Multi-gene editing fragment / vector / cell line as well as preparation method and application thereof

Abstract

The invention discloses a polygene editing fragment / vector / cell line and a preparation method and application thereof, the polygene editing fragment can be used for editing pig CMAH, ANPEP, CD163, ANTXR1 and MSTN genes at the same time, the nucleotide sequence of the fragment is shown as SEQ ID No: 1, and the polygene editing vector and cell line can be prepared through the fragment and further used for preparing polygene editing pigs. The multi-gene editing fragment is formed by connecting a U6 promoter and five pairs of sgRNAs in series, each pair of sgRNAs is massively screened and is in an optimal, shortest and most efficient arrangement and connection mode, and the multi-gene editing fragment can be used for simultaneously performing fragment deletion on five genes of pig CMAH, ANPEP, CD163, ANTXR1 and MSTN. Due to the creative design of the segment, the five genes can be subjected to targeted editing at the same time, the gene editing efficiency of a multi-gene editing carrier and a cell line can be greatly improved, a foundation is laid for subsequent efficient gene editing research, and new materials and tools are further provided for pig gene improvement or new variety breeding.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of gene editing, in particular to a multi-gene editing fragment / vector / cell line and its preparation method and application. BACKGROUND

[0002] The discovery of the CRISPR system makes the gene editing tool more widely developed. Compared with the two traditional editing tools of zinc finger endonuclease and transcription activator-like effector nuclease, the CRISPR editing tool is designed more simply under the premise of higher editing efficiency. At the same time, with the in-depth development of the CRISPR system, various gene editing methods dependent on the CRISPR system have appeared, such as the knockout of the target gene, the replacement of the base sequence and the deletion of the gene sequence. The application of these editing methods requires high gene editing efficiency. Using the CRIUSPR / Cas9 system, a sgRNA is designed to target the target gene, and after generating a double-strand break, the cell's own repair system is used to generate base insertion and deletion at the break site, so that the target gene cannot be normally expressed, and the target gene can be successfully knocked out.

[0003] However, the use of a single 1 sgRNA for partial gene knockout has limited effect (for example, using only 1 sgRNA can also achieve gene knockout, but the knockout fragment of part of the gene may be short or it is not possible to well achieve the simultaneous deletion of 1 pair of chromosomes, resulting in limited knockout effect), and double-sgRNA fragment deletion can better and efficiently achieve the knockout of gene function, so using double-sgRNA to delete gene fragments has important significance for the study of gene function. Double-sgRNAs are two sgRNAs simultaneously targeting the two ends of the target gene sequence, generating double-strand breaks at the target gene sequence, and then using the cell's own repair function to delete the DNA sequence between the two sgRNAs. Because two sgRNAs are needed for fragment deletion, each sgRNA needs to have high editing efficiency. Therefore, the design and screening of two high-efficiency sgRNAs are crucial for the editing efficiency of genes.

[0004] And the existing studies show that knocking out some target genes of cells can effectively resist the infection of corresponding viruses, or knocking out some target genes can produce more excellent traits. However, at present, only a single gene can be edited, if multiple gene editing needs to be studied, each gene needs to be edited, so not only the time and research period are long, but also the state of the cells is damaged (the cells repeatedly experience the steps of transfection and drug screening of gene editing, which has a great influence on the state of the cells). Therefore, how to realize the simultaneous editing of multiple genes and maintain high editing efficiency has not been reported and studied. Therefore, designing a fragment, a vector or a cell line that can edit multiple genes has important significance for the study of multiple gene editing and genetic improvement. SUMMARY

[0005] The purpose of the present application is to provide a multiple gene editing fragment / vector / cell line and its preparation method and application, which can simultaneously edit four genes related to disease resistance (CMAH, ANPEP, CD163 and ANTXR1) and one gene related to pork quality (MSTN) in the field of pig breeding, and provides materials and methods for improving the efficiency of multiple gene editing.

