAAAAGAGTCAGAAAACG), 1 μL of NOS-R (SEQ ID No. 14, ATGATA ATCATCGCAAGACCG), and 9.5 μL of ddH2O were added. Positive monoclonal bacterial cultures containing the target gene, selected by PCR, were sent for sequencing. The correctly sequenced *E. coli* cultures were amplified, and plasmids were extracted using the TIAGE plasmid miniprep kit to obtain the intermediate vector pPZP212-E8.

[0092] 5. Construction of the pPZP212-E8-PnSE / PnDS / CYP716A47 / GT95 vector

[0093] The constructed pPZP212-E8 plasmid was subjected to double enzyme digestion. The enzyme digestion system was as follows: DNA 2 μg, Add 5 μL of buffer, 1 μL of SacⅠ, and nuclease-free water to a final volume of 50 μL. Reaction conditions: 25℃ for 1 h, then 65℃ for 20 min. After the reaction, add 1 μL of SacⅠ to the above reaction mixture and incubate at 37℃ for 1 h in a PCR instrument. The reaction product is recovered, and the resulting pPZP212-E8 linear vector is measured for concentration and stored at -20℃.

[0094] Using homologous recombination technology, ⅡOne Step Cloning Kit C112 kit, according to the instructions, the PnSE / PnDS / CYP716A47 / GT95 fragment recovered from the gel was ligated with the linear pPZP212-E8 vector. The ligation system was as follows: pPZP212-E8 linearized vector X μL, PnSE / PnDS / CYP716A47 / GT95 fragment Y μL, 5x CE II Buffer 4 μL, Exnase II 2 μL, ddH2O to 20 μL; X = (0.02 x pPZP212-E8 linearized vector base pair number) / concentration; Y = (0.04 x PnSE / PnDS / CYP716A47 / GT95 fragment base pair number) / concentration. 37°C for 30 min; after the reaction, it was cooled to 4°C or immediately placed on ice. The ligation product was transformed into E. coli DH5α, and single colonies were selected for PCR verification. The correct single colony was cultured to extract the plasmid, and the pPZP212-E8-PnSE, pPZP212-E8-PnDS, pPZP212-E8-CYP716A47 and pPZP212-E8-GT95 plasmids were obtained.

[0095] 6. Construction of pPZP212-PnSE-PnDS and pPZP212-CYP716A47-GT95 vectors

[0096] The constructed pPZP212-E8-PnDS and pPZP212-E8-GT95 plasmids were used as templates, primers P-E8-F and P-NOS-R were designed, and homologous arms were designed on the upstream and downstream primers to amplify the E8-PnDS-NOS fragment and E8-GT95-NOS fragment containing the promoter E8 and terminator NOS. TaKaRa PrimeSTAR Max Premix (2x) high-fidelity enzyme was used for PCR amplification in a 25 μL system. The reaction conditions were as follows: 98°C for 2 min; 98°C for 10 s, 55°C for 15 s, 72°C for 1 min, 35 cycles; 72°C for 5 min. Primer P-E8-F: CTATGTTACTAGATCGGATCC TGATAAGAAAAGAGTCAGAAAACGT (SEQ ID No. 9); primer P-NOS-R: G CCAAGCTTGCATGCCTGCAG GATCTAGTAACATAGATGACACCG (SEQ ID No. 15); the underlined part is the homologous arm. After the reaction, electrophoresis verification was performed, and the fragment was recovered.

[0097] The constructed pPZP212-E8-PnSE and pPZP212-E8-CYP716A47 vector plasmids were subjected to double enzyme digestion reaction using restriction enzymes BamH I and Pst I. After the enzyme digestion reaction, gel electrophoresis experiment was performed, and the correct linear vector was recovered from the gel.

[0098] The amplified E8-PnDS-NOS fragment was ligated with the linearized pPZP212-E8-PnSE vector, and the amplified E8-GT95-NOS fragment was ligated with the linearized pPZP212-E8-CYP716A47 vector. The ligations were transformed into E. coli DH5a, and single colonies were picked for verification. After the correct colonies were cultured, plasmids were extracted to obtain the recombinant vectors pPZP212-PnSE-PnDS and pPZP212-CYP716A47-GT95 (structure see Figure 1 and Figure 2 ).

