InDel molecular marker closely linked with soybean protein content character, detection primer and application

Abstract

The invention discloses an InDel molecular marker closely linked with soybean protein content characters, a detection primer and application, and belongs to the technical field of molecular biology. The nucleotide sequence of the InDel molecular marker is shown as SEQ ID NO.5, the 96th site to the 106th site of the SEQ ID NO.5 are insertion or deletion variation, and the soybean containing the 96th site to the 106th site insertion sequence of the SEQ ID NO.5 is a variety with high protein content; and the soybean containing the 96th-106th deletion sequence of the SEQ ID NO.5 is a variety with low protein content. According to the invention, 11bp insertion / deletion variation at 377 and 973bp positions of the soybean 14 # chromosome is found, and experiments show that the 11bp insertion / deletion variation has remarkable relevance with the soybean protein content. When the gene is applied to molecular assisted breeding, the protein content expression of a soybean candidate material can be predicted at an early stage.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular biology, in particular to an InDel molecular marker closely linked to the soybean protein content trait, a detection primer and application. BACKGROUND

[0002] Soybean (Glycine max L.) is an important food and oil crop in the world, and its seed protein content is one of the core traits that determine nutritional quality and economic value. However, protein content is a typical polygenic quantitative trait, which is easily affected by environmental factors, and traditional phenotypic selection methods have the problems of long cycle, low efficiency, and poor stability. With the development of molecular breeding technology, locating major quantitative trait loci (QTL) closely linked to the target trait and developing functional molecular markers have become the key strategy to break through the difficulties of quality breeding.

[0003] The essence of QTL mapping is to determine the linkage degree between markers and potential QTL by statistical analysis of the correlation between polymorphic molecular markers and the phenotypes of target quantitative traits according to Morgan's genetic linkage law. Using known molecular markers, unknown QTL can be located. Once a molecular marker closely linked to a major QTL is obtained, it can be applied to molecular marker-assisted selection (MAS) breeding.

[0004] Although progress has been made in the study of soybean protein content QTL mapping, there are still significant challenges. The relevant QTL sites recorded in the public database SoyBase have exceeded 240, however, the proportion of most sites explaining phenotypic variation is generally low (usually less than 10%), and the stability is poor under different genetic backgrounds or environmental conditions, which limits their direct application in breeding practice. The results of many studies also confirm this point: Lee et al. (1996) located multiple common markers related to protein and oil in a specific hybrid combination; Liang et al. (2010) and Pathan et al. (2013) also identified multiple protein and oil QTLs in different populations; Li et al. (2019) found new related sites and candidate genes in a specific ecological region through association analysis. Although these studies have enriched the genetic map of soybean quality traits, the problem of small and unstable QTL effects is still prominent. Therefore, to address the problems of low QTL effect and poor stability in current research, developing molecular markers that can be closely linked to major QTLs and stably expressed in different genetic populations and environments is a key breakthrough for efficient soybean molecular assisted breeding. SUMMARY

[0005] The application aims to provide an InDel molecular marker closely linked to the soybean protein content trait, a detection primer and an application, so as to solve the problems in the prior art. The application finds that a 11bp insertion / deletion variation at 377,973bp of the 14th chromosome of soybean has significant correlation with the protein content of soybean. The protein content of soybean material carrying a 301bp fragment is significantly higher than that of soybean material carrying a 290bp fragment, which proves that the marker containing the insertion / deletion variation can be used as an effective selection index of the high-protein trait. The application of the marker to molecular-assisted breeding can predict the protein content performance of candidate soybean materials at an early stage and realize rapid differentiation of different genotypes.

[0006] To achieve the above object, the application provides the following scheme.

[0007] The application provides an InDel molecular marker closely linked to the soybean protein content trait, wherein the nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO. 5, the 96th-106th positions of SEQ ID NO. 5 are an insertion or deletion variation, soybean containing the insertion sequence of the 96th-106th positions of SEQ ID NO. 5 is a high-protein variety, and soybean containing the deletion sequence of the 96th-106th positions of SEQ ID NO. 5 is a low-protein variety.