[0006] According to a first aspect of the present application, a multiple gene editing fragment is provided, which can be used to simultaneously edit pig CMAH, ANPEP, CD163, ANTXR1 and MSTN genes, and the nucleotide sequence of the fragment is shown in SEQ ID No: 1. Thus, the multiple gene editing fragment can be used to prepare a multiple gene editing vector and a cell line, which can simultaneously target the deletion of five genes, greatly improving the efficiency of gene editing, and providing new materials and tools for the genetic improvement and research of pigs. Moreover, the multiple gene editing fragment is composed of U6 promoters and 5 pairs of sgRNA in series, each pair of sgRNA is screened in large quantities, and the arrangement and connection mode is optimal, shortest and most efficient, which can be used to simultaneously delete the five genes of pig CMAH, ANPEP, CD163, ANTXR1 and MSTN, laying a foundation for subsequent efficient gene editing research.

[0007] According to a second aspect of the present application, a multiple gene editing fragment is provided for application in pig gene editing, which can be used to simultaneously edit pig CMAH, ANPEP, CD163, ANTXR1 and MSTN genes, and the nucleotide sequence of the fragment is shown in SEQ ID No: 1. Thus, through the application, the editing and deletion of five genes can be simultaneously targeted, greatly improving the efficiency and benefit of pig gene editing.

[0008] According to a third aspect of the present application, there is provided an application of a multi-gene editing fragment in the preparation of a multi-gene editing vector, the fragment being used for simultaneously editing pig CMAH, ANPEP, CD163, ANTXR1 and MSTN genes, and the nucleotide sequence of the fragment being shown as SEQ ID No: 1. Thus, due to the efficient design and creative connection mode (optimal, shortest and most efficient arrangement and connection mode) of the multi-gene editing fragment, the multi-gene editing vector prepared by using the fragment can realize efficient and stable gene editing, thereby providing tools and materials for subsequent research.

[0009] According to a fourth aspect of the present application, there is provided an application of a multi-gene editing fragment in the preparation of a multi-gene editing cell line, the fragment being used for simultaneously editing pig CMAH, ANPEP, CD163, ANTXR1 and MSTN genes, and the nucleotide sequence of the fragment being shown as SEQ ID No: 1. Thus, due to the efficient design and creative connection mode (optimal, shortest and most efficient arrangement and connection mode) of the multi-gene editing fragment, the multi-gene editing cell line prepared by using the fragment can realize targeted deletion of 5 genes, and the prepared cell line can be used for subsequent research, thereby providing a new method and tool for genetic improvement or new breed cultivation of pigs.

[0010] According to a fifth aspect of the present application, there is provided an application of a multi-gene editing fragment in the preparation of a multi-gene editing pig, the fragment being used for simultaneously editing pig CMAH, ANPEP, CD163, ANTXR1 and MSTN genes, and the nucleotide sequence of the fragment being shown as SEQ ID No: 1. Thus, due to the efficient design and creative connection mode (optimal, shortest and most efficient arrangement and connection mode) of the multi-gene editing fragment, the multi-gene editing pig prepared by using the fragment can be used as a tool for pig disease research and genetic improvement, thereby providing a new research tool for cultivating disease-resistant or meat-improved pigs, and can be further used for new breed cultivation of pigs.

[0011] According to a sixth aspect of the present application, there is provided a multi-gene editing vector, the vector comprising a multi-gene editing fragment, the fragment being used for simultaneously editing pig CMAH, ANPEP, CD163, ANTXR1 and MSTN genes, and the nucleotide sequence of the fragment being shown as SEQ ID No: 1. Thus, due to the efficient design and creative connection mode (optimal, shortest and most efficient arrangement and connection mode) of the multi-gene editing fragment, the multi-gene editing vector containing the fragment can simultaneously target knockout of 5 genes, can realize efficient and stable gene editing, and thereby provides tools and materials for subsequent research.

[0012] In some embodiments, the nucleotide sequence of the vector is shown in SEQ ID No: 3. In the vector, the multi-gene editing fragment is connected with the Gs12-7MAX editing system to prepare a multi-gene editing vector. The Gs12-7MAX (the Gs12-7MAX protein and editing system are disclosed in patent 202411320266.4) is a subtype of Cas12 protein, which has a smaller volume than the conventional gene editing protein Cas9, and the PAM sequence recognized by the protein is TTTV, which enriches the selection site of gene editing. At the same time, because the Cas12 protein does not need tracrRNA and has a self-cleavage function, the Gs12-7MAX protein also does not need tracrRNA, so that the protein can be directly used with sgRNA for concatenation, without the need for additional addition of a cleavage enzyme, so that the Gs12-7MAX protein directly uses the sgRNA concatenation sequence is shorter than the Cas9 using the sgRNA concatenation sequence. Thus, the vector can be used for multiple sgRNA concatenation and for the targeted editing of 5 genes, and the vector sequence is shorter, easier to transfect, and has higher editing efficiency.

