Specific molecular marker for identifying genetic sex of mugilogobius chuchuyi and application of specific molecular marker

Abstract

The invention discloses a specific molecular marker for identifying genetic sex of mugilogobius chuyi and application of the specific molecular marker for identifying genetic sex of mugilogobius chuyi. According to the invention, a specific molecular marker capable of identifying genetic sex of mullet chubil is developed by sequencing, comparing and analyzing full-length transcriptome of male and female gonads, and a detection primer pair of the molecular marker is designed to carry out PCR and qPCR amplification detection on a to-be-detected mullet chubil sample. Through Sanger sequencing and peak patterns of a high-resolution melting curve, the genetic sex of the mullet chubil can be accurately distinguished, and verification shows that the method is stable and applicable to both laboratory groups and wild groups. The method for rapidly, accurately, economically and reliably identifying the genetic sex of the mullet obliterans is established, is suitable for identifying the genetic sex of the mullet obliterans in each development stage, can conveniently and rapidly confirm the genetic sex of the mullet obliterans, and lays a foundation for researching the biological characteristics of the mullet obliterans and sex differentiation and regulation of the mullet obliterans.

Description

Technical Field

[0001] This invention belongs to the field of fish sex identification technology, and more specifically, relates to a specific molecular marker for identifying the genetic sex of the mullet goby and its application. Background Technology

[0002] Zhu's mullet goby ( Mugilogobius chulae *Mugilogobius*, belonging to the order Perciformes, family Gobiidae, and genus *Mugilogobius*, is a small, warm-water marine fish widely distributed along the western Pacific coast, including the South China Sea and East China Sea. This species is characterized by its small size, high reproductive rate, transparent embryos, short breeding cycle, and ease of artificial rearing. Currently, my country has successfully achieved fully artificial breeding of *Mugilogobius* and has conducted in-depth research on its biology and quality control techniques, including karyotype analysis, whole-genome sequencing, genetic marker development, nutritional requirement determination, and microbial control, establishing closed colonies and inbred lines. Simultaneously, several toxicological evaluation standards have been developed for this fish species, including acute toxicity, feeding inhibition, growth inhibition, and reproductive toxicity, enabling its widespread application in marine ecotoxicological research on heavy metal pollutants, organic matter, inorganic matter, and endocrine disruptors.

[0003] However, research reports on the sex determination mechanism of *Mulletodon zhubryanus* are currently scarce, and its sex chromosome composition and key sex-determining genes remain unknown. This lack of basic knowledge makes rapid sex determination of this fish difficult, particularly in terms of effective external sexing of immature individuals. This deficiency in sex determination technology severely restricts in-depth exploration of *Mulletodon zhubryanus* in basic biology (such as sex differentiation and reproductive physiology) and hinders its potential for further development and application as a model organism in fields such as genetics, developmental biology, and toxicology.

[0004] Patent CN111763744A identifies the physiological sex of individuals by detecting gonad-specific gene expression in the mullet goby. However, this method has significant drawbacks: 1) It requires dissecting the gonads of the mullet goby, extracting total RNA using the gonads as a template, then reverse transcribing it into cDNA, performing PCR using the cDNA as a template, followed by electrophoresis. This method cannot be used for live detection and is time-consuming and costly; 2) This method can only be performed after the gonads of the mullet goby have formed, and cannot detect earlier stages; 3) This method can amplify a single target band in the cDNA of the testes of physiological males, but cannot amplify the target band in the cDNA of the ovaries of physiological females, leading to false positives and affecting the accuracy of identification. Therefore, there is an urgent need to develop a method for genetic sex identification in immature mullet gobies that can be used for live detection. Summary of the Invention

[0005] The present application aims to overcome the above-mentioned defects and deficiencies in the prior art, and provide a specific molecular marker for identifying the genetic sex of Oreichthys cosmi.

[0006] The second object of the present application is to provide a primer pair for identifying the genetic sex of Oreichthys cosmi.

[0007] The third object of the present application is to provide a kit for identifying the genetic sex of Oreichthys cosmi.