[0099] 6. Transformation of recombinant plasmids into Agrobacterium

[0100] The obtained plant expression vectors pPZP212-PnSE-PnDS and pPZP212-CYP716A47-GT95 were transformed into Agrobacterium tumefaciens GV3101 competent cells for subsequent infection. The specific operation steps are as follows:

[0101] (1) The Agrobacterium tumefaciens GV3101 competent cells were taken out from the-80℃ refrigerator and thawed on ice.

[0102] (2) 5 μL of pPZP212-PnSE-PnDS and pPZP212-CYP716A47-GT95 plasmids were added to two tubes of 50 μL competent cells, respectively, and mixed by flicking the tube wall (do not shake to mix).

[0103] (3) Incubate on ice for 5 min, in liquid nitrogen for 5 min, in a 37℃ metal bath for 5 min, and in an ice bath for 5 min.

[0104] (4) In the clean bench, 500 μL of antibiotic-free LB liquid medium was added to each centrifuge tube, and after mixing, it was placed in a 28℃, 220 rpm shaker for 3 to 4 h.

[0105] (5) After the culture was completed, centrifugation was performed at 5,000 rpm (2,500 x g) for 5 min, and the bacterial cells were collected.

[0106] (6) In the clean bench, 300 μL of supernatant was discarded, and the bacterial cells were resuspended with the remaining culture medium. Then, they were evenly spread on LB solid medium containing Spec, Rif, and Gent.

[0107] (7) Place the flat on the inverted position in the 28℃ incubator for 2-3 days.

[0108] (8) After the culture, perform colony PCR verification. Add 10 μL Spec, Rif and Gent antibiotics, 10 mL LB liquid medium to the colonies verified as positive, and place in a shaker at 28℃, 220 rpm, and shake until the Agrobacterium liquid OD600 value is about 0.8. Under a clean bench, take 500 μL of the Agrobacterium liquid and 500 μL of 50% glycerol in a 2 mL centrifuge tube, vortex to mix, freeze with liquid nitrogen, and store in a -80℃ refrigerator.

[0109] Example 2 Heterologous synthesis of ginsenoside CK in tomato

[0110] 1. Agrobacterium-mediated genetic transformation of tomato

[0111] Wild-type tomato seeds (variety AC (Ailsa Craig)) are sterilized with 5% sodium hypochlorite and 75% alcohol, placed in a shaker at a rotation speed of 50-100 rpm for 2-3 days at room temperature until the tomato seeds germinate and white sprouts grow. The explants are cut when two cotyledons grow under long-day conditions at 25℃ in a light incubator. The cotyledons and hypocotyls are infected with Agrobacterium tumefaciens GV3101 containing pPZP212-PnSE-PnDS and pPZP212-CYP716A47-GT95 to induce callus formation, adventitious bud formation, rooting culture, and seedling culture.

[0112] 2. Identification of transgenic tomato positive plants

[0113] After the tomato grows for about a month, the tomato tender leaves are cut, and the genomic DNA of the tomato is extracted using a kit. The specific primers of the genes PnSE, PnDS, CYP716A47, and GT95 are designed to have a fragment length of 600-700 bp, and the primer sequences are shown in Table 2. The extracted tomato genomic DNA is used as a template for PCR amplification using M5 enzyme, and then agarose gel electrophoresis is used to detect whether the band is correct to determine whether the PnSE, PnDS, CYP716A47, and GT95 genes are integrated into the tomato genome.