[0013] In some embodiments, the nucleotide sequence of the vector is shown in SEQ ID No: 2. The vector also contains an epi replicon element. The epi replicon element includes EBNA1 and Orip, which can significantly improve the efficiency of gene editing by extending the gene editing time window. After the plasmid with the epi replicon element is transfected into target cells, it can exist stably in the form of an episome, has the characteristics of transporting into the nucleus, enhancing transcription, and escaping immunity, and enables the sustained expression of the target gene carried by the vector. Replicon refers to the smallest functional unit that can independently replicate during DNA replication. It usually starts from an origin of replication and ends with a terminus, completing an independent replication process. By using the epi replicon element and sgRNA concatenation, the plasmid containing the replicon element can exist in the cell, and the elements for expressing gene editing on the plasmid can be expressed in the cell, thereby improving the efficiency of multi-gene fragment deletion.

[0014] According to a seventh aspect of the present application, there is provided an application of a multi-gene editing vector in pig gene editing, the vector comprising a multi-gene editing fragment, the fragment being used for simultaneously editing pig CMAH, ANPEP, CD163, ANTXR1 and MSTN genes, the nucleotide sequence of the fragment being shown as SEQ ID No: 1 or the nucleotide sequence of the vector being shown as SEQ ID No: 3 or the nucleotide sequence of the vector being shown as SEQ ID No: 2. Thus, by applying the multi-gene editing vector, simultaneous knockout of 5 genes can be achieved, and the efficiency of pig gene editing is greatly improved.

[0015] According to an eighth aspect of the present application, there is provided an application of a multi-gene editing vector in preparing a multi-gene editing cell line, the vector comprising a multi-gene editing fragment, the fragment being used for simultaneously editing pig CMAH, ANPEP, CD163, ANTXR1 and MSTN genes, the nucleotide sequence of the fragment being shown as SEQ ID No: 1 or the nucleotide sequence of the vector being shown as SEQ ID No: 3 or the nucleotide sequence of the vector being shown as SEQ ID No: 2. Thus, by applying the multi-gene editing vector to prepare a multi-gene editing cell line, the cell line can achieve simultaneous knockout of 5 genes, and the prepared cell line can be used for subsequent research, providing a new method and tool for pig genetic improvement or new breed cultivation.

[0016] According to a ninth aspect of the present application, there is provided an application of a multi-gene editing vector in preparing a multi-gene editing pig, the vector comprising a multi-gene editing fragment, the fragment being used for simultaneously editing pig CMAH, ANPEP, CD163, ANTXR1 and MSTN genes, the nucleotide sequence of the fragment being shown as SEQ ID No: 1 or the nucleotide sequence of the vector being shown as SEQ ID No: 3 or the nucleotide sequence of the vector being shown as SEQ ID No: 2. Thus, by applying the multi-gene editing vector to prepare a multi-gene editing pig, the pig can be used as a tool for pig disease research and genetic improvement, providing a new research tool for cultivating pigs with disease resistance or improved meat quality, and can be further used for new breed cultivation of pigs.

[0017] According to a tenth aspect of the present application, there is provided a multi-gene editing cell line, the cell line comprising CMAH, ANPEP, CD163, ANTXR1 and MSTN genes being simultaneously knocked out. Thus, since 5 genes (CMAH, ANPEP, CD163, ANTXR1 and MSTN) are simultaneously knocked out in the cell line, new materials and tools can be provided for subsequent pig genetic improvement or new breed cultivation.