[0008] The fourth object of the present application is to provide the use of the above-mentioned specific molecular marker, primer pair and kit in the identification of the genetic sex of Oreichthys cosmi.

[0009] The fifth object of the present application is to provide a method for identifying the genetic sex of Oreichthys cosmi.

[0010] The sixth object of the present application is to provide a breeding method for improving the production efficiency of Oreichthys cosmi.

[0011] The above-mentioned objects of the present application are realized by the following technical solutions: The present application provides a specific molecular marker for identifying the genetic sex of Oreichthys cosmi, and the sequence of the molecular marker is shown in SEQ ID NO. 1-2.

[0012] The present application is based on the full-length transcriptome sequencing comparison analysis of the testis and ovary of Odachthrus chrysargyi, and it is found that there are two highly homologous transcripts, Mc15468 and Mc15469, and Mc15468 is expressed in the testis and ovary, while Mc15469 is only expressed in the testis, both of which are highly homologous, and only have insertions and deletions in part of the sequence. Further, a pair of primers (the nucleotide sequences of which are shown as SEQ ID NO. 3-4) are designed based on the sequences of the two, and the primers can amplify a 101-107 bp PCR product in the genomic DNA of Odachthrus chrysargyi. Sequencing shows that the primer pair only has a single PCR product (named F-SEQ, 107 bp) in female fish, and can amplify two highly consistent PCR products M-SEQL (107 bp) and M-SEQS (101 bp) in male fish, wherein the F-SEQ and M-SEQL sequences are consistent (the nucleotide sequence is shown as SEQ ID NO. 1), and the M-SEQS sequence fragment has a 6 bp deletion and partial site mutations (the nucleotide sequence is shown as SEQ ID NO. 2). The two bands cannot be distinguished by agarose electrophoresis, but with the help of sequencing or high-resolution melting curve technology of qPCR, the two PCR products can be distinguished, so as to realize the DNA-based gender identification method. The method does not need to dissect the gonad of Odachthrus chrysargyi, and only a small amount of fin rays are needed to extract DNA to realize the live detection of genetic sex, and is not affected by the development stage and physiological state of the fish body, and can also exclude the interference of false positive results.

[0013] Therefore, the present application provides a primer pair for detecting the specific molecular marker.

[0014] Further, the nucleotide sequences of the primer pair are shown as SEQ ID NO. 3-4.

[0015] The present application also provides a kit for genetic sex identification of Odachthrus chrysargyi, comprising the above-mentioned primer pair.

[0016] The present application also provides the application of the above-mentioned specific molecular marker or the above-mentioned primer pair or the above-mentioned kit in the genetic sex identification of Odachthrus chrysargyi.

[0017] The present application also provides a method for identifying the genetic sex of Odachthrus chrysargyi, which uses the above-mentioned primer pair to perform PCR amplification on the genomic DNA of Odachthrus chrysargyi, and then performs sex differentiation after sequencing the PCR product, and the fish containing the two sequences shown as SEQ ID NO. 1-2 in the above-mentioned specific molecular marker is a male fish, and the fish containing the single sequence shown as SEQ ID NO. 1 is a female fish. Or using the above primer pair to carry out quantitative PCR (qPCR) amplification on the genome DNA of Oreichthys cosmius, and distinguishing the gender by the peak type of high-resolution melting curve, the single melting curve peak type is female, and the two melting curve peak types are male.

[0018] Further, the genomic DNA is extracted from the fin strip, blood and muscle of Oreichthys cosmius.

[0019] Further, the melting reaction procedure of the qPCR amplification is 95℃ 60s, 40℃ 60s, 65℃ 1s and 97℃ 1s.

[0020] Further, the qPCR amplification system takes the genomic DNA of Oreichthys cosmius as a template, 2*qPCR Mix 10 μL, 0.5 μL of the upper and lower primers (10 μM) respectively, 1.5 μL of DNA (50 ng / μL) and 7.5 μL of ddH2O.