[0114] Table 2 Amplification primers for identification of target genes

[0115] Primer name Sequence (5'-3') Sequence ID No. PnSE-F GCTAATTATCTCAAGACAGTAGTAGC SEQ ID No. 16 PnSE-R TTAGCGAATGGGGGGAGCTC SEQ ID No. 17 PnDS-F GAATCCTTCAGAAATTTTTGCAGAC SEQ ID No. 18 PnDS-R CCGAACCCTTAAATTTTGAGC SEQ ID No. 19 CYP716A47-F CTTGCTACTTACGGCCAATC SEQ ID No. 20 CYP716A47-R TTAATTGTGGGGATGTAGATGAAT SEQ ID No. 21 GT95-F GATTGCAATGGGTCTAGAGC SEQ ID No. 22 GT95-R CCGAACCCTTACATAATTTCCTC SEQ ID No. 23

[0116] The results are as follows Figure 3As shown, PnSE, PnDS, CYP716A47, GT95, the four genes are integrated into the genome of the tomato plants, a total of 2, respectively, the 2nd, 8th lines. PnDS, CYP716A47, GT95, the three genes are integrated into the genome of the tomato plants, 1, the 16th line, may be the Agrobacterium infection, PnSE gene is not integrated successfully lead to the gene did not transfer to the line, but the plant in the seedling, may be due to pathogenic bacteria, etc. Reasons, leading to its survival. PnSE, PnDS, the two genes are integrated into the genome of the tomato plants, 3, respectively, the 1st, 14th, 15th line. CYP716A47, GT95, the two genes are integrated into the genome of the tomato plants, 6, respectively, the 4th, 5th, 12th, 13th, 17th, 18th line. Containing PnSE, PnDS, CYP716A47, GT95, the transgenic tomato named PnSE-PnDS-CYP716A47-GT95-2 / 8, abbreviated as SDCG-2 / 8; containing PnSE, PnDS, the transgenic tomato named PnSE-PnDS-1 / 14 / 15, abbreviated as SD-1 / 14 / 15; containing CYP716A47, GT95, the transgenic tomato named CYP716A47-GT95-4 / 5 / 12 / 13 / 17 / 18, abbreviated as CG-4 / 5 / 12 / 13 / 17 / 18.

[0117] Tomato fruit color break a week, take the tomato fruit, remove the pulp and seeds, the peel as a plant sample, liquid nitrogen grinding into powder, weighing 100 mg of peel powder, using TIANGEN polysaccharide polyphenol plant total RNA extraction kit to extract total RNA. After obtaining the total RNA of tomato fruit, the purity and concentration were determined by spectrophotometer, and stored at -80℃ refrigerator. Then using Promega reverse transcription kit for RT-PCR reaction, the cDNA of tomato fruit was obtained, and stored at -20℃ refrigerator.

[0118] The quantitative primers of the genes were designed using NCBI and Premier 5, as shown in Table 3. The expression of the target gene was detected by real-time fluorescent quantitative PCR with SlUbi as the internal reference gene.

[0119] Table 3 Real-time fluorescent quantitative PCR primers

[0120] Primer name Sequence (5'-3') SEQ ID No. PnSE-RT-F TATTGCCGGAAGTACGGACG SEQ ID No. 24 PnSE-RT-R AACTCTCCGGCCATCTTTGG SEQ ID No. 25 PnDS-RT-F GGTGCGTGGACTTTCTCTGA SEQ ID No. 26 PnDS-RT-R AACTGCGAAGCCACCACTTA SEQ ID No. 27 CYP716A47-RT-F CGATGTCGTGTCGGGTGTTT SEQ ID No. 28 CYP716A47-RT-R GGTTGGGACGCTTGCTTATT SEQ ID No. 29 GT95-RT-F CAGTGGGCATCGCTTCTTGT SEQ ID No. 30 GT95-RT-R TTGAGTTGTTGCTCGCCGTA SEQ ID No. 31 Ubi-RT-F GCCGACTACAACATCCAGAAGG SEQ ID No. 32 Ubi-RT-R GCAACACAGCGAGCTTAACC SEQ ID No. 33

[0121] Real-time quantitative PCR analysis was performed using 2x Universal SYBR Green Fast qPCR Mix (ABclonal). The reaction system was as follows: cDNA 1 μL, Primer F 0.8 μL, Primer R 0.8 μL, 2x Universal SYBR Green Fast qPCR Mix 10 μL, ddH2O 7.4 μL. The real-time fluorescence quantitative PCR reaction program was as follows: 95 °C for 3 min; 95 °C for 5 s, 60 °C for 30 s, 40 cycles; melting curve, instrument automatic setting.