[0008] The nucleotide sequence of the insertion or deletion variation is shown in SEQ ID NO. 1.

[0009] The application further provides a primer pair for detecting the InDel molecular marker, which comprises an upstream primer with the nucleotide sequence shown in SEQ ID NO. 2 and a downstream primer with the nucleotide sequence shown in SEQ ID NO. 3.

[0010] The application further provides a kit for detecting the InDel molecular marker, which comprises the primer pair.

[0011] The application further provides an application of the primer pair or the kit in identifying the protein content of soybean.

[0012] The application further provides a method for identifying the protein content of soybean, which comprises the following steps.

[0013] Genomic DNA of the soybean to be detected is extracted, and PCR amplification is performed on the genomic DNA by using the primer pair; after gel electrophoresis of the amplification product, the protein content of the soybean to be detected is determined according to the electrophoretic band.

[0014] If the electrophoretic band is 290bp, the protein content of the soybean to be detected is low; if the electrophoretic band is 301bp, the protein content of the soybean to be detected is high.

[0015] Further, the reaction system of the PCR amplification is 50 ng / μL DNA template 2 μL; 10 μmol / L upper and lower primers each 0.25 μL; 2x Taq Mix 5 μL; double distilled water 2.5 μL.

[0016] Further, the reaction procedure of the PCR amplification is 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 58℃ annealing for 15 seconds, 72℃ extension for 30 seconds, 35 cycles; 72℃ incubation for 5 minutes, 4℃ preservation.

[0017] The application further provides application of the primer pair or the kit in screening soybeans with high protein content.

[0018] The application further provides application of the primer pair or the kit in molecular marker-assisted selection of soybean protein content traits.

[0019] The application discloses the following technical effects:

[0020] The QTL site and the InDel molecular marker related to the soybean protein content provided by the application provide an efficient molecular assisted selection tool for soybean high-protein breeding. The 11bp insertion / deletion variation at 377,973bp of the 14th chromosome of soybean can be accurately detected by specific primers, so that different genotypic materials can be rapidly distinguished. The detection method of the marker is simple and reliable, and only needs to determine the genotype by the length (301bp or 290bp) of the PCR amplification product, is suitable for material screening at any stage of soybean breeding, and significantly improves the breeding efficiency.

[0021] The application shows through experiments that the molecular marker has significant correlation with the soybean protein content. The protein content of the soybean material carrying the 301bp fragment is significantly higher than that of the material carrying the 290bp fragment, and it is proved that the marker can be used as an effective selection index of the high-protein trait. The application of the marker to molecular assisted breeding can predict the protein content performance of the candidate soybean material at an early stage, shorten the breeding cycle, and accelerate the genetic improvement process of high-protein soybean varieties. The application has important practical guiding value for improving the soybean quality breeding level. BRIEF DESCRIPTION OF DRAWINGS

[0022] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the following will briefly introduce the drawings needed in the embodiments. Obviously, the drawings in the following description only constitute some embodiments of the application, and for those skilled in the art, other drawings can also be obtained from these drawings without creative labor.

[0023] Figure 1The QTL mapping diagram of soybean protein content on chromosome 14 for a soybean recombinant inbred line 'ST214' population is shown in the figure;

[0024] Figure 2 The molecular marker InDel_14-2 is used for genotyping single plants of part of families of a soybean recombinant inbred line; wherein, M is a 50bp DNA marker, P1 is an amplification band type of 'Sudou 13', P2 is an amplification band type of local species TS1, 1-9 are amplification band types of single plants with low protein content, and 10-18 are amplification band types of single plants with high protein content. DETAILED DESCRIPTION

[0025] The various illustrative embodiments of the present application are now described in detail. The detailed description is not intended to limit the present application, but rather to provide a more detailed description of certain aspects, features and embodiments of the present application.