[0021] Further, the qPCR amplification procedure takes the genomic DNA of Oreichthys cosmius as a template, 95℃ 5min; 95℃ 10s, 60℃ 20s (collect fluorescence), 35 cycles; 95℃ 60s, 40℃ 60s, 65℃ 1s, 97℃ 1s (collect fluorescence); 37℃ 30s.

[0022] Further, the sequencing is Sanger sequencing.

[0023] Further, the PCR amplification system takes the genomic DNA of Oreichthys cosmius as a template, 2*PCR Mix 10 μL, 0.5 μL of the upper and lower primers (10 μM) respectively, 1.5 μL of DNA (50 ng / μL) and 7.5 μL of ddH2O.

[0024] Further, the PCR amplification procedure takes the genomic DNA of Oreichthys cosmius as a template, 95℃ 7min; 95℃ 30s, 60℃ 30s, 72℃ 20s, 33 cycles; 72℃ 5min.

[0025] The application also provides a breeding method for improving the production efficiency of Oreichthys cosmius, which distinguishes the genetic gender of Oreichthys cosmius by using the above specific molecular marker, the above primer pair, the above kit or the above identification method, and breeds according to the gender ratio.

[0026] Compared with the prior art, the application has the following beneficial effects: The application provides a specific molecular marker for identifying the gender of Oreichthys cosmius and application thereof. The application develops a specific molecular marker for identifying the genetic gender of the Oreichthys cosmius through comparative analysis and PCR amplification verification of full-length transcriptome sequencing of female and male gonads, the marker sequence is shown as SEQ ID NO. 1-2, the DNA sample of the to-be-tested Oreichthys cosmius is subjected to PCR and qPCR amplification detection by using a primer pair for detecting the molecular marker, and the genetic gender of the Oreichthys cosmius can be accurately distinguished through Sanger sequencing or the peak type of a high-resolution melting curve, and the method is stable and applicable in laboratory populations and wild populations. The application establishes a method for identifying the genetic gender of the Oreichthys cosmius without dissecting the gonad of the Oreichthys cosmius, only a small amount of fin rays are taken to extract DNA, and the genetic gender of the Oreichthys cosmius can be detected in vivo, and the method is not affected by the development stage and physiological state of the fish body, and can also exclude the interference of false positive results, and is fast, accurate, economical and reliable, and is suitable for the genetic gender identification of the Oreichthys cosmius at various development stages, and can conveniently and quickly confirm the genetic gender of the Oreichthys cosmius, and lays a foundation for studying the biological characteristics and gender differentiation and regulation of the Oreichthys cosmius. BRIEF DESCRIPTION OF DRAWINGS

[0027] Figure 1 It is the electrophoresis result of PCR products of female and male individuals.

[0028] Figure 2 It is the sequencing alignment result of PCR products of female and male individuals. Note: F&M-long is SEQ ID NO. 1 of the application; M-short is SEQ ID NO. 2 of the application.

[0029] Figure 3 It is the qPCR reaction program.

[0030] Figure 4 It is the DNA quantitative PCR melting curve of the female fish.

[0031] Figure 5 It is the DNA quantitative PCR melting curve of the male fish. DETAILED DESCRIPTION

[0032] The application will be further described below in combination with the drawings and specific examples in the specification, but the examples do not limit the application in any form. Unless otherwise specified, the reagents, methods and equipment used in the application are conventional reagents, methods and equipment in the technical field.

[0033] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0034] Example 1: Transcriptome sequencing of total RNA of testis and ovary of Oreichthys cosmius I. Experimental method Three female and three male sexually mature O. jordani were selected to determine the physiological sex by phenotype and the type of gonad. The total RNA of testis and ovary was extracted, and then sent to a biological company for full-length transcriptome sequencing.