[0122] The results are shown in Figure 4 PnSE, PnDS, CYP716A47, GT95, these four genes did not express in wild type tomato. The results of quantitative detection of the transcription level of PnSE, PnDS genes in transgenic lines SDCG-2, SDCG-8, SD-15 are shown in Figure 4 A and 4B, the expression amount of PnSE gene in SDCG-2 line is the highest, the expression amount of SD-15 line is the second, and the expression amount of SDCG-8 line is the lowest; the expression amount of PnDS gene in SD-15 line is the highest, the expression amount in SDCG-2 line is the second, and the expression amount in SDCG-8 line is very low. The results of quantitative detection of the transcription level of CYP716A47, GT95 genes in transgenic lines SDCG-2, SDCG-8, CG-7, CG-17 are shown in Figure 4 C and 4D, the expression amount of CYP716A47 gene in SDCG-8 line is the highest, the expression amount in CG-7 and CG-17 lines is the second, and the expression amount of the two is equivalent, and the expression amount in SDCG-2 line is the lowest. The expression amount of GT95 gene in SDCG-2 line is the highest, the expression amount in CG-7 line is the second, followed by SDCG-8 line, and the expression amount in CG-17 line is very low. The expression amount of PnSE, PnDS, CYP716A47, GT95 genes in transgenic line SDCG-2 is relatively high, which can be used as further experimental material to detect the change of metabolites and see whether ginsenoside CK is generated.

[0123] 3, Metabolite analysis of mature tomato fruits

[0124] (1) Extraction of saponins in tomato fruits

[0125] ① The tomato plants identified as positive were used as experimental materials, and the mature period tomato fruits of 7 days after breaking color of transgenic and wild type were taken, ground into powder with liquid nitrogen, 1 g powder was weighed and placed in a 50 mL centrifuge tube, 3 repeats for each treatment, and thawed at room temperature for 20 min.

[0126] ②Each centrifuge tube was added with 1 mL of methanol and soaked for 3 h.

[0127] ③After soaking, the sample was ultrasonically treated for 1.5 h under the following conditions: 100 W, 4 s of ultrasonic treatment, and 2 s of interval.

[0128] ④After the ultrasonic treatment, the supernatant was collected in a new 2 mL centrifuge tube at room temperature under the following centrifugal conditions: 12000 rpm, 10 min.

[0129] ⑤Pre-treatment of the sample for determination of ginsenoside CK (CK): 200 μL of the supernatant was taken, passed through a 0.22 μm organic filter membrane, and placed in a liquid-phase vial with an inner lining tube, and stored in a -20 °C refrigerator for use.

[0130] ⑥Pre-treatment of the sample for determination of dammarenediol (DD) and protopanaxadiol (PPD): the remaining supernatant was blown dry with nitrogen, 800 μL of tert-butyl methyl ether was added, 200 μL of the supernatant after dissolution was taken and placed in a liquid-phase vial with an inner lining tube, and stored in a -20 °C refrigerator for use.

[0131] (2) Preparation of standard solution

[0132] Preparation of standard stock solution: 1 mg of the standard DD, PPD and CK solid powder was weighed into a 15 mL centrifuge tube, 1 mL of methanol was added respectively, and after shaking and dissolution, a 1 mg / mL standard stock solution was obtained, which was placed in a brown liquid-phase vial and stored in a -20 °C refrigerator for use.

[0133] Preparation of standard working solution: the standard stock solution was sequentially diluted with chromatographic grade methanol to 100 mg / L, 10 mg / L, 1 mg / L, 500 μg / L, 250 μg / L, 100 μg / L, 50 μg / L, 25 μg / L, 10 μg / L, 5 μg / L, 2.5 μg / L, 1 μg / L and 0.5 μg / L, to obtain a standard working solution with a concentration, and a standard curve was drawn with the peak area of the standard solution as the ordinate and the volume concentration as the abscissa.

[0134] (3) Determination of saponins in tomato fruits

[0135] ① Determination of dammarenediol and protopanaxadiol content

[0136] The system of Agilent GC-MS (GC-MS-RMN3540A) equipped with HP-5MS UI chromatographic column (30 m x 0.25 mm x 0.25 μm, USA) was used to determine DD and PPD, and the injection volume was 1 μL. The temperature program was set as follows: the initial temperature was 50 °C (maintained for 2 min), and then increased from 50 °C to 320 °C at a rate of 30 °C / min, and maintained for 15 min.