[0018] According to an eleventh aspect of the present application, there is provided a method for preparing a multi-gene editing cell line, which comprises connecting the multi-gene editing fragment to a vector containing the Gs12-7MAX protein coding sequence, then transfecting the vector into cells and performing drug screening to obtain a multi-gene editing cell line; or transfecting the multi-gene editing vector into cells and performing drug screening to obtain a multi-gene editing cell line. Thus, the cell line prepared by the method can simultaneously knockout five genes (CMAH, ANPEP, CD163, ANTXR1 and MSTN), which can provide new materials and tools for subsequent genetic improvement or new breed cultivation of pigs.

[0019] According to a twelfth aspect of the present application, there is provided a multi-gene editing cell line prepared by using a multi-gene editing fragment, which can be used to simultaneously edit the CMAH, ANPEP, CD163, ANTXR1 and MSTN genes of pigs, and the nucleotide sequence of the fragment is shown in SEQ ID No: 1. Thus, the cell line prepared by using the multi-gene editing fragment can simultaneously knockout five genes (CMAH, ANPEP, CD163, ANTXR1 and MSTN), which can provide new materials and tools for subsequent genetic improvement or new breed cultivation of pigs.

[0020] According to a thirteenth aspect of the present application, there is provided a multi-gene editing cell line prepared by using a multi-gene editing vector, which contains a multi-gene editing fragment, which can be used to simultaneously edit the CMAH, ANPEP, CD163, ANTXR1 and MSTN genes of pigs, and the nucleotide sequence of the fragment is shown in SEQ ID No: 1 or the nucleotide sequence of the vector is shown in SEQ ID No: 3 or the nucleotide sequence of the vector is shown in SEQ ID No: 2. Thus, the cell line prepared by using the multi-gene editing vector can simultaneously knockout five genes (CMAH, ANPEP, CD163, ANTXR1 and MSTN), which can provide new materials and tools for subsequent genetic improvement or new breed cultivation of pigs.

[0021] According to a fourteenth aspect of the present application, there is provided a multi-gene editing cell line prepared by using the method for preparing the multi-gene editing cell line. Thus, the cell line prepared by using the method for preparing the multi-gene editing cell line can simultaneously knockout five genes (CMAH, ANPEP, CD163, ANTXR1 and MSTN), which can provide new materials and tools for subsequent genetic improvement or new breed cultivation of pigs.

[0022] According to a fifteenth aspect of the present application, the application provides the use of the multi-gene editing cell line in the preparation of a multi-gene editing pig. Thus, by the use, a multi-gene editing pig in which five genes (CMAH, ANPEP, CD163, ANTXR1 and MSTN) are simultaneously knocked out can be prepared, and the editing efficiency is greatly improved.

[0023] According to a sixteenth aspect of the present application, the application provides the use of the multi-gene editing cell line in the genetic improvement of a pig. Thus, by the cell line, the genetic improvement of a pig can be achieved, and the disease resistance of the pig can be improved or the meat quality of the pig can be improved.

[0024] According to a seventeenth aspect of the present application, the application provides the use of the multi-gene editing cell line in the breeding of a new pig breed. Thus, by the cell line, a new pig breed can be prepared, the genes of the pig can be improved, and the disease resistance and meat quality of the pig can be improved, and the basic materials and tools are provided.

[0025] Advantages of the present application:

[0026] 1. By designing and screening high-efficiency sgRNAs targeting CMAH, ANPEP, MSTM, CD163 and ANTXR1 genes, and by designing and verifying, the sgRNAs of the above-mentioned five genes are connected to form a multi-gene editing fragment. In the design of the multi-gene editing fragment, the expression efficiency and editing efficiency of the sgRNA are fully considered, and various connection methods are tried. Compared with other design methods, the designed sequence is the shortest and has the highest editing efficiency.

[0027] 2. A multi-gene editing vector for simultaneously targeting five genes (CMAH, ANPEP, CD163, ANTXR1 and MSTN) is provided, which directly uses Gs12-7MAX protein and sgRNA for connection to achieve high-efficiency fragment deletion. The vector can achieve simultaneous editing of five genes, is efficient and convenient, and provides a new material and research tool for the preparation of a multi-gene editing cell line or a multi-gene editing pig. Since the Gs12-7MAX and the sgRNA are connected, the size of the vector can be greatly reduced, and the transfection efficiency and the gene editing efficiency can be improved.