[0035] II. Experimental results The alignment analysis of the sequencing results found that two transcripts, Mc15468 and Mc15469, were highly homologous in sequence. Mc15468 was expressed in both testis and ovary, while Mc15469 was only expressed in testis. Sequence alignment of Mc15468 and Mc15469 found that they were highly homologous, with insertions and deletions in some sequences. Based on the sequences of Mc15468 and Mc15469, a pair of primers was designed (GAGAGCATCAACACGGCATTC (SEQ ID NO. 3) and ATGTAACTGGTGGCGAGACGC (SEQ ID NO. 4)).

[0036] The sequence of transcript Mc15468 (SEQ ID NO. 1): GAGAGCATCAACACGGCATTCGCGGAGCTCCGGGAGTGCATCCCCAACGTGCCCGCGGACACCAAGCTGTCCAAGATCAAAACGCTGCGTCTCGCCACCAGTTACAT (sequence is 5'-3' direction) The sequence of transcript Mc15469 (SEQ ID NO. 2): GAGAGCATCAACACGGCATTCGCAGAGCTACGGAAGTGCATCCCTAACGCTGGTACCAAGCTGTCCAATTTCCAAACTCTGCGTCTCGCCACCAGTTACAT (sequence is 5'-3' direction) Example 2 Verification of the primers provided in Example 1 in O. jordani sex identification 1. A small amount of tail fin of 10-month-old female and male O. jordani with known sex was cut off, respectively. The genomic DNA was extracted by phenol chloroform method, and the DNA quality and concentration were detected by Nanodrop 2000 spectrophotometer. After further detection of DNA quality by 1% agarose gel electrophoresis, the female and male goby DNA were used as templates for PCR amplification: 2*PCR Mix (Quigen, Beijing) 10 μL, upper and lower primers (10 μM) 0.5 μL each, DNA (50 ng / μL) 1.5 μL, ddH2O 7.5 μL. The PCR program was as follows: 95℃ 7min; 95℃ 30s, 60℃ 30s, 72℃ 20s, 33 cycles; 72℃ 5min, 4℃ storage. The PCR products were detected by 1.5% agarose gel electrophoresis.

[0037] Results as shown in Figure 1 , the primer can be amplified in both sexes about 100 bp band, the sex of the individual PCR product electrophoresis results no obvious difference.

[0038] 2, the PCR product was gel recovery purification, reference gel recovery kit (full style gold, Beijing) operation instruction, purification PCR product, then the PCR product was ligated into PUC57 cloning vector, transformed into E. coli, selected positive clones to the biological company for sequencing.

[0039] The sequencing results as shown in Figure 2 , the PCR product in female fish is 107 bp DNA fragment (F-SEQ); and the PCR product in male fish is two DNA fragments of 107 bp (M-SEQL) and 101 bp (M-SEQS), wherein the F-SEQ and M-SEQL sequences are identical (the nucleotide sequence is shown as SEQ ID NO. 1), and the M-SEQS sequence fragment has a 6 bp deletion and partial site mutation (the nucleotide sequence is shown as SEQ ID NO. 2).

[0040] 3, using fluorescent quantitative reagent (full style gold, Beijing) in Roche LC96 quantitative PCR instrument (Roche, Switzerland) for qPCR amplification detection of female and male DNA, the reaction system 20 μL, containing 2*qPCR Mix 10 μL, upstream and downstream primers (10 μM) 0.5 μL each, DNA (50 ng / μL) 1.5 μL, ddH2O 7.5 μL.

[0041] PCR program as shown in Figure 3 : 95℃ 5min; 95℃ 10s, 60℃ 20s (collect fluorescence), 35 cycles; 95℃ 60s, 40℃ 60s, 65℃ 1s, 97℃ 1s (collect fluorescence); 37℃ 30s preservation.

[0042] From the results of Figure 4 and Figure 5 , the melting curve of female individuals is a single peak, while the melting curve of male individuals is a double peak; by comparing the characteristics of the melting curve, the genetic sex of the goby can be quickly and accurately distinguished.

[0043] In summary, the sequences of SEQ ID NO. 1-2 can be used as specific molecular markers for identifying the genetic sex of O. jordani. The primers provided in the present application can well distinguish the genetic sex of the goby, and the genetic sex of O. jordani can be quickly identified within 3-4 hours (about 2 hours for cutting fin and extracting DNA, and about 1 hour for qPCR reaction) by using the fluorescent quantitative detection method.