[0137] 2. Determination of ginsenoside CK content

[0138] Chromatographic conditions: LC-MS / MS was performed using Thermo Scientific TM TSQ Quantis TM Plus triple quadrupole mass spectrometer, the chromatographic column was Shim-pack Velox chromatographic column (specification PFPP, 1.8 μm, 2.1 x 100 mm); mobile phase A was 0.1% formic acid aqueous solution, mobile phase B was 100% acetonitrile by volume fraction; column temperature was 25°C, injection volume was 20 μL, flow rate was 0.3 mL / min; gradient elution program was: 0 min: 5% B + 95% A; 5 min: 5% B + 95% A; 8 min: 90% B + 10% A; 12 min: 90% B + 10% A; 12 min: 5% B + 95% A; 13 min: 5% B + 95% A.

[0139] Ion source parameters: electrospray ion source; positive ion mode; ion source spray voltage setting range was 2000 V-35000 V; sheath gas was nitrogen, flow rate was 35 L / min; auxiliary gas flow rate was 5 L / min; purge gas flow rate was 10 L / min; ion transmission tube temperature was 325°C; atomizer temperature was 350°C.

[0140] Mass spectrometry parameters are shown in Table 4.

[0141] Table 4 Ginsenoside CK mass spectrometry parameters

[0142] Compound Precursor (m / z) RF Lens (V) Min Dwell Time (ms) Time (min) Ginsenoside CK 623.5 267 98.893 8.17

[0143] Tomato contains an important precursor substance for terpenoid synthesis, 2,3-oxidosqualene, and the PnDS enzyme encoded by the PnDS gene in Panax notoginseng can catalyze 2,3-oxidosqualene to form dammarenediol-II. After the PnDS gene was introduced into tomato, the expression amount of the PnDS gene in different transgenic lines was detected by qRT-PCR reaction, and whether dammarenediol-II was synthesized in mature tomato fruits was detected by GC-MS. GC-MS detected dammarenediol-II in SDCG-2, SDCG-8, and SD-15 lines, and the chromatogram is shown in Figure 5 A, the standard showed a peak at 18.1 min, by comparison with the standard, SDCG-2, SDCG-8, and SD-15 lines showed corresponding peaks at 18.1 min, while the wild type did not show corresponding peaks, indicating that SDCG-2, SDCG-8, and SD-15 lines successfully synthesized dammarenediol-II under the action of PnDS enzyme.

[0144] To further determine the content of dammarenediol-II in SDCG-2, SDCG-8, SD-15 strains, the dammarenediol-II standard sample was diluted to different working concentrations to establish a standard curve, and the regression equation of the standard curve was y = 45.629139x-43.720864, and the linear correlation coefficient R2 was 0.99821565. According to the standard curve, the content of dammarenediol-II in the transgenic strains was calculated, such as Figure 5 As shown in B, the content of dammarenediol-II synthesized by SDCG-2 strain is 5.526 ng / g FW, the content of dammarenediol-II synthesized by SDCG-8 strain is 2.945 ng / g FW, and the content of dammarenediol-II synthesized by SD-15 strain is 22.993 ng / g FW. The content of dammarenediol-II in the transgenic strain SD-15 is the highest.

[0145] The protopanaxadiol is formed by hydroxylation of C-12 of dammarenediol-II by cytochrome P450 enzyme (CYP716A47). After the PnDS and CYP716A47 genes of Panax notoginseng are successfully transferred into tomatoes for expression, the PnDS enzyme encoded by PnDS catalyzes 2,3-oxidosqualene in tomatoes to generate dammarenediol-II, and the protopanaxadiol synthase encoded by CYP716A47 catalyzes dammarenediol-II to synthesize protopanaxadiol. The content of protopanaxadiol in SDCG-2 and SDCG-8 strains is detected by GC-MS, and protopanaxadiol is not detected. This is because protopanaxadiol is a precursor of ginsenoside synthesis, and the ginsenoside glycosyltransferase successfully expressed in the tomatoes of the application has high activity, which can rapidly catalyze the protopanaxadiol synthesized in the previous synthesis step to form ginsenoside, so that it is difficult to accumulate protopanaxadiol in the transgenic tomato plants obtained by the application. Therefore, once protopanaxadiol is formed in the transgenic tomato fruits obtained by the application, it is efficiently glycosylated and modified by the transferred glycosyltransferase GT95 to form protopanaxadiol-type ginsenoside.