[0028] 3. A tandem vector combining an epi replicon element and a tandem sgRNA is provided to realize a vector for efficiently editing a targeted gene. The epi replicon element includes EBNA1 and Orip, which can significantly improve the efficiency of gene editing by extending the gene editing time window. After the plasmid with the epi replicon element is transfected into target cells, it can exist in the form of an episome, has the characteristics of transporting into the nucleus, enhancing transcription, and escaping immunity, and enables the sustained expression of the target gene carried by the vector. A replicon refers to the smallest functional unit that can independently replicate during the DNA replication process. It usually starts from an origin of replication and ends at a terminus, completing an independent replication process. By using the epi replicon element and the tandem sgRNA, the plasmid containing the replicon element can persist in the cell, and the gene editing elements expressed on the plasmid can be continuously expressed in the cell, thereby improving the efficiency of multiple gene fragment deletion.

[0029] 4. A multiple gene editing cell line and a preparation method thereof are provided. The multiple gene editing cell line prepared by using the multiple gene editing fragment or vector in the present application can efficiently achieve the targeted deletion of five genes (CMAH, ANPEP, CD163, ANTXR1, and MSTN). In the prepared ANTXR1-ANPEP-CMAH-MSTN-CD163 KO cell strain, ANTXR1 and ANPEP are homozygous fragment deletions, CMAH and MSTN are heterozygous fragment deletions, and the homozygous gene KO; CD163 is a heterozygous fragment deletion, and the heterozygous gene KO. The ANTXR1-ANPEP-CMAH-MSTN-CD163 KO cell strain not only proves the efficiency of the multiple gene editing fragment and the multiple gene editing vector deletion system, but also can be used for subsequent research, providing a new method and tool for genetic improvement or new breed cultivation of pigs. BRIEF DESCRIPTION OF DRAWINGS

[0030] Figure 1 Comparison results of knockout efficiency of epiGs12-7MAX-U6-10xsg vector and Gs12-7MAX-U6-10xsg vector: among them, epi vector represents transfection of epiGs12-7MAX-U6-10xsg plasmid, ordinary vector represents transfection of Gs12-7MAX-U6-10xsg plasmid, figures A-E represent CMAH, ANPEP, CD163, MSTN, and ANTXR1 gene knockout efficiency comparison results, * represents p<0.05, ** represents p<0.01, and ns represents p>0.05;

[0031] Figure 2For monoclonal cell pictures: where the pictures are the results under 40X microscope. DETAILED DESCRIPTION

[0032] The application will be further described in conjunction with the specific embodiments, and the examples given are only to illustrate the application, but not to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the application.

[0033] The experimental methods in the following examples are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified.

[0034] Example 1, design of amplification sequence primers for five gene targeting sites and construction of five gene site sgRNA expression vectors.

[0035] 1.1 Verify the genomic SNP, and design sgRNA at the SNP-free position.

[0036] A pair of primers was designed to target the 3rd exon of the MSTN gene (MSTN myostatin [Sus scrofa (pig)] Gene ID: 399534), a pair of primers was designed to target the 15th exon of the ANPEP gene (ANPEP alanyl aminopeptidase, membrane [Sus scrofa (pig)] Gene ID: 397520), a pair of primers was designed to target the 7th exon of the CD163 gene (CD163 CD163 molecule [Sus scrofa (pig)] Gene ID: 397031), two pairs of primers were designed to target the 1st, 2nd and 16th exon of the ANTXR1 gene (ANTXR1 ANTXR cell adhesion molecule 1 [Sus scrofa (pig)] Gene ID: 100513853), and a pair of primers was designed to target the 1st exon of the CMAH gene (cytidine monophospho-N-acetylneuraminic acid hydroxylase [Sus scrofa (pig)] Gene ID: 396918). The designed upstream primers and downstream primers (the primer sequences are shown in Table 1 below) were used to perform PCR amplification on the genome of Yorkshire pig fibroblasts (pig fetal fibroblasts, PFF) to obtain PCR products. After the PCR products were sequenced, the sequencing results were compared with the sequences in NCBI, and sgRNAs were designed at SNP-free positions.