[0026] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. Additionally, the use of the term "about" in relation to a value or a range of values is intended to include each individual intermediate value and each smaller range that falls within the range of values. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0027] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All publications mentioned in this specification are herein incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any reference in this specification is not intended as an admission that the reference is prior art, but rather that the reference is part of the technical literature that is relevant to the disclosure.

[0028] Many modifications and variations of this application specification can be made in light of the above teachings without departing from the spirit or scope of the application. Other embodiments of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application. The specification and examples are illustrative only.

[0029] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", and the like are open-ended terms that are intended to mean including, but not limited to.

[0030] The 'Sudou 13' and the local variety TS1 used in the embodiments of the present application are from the Soybean Innovation Team of the Economic Crops Research Institute of Jiangsu Academy of Agricultural Sciences, and are stored in the Germplasm Resource Bank of Jiangsu Academy of Agricultural Sciences. The 'Sudou 13' is bred by the Economic Crops Research Institute of Jiangsu Academy of Agricultural Sciences through crossing Su No. 5 and Jufeng radiation M6, and the local variety TS1 is collected by the Soybean Innovation Team of the Economic Crops Research Institute of Jiangsu Academy of Agricultural Sciences.

[0031] Obtaining of the major QTL of soybean protein content in Example 1

[0032] (1) Construction of 'ST214' recombinant inbred line population

[0033] The cultivated soybean 'Sudou 13' is used as the female parent, and the local variety TS1 is used as the male parent to carry out hybridization to obtain hybrid F1. The population is constructed by the'single seed transmission' method to obtain 214 F 2:6 generation recombinant inbred lines ('ST214').

[0034] The steps of the'single seed transmission' method are as follows: after a seed harvested from the female parent plant in the hybridization generation is planted and grows into a F1 generation single plant, the F2 generation seed is harvested after selfing and fruiting. The F2 generation plant row containing the segregation traits is planted and grows, and each single plant is selfed and fruiting to harvest F3 generation seeds. The plants with the same segregation traits are harvested and threshed to be bagged. Each seed is planted into a F3 plant row the next year, and the F4 generation seeds are harvested after selfing and fruiting. The process is repeated until the traits of different plants in each family are completely stable and consistent. In this way, the initial single seed is developed into a large population consisting of hundreds of recombinant inbred lines through continuous multiple generations of selfing, segregation, purification, planting, breeding and identification, which is the'single seed transmission' method for constructing the population.

[0035] (2) Construction of the genetic map of the 'ST214' population

[0036] According to the whole genome resequencing results of 'Sudou 13' and the local variety TS1, the situation of each site of the population is identified by realSFS. Based on the SNP sites between 'Sudou 13' and the local variety TS1, the genotype of each individual is finally filtered to determine the crossover site of each individual and obtain the bin genotype of each individual. According to the window sliding method, each 15 SNPs is selected as a window, and each SNP is slid once to determine the genotype of each window and the crossover site of each individual, to obtain the genotype of each individual and generate a bin map, a total of 2441 bins are obtained. Using the record software, the genetic map is constructed based on the bin genotype data, and the genetic map distance of each chromosome is calculated, and the total genetic map distance is 1822.95 cM.

[0037] The genomic DNA of the recombinant inbred line population 'ST214' soybean leaves was extracted by CTAB method, and PCR amplification was performed. The amplification primers are shown in SEQ ID NO. 2 and SEQ ID NO. 3.

[0038] The primers used were synthesized by Beijing Qikang Biotechnology Co., Ltd. The PCR reaction system (10 μL) was 50 ng / μL DNA template 2 μL; 10 μmol / L upper and lower primers 0.25 μL each; 2x Taq Mix 5 μL; double distilled water 2.5 μL. The PCR amplification program was as follows: 95°C pre-denaturation for 3 minutes; 95°C denaturation for 15 seconds, 58°C annealing for 15 seconds, 72°C extension for 30 seconds, 35 cycles; 72°C for 5 minutes, 4°C for storage. The PCR amplification product was electrophoresed on 8% polyacrylamide gel and silver-stained.