[0146] Ginsenoside CK is generated by glycosylation and modification of protopanaxadiol by glycosyltransferase GT95. After the PnSE, PnDS, CYP716A47 and GT95 of Panax notoginseng are transferred into tomatoes, PnSE catalyzes squalene to generate 2,3-oxidosqualene, which is a key precursor of ginsenoside synthesis, PnDS catalyzes 2,3-oxidosqualene to generate dammarenediol-II, which is the basic triterpene skeleton of ginsenoside, cytochrome P450 enzyme CYP716A47 catalyzes dammarenediol-II to generate protopanaxadiol, and finally glycosyltransferase GT95 catalyzes protopanaxadiol to generate ginsenoside CK. The ginsenoside CK in SDCG-2 and SDCG-8 strains is detected by LC-MS, and the chromatogram is as shown in Figure 6As shown in A. The standard sample appeared a peak at 8.7 min, by comparison with the standard sample, SDCG-2 and SDCG-8 strains appeared a peak of dammarenediol-II at 18.1 min, while the wild type did not appear this peak, indicating that SDCG-2 and SDCG-8 strains successfully synthesized ginsenoside CK under the action of GT95 enzyme.

[0147] In order to further determine the content of ginsenoside CK in SDCG-2 and SDCG-8 strains, the ginsenoside CK standard sample was diluted to different working concentrations to establish a standard curve, and the regression equation of the standard curve was y=3440.57x-408.133, and the linear correlation coefficient R2 was 0.9990. According to the standard curve, the content of ginsenoside CK in the transgenic strains was calculated, as shown in B. The content of ginsenoside CK synthesized by SDCG-2 strain was 4.327 ng / g FW, and the content of ginsenoside CK synthesized by SDCG-8 strain was 0.470 ng / g FW, and the content of ginsenoside in the transgenic strain SDCG-2 was 9.2 times higher than that in SDCG-8 strain. Figure 6 B. The content of ginsenoside CK synthesized by SDCG-2 strain was 4.327 ng / g FW, and the content of ginsenoside CK synthesized by SDCG-8 strain was 0.470 ng / g FW, and the content of ginsenoside in the transgenic strain SDCG-2 was 9.2 times higher than that in SDCG-8 strain.

[0148] Through screening at the genome and transcriptome levels, two transgenic strains simultaneously expressed the four genes, SDCG-2 and SDCG-8, wherein the expression amounts of PnSE, PnDS, CYP716A47 and GT95 genes of SDCG-2 strain were higher. At the same time, the contents of metabolites dammarenediol-II, protopanaxadiol and ginsenoside CK were detected by GC-MS. The content of dammarenediol-II in SD-15 strain with high expression of PnSE and PnDS was 22.993 ng / g FW; followed by SDCG-2 strain, the content was 5.526 ng / g FW; the content of SDCG-8 strain was slightly lower, which was 2.945 ng / g FW. SD-15 strain did not introduce CYP716A47 and GT95 genes, so the dammarenediol-II accumulated in vivo was not metabolized, and the content was 4.17 times of that of SDCG-2 strain. Since the glycosyltransferase successfully expressed in the tomato of the application has high activity, protopanaxadiol is catalyzed to ginsenoside as soon as it is formed, so protopanaxadiol has not been detected. Through detection, the contents of ginsenoside CK in SDCG-2 and SDCG-8 strains were 4.327 ng / g FW and 0.470 ng / g FW, respectively, and the content of ginsenoside CK in SDCG-2 strain was 9.2 times of that in SDCG-8 strain. It can be seen that the higher the expression amount of the gene, the higher the concentration of the metabolite catalyzed by the enzyme coded by the gene.