[0037] Table 1 Primer sequences

[0038]

[0039]

[0040] 1.2 Construction of expression vector.

[0041] 1.2.1 Design of sgRNA sequence.

[0042] Two sgRNAs (MSTN KO sg2, MSTN KO sg3) were designed for the 3rd exon of MSTN gene, two sgRNAs (ANPEP KO sg6, ANPEP KO sg8) were designed for the 16th exon of ANPEP gene, seven sgRNAs (CMAH KO sg1-7) were designed for the 1st exon of CMAH gene, nineteen sgRNAs (ANTXR1 KO sg1-19) were designed for the 1st, 2nd, 16th exon of ANTXR1 gene, two sgRNAs (CD163 KO sg2, CD163 KO sg 10) were designed for the 7th exon of CD163 gene, as shown in Table 2:

[0043] Table 2 sgRNA sequences of CMAH, ANPEP, MSTM, CD163, ANTXR1 genes

[0044]

[0045]

[0046] 1.2.2 Synthesis of sgRNA oligonucleotide sequences.

[0047] According to the sgRNA sequences in Table 2, the corresponding annealing primers were designed, as shown in Table 3.

[0048] 5 μL of the upstream primer and the downstream primer of the sgRNA annealing primer were added to a 200 μL centrifuge tube, and mixed by blowing. The mixed system was annealed: the annealing program was 95℃, 10 min; 65℃, 30 min. The obtained sgRNA annealing product was diluted 10 times with 90 μL of ddH2O for standby.

[0049] Table 3 sgRNA primer sequences

[0050]

[0051]

[0052]

[0053] Note: Some sgRNAs of ANTXR1 gene in Table 3 share primers.

[0054] 1.2.3 Connection and construction of expression vectors.

[0055] The annealing product in 1.2.3 is connected to the sgRNA expression vector plenti-U6-crRNA-zsGreen (the vector is disclosed in CN202411320266.4, the sequence is shown as SEQ ID No: 98) skeleton by using DNA ligase, and the system is shown in Table 4. After mixing the components in the system, place it in a constant temperature metal bath at 25°C for 10 min. After the connection is completed, it is taken out and added to the competent cells, and after ice bath for 5 min, 42°C water bath for 45 s, ice bath for 2 min, it is coated on the solid culture medium for transformation. After inversion overnight, suitable single colony is picked up in 1.5 ml centrifuge tube, and 700 μL LB liquid medium is added. Culture at 37°C, 220 r / min on a shaker for 8 h, and send to the company for sequencing to determine that the vector construction is successful, and then enlarge the culture, and extract the sgRNA expression vector plasmid.

[0056] Table 4 connection system

[0057] Component Volume Plenti-U6-crRNA-zsGreen enzyme cut product 50 ng Annealed product 1 μL DNA ligation mix 5 μL H2O up to 10 μL

[0058] Example 2, cell experiment verifies the editing efficiency of different sgRNAs of each gene.

[0059] PK15 cell line is used to plate 10 cm dish, and when the density is 90% to 100%, the sgRNA expression vector plasmid is electroporated. A total of 10 μg plasmid is electroporated per 1 / 3 10 cm cell culture dish. After 72 h, flow cytometry sorting is performed according to green fluorescent protein, and a cell pool with green fluorescence is obtained, and the cell genome is extracted and PCR amplified using the previous genome amplification primer. The amplification product is sent to the company for sequencing, and the editing efficiency of sgRNA is analyzed using the online website https: / / ice.editco.bio / # / . The best sgRNA with the best activity of each gene site is finally selected for subsequent multi-gene editing experiment. The best sgRNA with the best activity finally selected is shown in Table 5:

[0060] Table 5 effective sgRNA sequence table after screening

[0061]

[0062]

[0063] Example 3, construction of two kinds of tandem five-gene KO vectors.

[0064] 3.1, construction of epiGs12-7MAX-U6-10×sg vector.