[0039] (3) Phenotypic determination of protein content of 'ST214' population soybean

[0040] Protein content determination: After taking the oven-dried laboratory test sample and mixing thoroughly, crush it and pass the powder through a 0.25 mm aperture sieve. Weigh 0.2 g of the test sample to the nearest 0.0001 g and place it in a 300 mL digestion tube. Then, according to the method of GB 5009.5-2016, determine the protein content.

[0041] (4) Results and analysis

[0042] QTL IciMapping4.2 software was used to locate the QTL of soybean protein content by combining the phenotype data and genetic map data of 'ST214' population (as shown in Figure 1 The LOD threshold was set to 2.50. A major QTL for soybean protein content was detected near 1-631,518 bp on chromosome 14 in two environments (Nanjing in 2023 and Nanjing in 2024). The LOD value ranged from 2.96 to 4.00, and the phenotypic variation explained was 8.0% to 10.46%.

[0043] Example 2: Obtaining of major QTL InDel_14-2 and primer pair for soybean protein content

[0044] By comparing the genomic sequences obtained by whole-genome resequencing of 'Sudou 13' and local variety TS1, an 11 bp insertion / deletion (InDel) was found at 377,973 bp within the 1-631,518 bp DNA interval on chromosome 14. The size of the 11 bp InDel is 11 bp, and the nucleotide sequence of the 11 bp InDel is shown in SEQ ID NO. 1.

[0045] SEQ ID NO. 1:

[0046] AGGCAAAACAT.

[0047] For this allelic variation, the primer pair of InDel_14-2 marker was designed using the Primer-BLAST function of NCBI (https: / / www.ncbi.nlm.nih.gov / ), and the primer pair was as follows:

[0048] Upstream primer F: TGGGGGAGCATAGTCTCGTT, SEQ ID NO. 2;

[0049] Downstream primer R: AGGGATTCACATCTCAACTACAAT, SEQ ID NO. 3.

[0050] Example 3 Application of InDel_14-2 molecular marker in soybean protein content selection

[0051] (1) Parental genomic amplification detection

[0052] Using the InDel_14-2 primer pair, the genomic DNA of the soybean recombinant inbred line parent ‘Sudou 13’ (P1, protein content 46.07%) and the parent TS1 (P2, protein content 37.0%) was amplified by PCR, and products of 301 bp (P1) and 290 bp (P2) in size were obtained, and the sequences of the amplification products were shown in SEQ ID NO. 5 and SEQ ID NO. 4. SEQ ID NO. 4 (290 bp):

[0053] TGGGGGAGCATAGTCTCGTTTAGATTTATTTTTATTTTTATTTGTAAATGGAGGGAAAATAGATGTTTGTGCTGTTGTGAGCAGATTTCATTTTCGGGAGGATGTCTCTTTTTGAAAGAGGAGAGGTAGAGCAAGTTTTTGGCTTGGTTTATGGCACTTCTTGTGCTAAAACTGAGACATGATTATAATTAAAAAAATTGTTGGCTTTAAAATAAATCTCTCTCTATATATATATAATAACCTATATATGATCTGGTTTAATTTGTATTGTAGTTGAGATGTGAATCCCT.

[0054] SEQ ID NO. 5 (301 bp):

[0055] TGGGGGAGCATAGTCTCGTTTAGATTTATTTTTATTTTTATTTGTAAATGGAGGGAAAATAGATGTTTGTGCTGTTGTGAGCAGATTTCATTTTCAGGCAAAACATGGGAGGATGTCTCTTTTTGAAAGAGGAGAGGTAGAGCAAGTTTTTGGCTTGGTTTATGGCACTTCTTGTGCTAAAACTGAGACATGATTATAATTAAAAAAATTGTTGGCTTTAAAATAAATCTCTCTCTATATATATATAATAACCTATATATGATCTGGTTTAATTTGTATTGTAGTTGAGATGTGAATCCCT.