[0149] The above examples of the present application introduce PnSE, PnDS, CYP716A47 and GT95 genes in Panax notoginseng into tomatoes by Agrobacterium-mediated method, and make the four genes express in tomatoes under the drive of fruit-specific promoter E8, so that the four genes express in mature tomatoes and only ginsenoside CK is synthesized in the fruits, and edible and healthy fruits and vegetables are successfully obtained. However, some other species with mature transformation system, such as tobacco and Arabidopsis, are not suitable for direct consumption.

[0150] The above description is only the preferred embodiments of the present application, and does not limit the present application in any form. Although the present application has been disclosed as the above preferred embodiments, it is not intended to limit the present application. Any person skilled in the art can make slight changes or modifications to the above disclosed technical content to obtain equivalent embodiments with equivalent changes, without departing from the technical solution of the present application. Any modification, change, equivalent change and modification of the above embodiments according to the technical essence of the present application still belong to the scope of the technical solution of the present application.

Claims

1. A method for creating tomato varieties with high ginsenoside content, characterized in that: This was achieved by increasing the expression levels of the genes PnSE, PnDS, CYP716A47, and GT95 in tomatoes.

2. The method according to claim 1, characterized in that: The ginsenoside mentioned is the rare ginsenoside CK.

3. The method according to any one of claims 1 or 2, characterized in that: The method to increase the expression levels of genes PnSE, PnDS, CYP716A47 and GT95 in tomatoes is as follows: construct plant expression vectors that can express genes PnSE, PnDS, CYP716A47 and GT95, and transform tomatoes. Preferably, the method for increasing the expression levels of genes PnSE, PnDS, CYP716A47, and GT95 in tomatoes is as follows: PnSE and PnDS genes are constructed onto the expression vector backbone to obtain recombinant vector 1, and CYP716A47 and GT95 genes are constructed onto the expression vector backbone to obtain recombinant vector 2; recombinant vector 1 and recombinant vector 2 are transformed into tomatoes.

4. The method according to claim 3, characterized in that: The expression vector backbone is pPZP212; or, the promoter used in the plant expression vector is a fruit-specific promoter; preferably, the fruit-specific promoter is E8.

5. The use of tomato fruit obtained by the method according to any one of claims 1 to 4 in the production of ginsenoside CK.

6. A method for synthesizing ginsenoside CK in tomatoes, characterized in that: By increasing the expression levels of genes PnSE, PnDS, CYP716A47, and GT95 in tomatoes, transgenic tomato varieties with high ginsenoside content were obtained, and ginsenoside CK was extracted from the transgenic tomato plants. Preferably, the tomato variety with high ginsenoside content is created according to the method described in any one of claims 1 to 4.

7. The method according to claim 8, characterized in that: Ginsenoside CK was extracted from the genetically modified tomato plants after they matured. Furthermore, the ginsenoside CK is extracted from tomato fruit.

8. The method according to claim 7, characterized in that: The procedure for extracting ginsenoside CK is as follows: Take ripe tomato fruits, quick-freeze them with liquid nitrogen, and grind them into powder; soak them in methanol; treat them with ultrasound; centrifuge and collect the supernatant; Preferably, the methanol soaking time is 0.5 to 12 hours; Preferably, the conditions for the ultrasonic treatment are: 50-500W, ultrasonic treatment for 1-8 seconds, interval for 1-30 seconds, and a total treatment time of 0.5-6 hours; Preferably, the centrifugation conditions are: 12000 rpm, 10 min.

9. The method according to claim 8, characterized in that: The methanol soaking time is 3 hours; or, the ultrasonic treatment conditions are: 100W, ultrasonic for 4 seconds, intermittent for 2 seconds, for a total treatment of 1.5 hours.

10. A method for synthesizing dammarene diol-II in tomatoes, characterized in that: This was achieved by increasing the expression levels of the genes PnSE and PnDS in tomatoes. Preferably, the method for increasing the expression levels of genes PnSE and PnDS in tomatoes is as follows: constructing plant expression vectors for genes PnSE and PnDS and transforming them into tomatoes.

Images