[0044] Example 3 Application of the primers provided in Example 1 in detecting the sex of wild O. marmoratus I. Experimental method Sixty-five sexually mature wild O. marmoratus were purchased from a fish market. The sex of the fish was first determined by observing the body phenotype and the appearance of the gonad. Because of the difference between the growth environment of wild fish and the laboratory environment, and the fact that the nutritional status of wild fish was generally not as good as that of the laboratory population, the difference in the structure of the testis and ovary was not obvious, and only 15 females and 18 males could be roughly determined, and the gonad of the rest could not be determined by appearance. Therefore, paraffin tissue sections of the gonad of all individuals were prepared to observe the genetic sex of wild O. marmoratus by HE staining, and the genomic DNA of the fin rays of all individuals was extracted, and the genetic sex of wild O. marmoratus was analyzed by qPCR amplification and melting curve analysis according to the method of Example 2 to identify the feasibility of the method of Example 2 in detecting the sex of wild O. marmoratus.

[0045] II. Experimental results The results are shown in Table 1 below. Among the first round of gonad appearance determination of the sex, 2 females were misjudged as males. Except for the fact that no product was produced by qPCR due to the poor quality of the DNA extraction of 3 individuals, the melting curve determination results of all individuals were consistent with the section results.

[0046] Table 1 Identification of the sex of wild O. marmoratus

[0047] From the above results, it can be seen that the success rate of the primers provided in Example 1 in detecting the genetic sex of unknown O. marmoratus can reach 95.4%, and therefore the primers provided in Example 1 and the method provided in Example 2 are applied to detect the genetic sex of unknown O. marmoratus.

Claims

1. A specific molecular marker for identifying the genetic sex of Oreichthys cosmius, characterized in that, The nucleotide sequence of the specific molecular marker is shown as SEQ ID NO. 1-2.

2. A primer pair for detecting the specific molecular marker of claim 1.

3. The pair of primers according to claim 2, wherein The nucleotide sequence of the primer pair is shown as SEQ ID NO. 3-4.

4. A kit for genetic sex identification of O. jordani, characterized by, The kit comprises the primer pair of any one of claims 2 or 3.

5. The specific molecular marker of claim 1, the primer pair of any one of claims 2-3, or the kit of claim 4 is used for identifying the genetic sex of Oreichthys cosuatinus.

6. A method for identifying the genetic sex of Oryzias latipes, characterized by, The primer pair of claim 2 or 3 is used for PCR amplification of the genomic DNA of O. cosuatinus, and the PCR product is sequenced to distinguish the sex, wherein the male fish contains the two sequences shown as SEQ ID NO. 1-2 in the specific molecular marker of claim 1, and the female fish contains the single sequence shown as SEQ ID NO. 1; or the primer pair of claim 2 or 3 is used for quantitative PCR amplification of the genomic DNA of O. cosuatinus, and the sex is distinguished by the peak type of high-resolution melting curve, wherein the female fish obtains the single peak type of melting curve, and the male fish obtains the two peak types of melting curve.

7. The method of claim 6, wherein the method further comprises the step of: The sequencing is Sanger sequencing. ​ 8. The method of claim 6, wherein the method further comprises the step of: The melting reaction procedure of the quantitative PCR amplification is 95℃ for 60s, 40℃ for 60s, 65℃ for 1s, 97℃ for 1s. ​ 9. The method of claim 6, wherein the method further comprises the step of: The genomic DNA is extracted from the fin, blood, or muscle of O. cosuatinus. ​ 10. A method for improving the production efficiency of O. jordani, characterized by, The genetic sex of O. cosuatinus is distinguished by the specific molecular marker of claim 1, the primer pair of any one of claims 2-3, the kit of claim 4, or the identification method of any one of claims 6-9, and the fish is bred according to the sex ratio.

Images