[0056] The band pattern was shown by 8% polyacrylamide gel electrophoresis and silver staining. Figure 2

[0057] (2) Recombinant inbred line family amplification detection

[0058] Genomic DNA of 18 families of soybean recombinant inbred line population (‘ST214’) was extracted by CTAB method, and PCR amplification was performed by using primer pair in Example 2. The PCR reaction system (10 μL) was 50 ng / μL DNA template 2 μL; 10 μmol / L upper and lower primers 0.25 μL each; 2 × Taq Mix 5 μL; double distilled water 2.5 μL. The PCR amplification program was as follows: 95 °C pre-denaturation for 3 minutes; 95 °C denaturation for 15 seconds, 58 °C annealing for 15 seconds, 72 °C extension for 30 seconds, 35 cycles; 72 °C for 5 minutes, 4 °C for storage. The PCR amplification product was subjected to 8% polyacrylamide gel electrophoresis and silver staining.

[0059] (3) Results and analysis

[0060] Among the 18 offspring families, it was found that the DNA amplification products of 9 materials appeared 290 bp bands (1-9 in Table 1), and the average protein content of the 9 families was 38.62%; the DNA amplification products of 9 materials appeared 301 bp bands (10-18 in Table 1), and the average protein content of the 9 families was 44.36%, which indicated that the InDel_14-2 molecular marker had a good prediction effect on the prediction of soybean protein content, i.e. when the amplification product was 290 bp, the protein content of the soybean to be tested was low; when the amplification product was 301 bp, the protein content of the soybean to be tested was high. Figure 2 Figure 2 ​​​

[0061] The above-described embodiments are merely intended to describe the preferred modes of the present application, and are not intended to limit the scope of the present application. Various modifications and improvements of the present application made by those skilled in the art based on the above-described embodiments should fall within the scope of the present application defined by the claims.

Claims

1. An InDel molecular marker closely linked to the soybean protein content trait, characterized in that, The nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO.5, wherein positions 96-106 of SEQ ID NO.5 are insertion or deletion variations. Soybeans containing the insertion sequence at positions 96-106 of SEQ ID NO.5 are varieties with high protein content; soybeans containing the deletion sequence at positions 96-106 of SEQ ID NO.5 are varieties with low protein content. The nucleotide sequence of the insertion or deletion variation is shown in SEQ ID NO.

1.

2. A primer pair for detecting the InDel molecular marker of claim 1, characterized in that, The primer pair consists of an upstream primer with a nucleotide sequence as shown in SEQ ID NO.2 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.

3.

3. A kit for detecting the InDel molecular marker of claim 1, characterized in that, Includes the primer pair as described in claim 2.

4. The application of the primer pair of claim 2 or the kit of claim 3 in identifying the level of soybean protein content.

5. A method for identifying the protein content of soybeans, characterized in that, Includes the following steps: Genomic DNA was extracted from the soybean to be tested, and PCR amplification was performed using the primer pair described in claim 2. After gel electrophoresis of the amplification product, the protein content of the soybean to be tested was determined based on the electrophoretic bands. If the electrophoretic band is 290bp, the content of the soybean protein to be tested is too low; if the electrophoretic band is 301bp, the content of the soybean protein to be tested is too high.

6. The method according to claim 5, characterized in that, The PCR amplification reaction system consisted of 2 μL of 50 ng / μL DNA template; 0.25 μL each of 10 μmol / L forward and reverse primers; 5 μL of 2×Taq Mix; and 2.5 μL of double-distilled water.

7. The method according to claim 5, characterized in that, The PCR amplification reaction program was as follows: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 58°C for 15 seconds, extension at 72°C for 30 seconds, for 35 cycles; incubation at 72°C for 5 minutes, and storage at 4°C.

8. The use of the primer pair of claim 2 or the kit of claim 3 in screening soybeans with high protein content.

9. The application of the primer pair of claim 2 or the kit of claim 3 in molecular marker-assisted breeding of soybean protein content traits.

Images