[0065] The 10 sgRNA sequences screened are screened through a large number of arrangement modes, and the optimal, shortest and most efficient arrangement and connection mode is screened, and a U6 promoter is added at the front to obtain a multi-gene editing fragment, and the sequence is as follows (SEQ ID No: 1):

[0066]

[0067] Note: In this sequence, the normal font is the U6 promoter; the underlined part is the sgRNA; the italic and bold part is the scaffold, which is an important component of sgRNA in the CRISPR-Cas system, and its main function is to combine with Cas protein and stabilize the secondary structure of sgRNA, thereby promoting the recognition and binding of sgRNA and target DNA.

[0068] The above multi-gene editing fragment is cloned into the epiGs12-7MAX vector, and the gene sequences such as AMP are deleted, and finally the epiGs12-7MAX-U6-10×sg vector is synthesized, and the sequence of the vector is shown as SEQ ID No: 2.

[0069] Construction method of epiGs12-7MAX vector:

[0070] (1) The epiPE2 plasmid (the epiPE2 plasmid and the construction method have been disclosed in the literature, and the literature is Enhancing Prime Editing Efficiency through Modification of Methylation on the Newly Synthesized DNA Strand and Prolonged Expression) is digested by NotI and PmeI to obtain the epi skeleton;

[0071] (2) The homologous arm sequence homologous to the epi skeleton is added at both ends of the Gs12-7MAX protein coding sequence (the Gs12-7MAX protein coding sequence is shown as SEQ ID No: 99), and then synthesized;

[0072] (3) The synthesized Gs12-7MAX protein coding sequence containing the homologous arm is cloned into the epi skeleton by homologous recombination enzyme to obtain the epiGs12-7MAX plasmid.

[0073] 3.2 Construction of Gs12-7MAX-U6-10×sg tandem vector.

[0074] 3.2.1 Double enzyme digestion of vector

[0075] On the basis of the epiGs12-7MAX-U6-10×sg vector, the EBNA1 and oriP elements were cut off. Double enzyme digestion was performed using restriction enzymes NheI and AscI, and the enzyme digestion system is shown in Table 6 below:

[0076] Table 6 Enzyme digestion system

[0077] Plasmid 1 μg 10 x rCutSmart Buffer 5 μL Nhe I-HF 1 μL Asc I-HF 1 μL H2O up to 50 μL

[0078] The enzyme digestion was performed in a 37℃ constant temperature metal bath for 30 min, followed by agarose gel electrophoresis, and then the vector skeleton was recovered and purified according to the instructions, and was placed at -20℃ for standby.

[0079] 3.2.2 Design and synthesis of the connecting fragments.

[0080] The fragments in Table 7 below were synthesized for connecting the double enzyme-digested skeleton described above:

[0081] Table 7 Sequence list of the connecting fragments

[0082] Name Sequence Nhe I F CTAGCAATTACTCGCAGCCCGGAA (SEQ ID No: 96) Asc I R CGCGTTCCGGGCTGCGAGTAATTG (SEQ ID No: 97)

[0083] 5 μL of each of the two linear fragments synthesized above was taken, shaken and centrifuged to mix, and then was placed in a PCR instrument for annealing, and the annealing program was: 95℃ for 10 min, 65℃ for 30 min. After annealing, 90 μL of sterilized water was added for dilution.

[0084] 3.2.3 Connection.

[0085] The annealed product in 3.2.2 and the linearized double enzyme-digested vector in 3.2.1 were connected using DNA Ligation Kit, and the connection system is shown in Table 8 below:

[0086] Table 8 Connection system

[0087] Linearized double enzyme cut backbone 100 ng Annealed product 1 μL DNA ligation mix 5 μL H2O up to 10 μL

[0088] After 10 min of connection at 25℃, transformation was performed, and positive clones were identified by sequencing, and the plasmid was extracted after endotoxin removal and was standby. According to the above steps, the Gs12-7MAX-U6-10×sg vector was successfully constructed by sequencing, and the sequence of the vector is shown as SEQ ID No: 3.

[0089] Example 4, cell experiment proves that the multi-gene editing vector can achieve targeted deletion of five gene fragments.

[0090] The recovered Yorkshire PFF cells were in 10 cm cell culture dishes, and the cell density reached 100% for electroporation. When the cell density reached 100% for electroporation, it was divided into three groups: epiGs12-7MAX-U6-10×sg plasmid group (epi vector group), Gs12-7MAX-U6-10×sg plasmid group (ordinary vector group) and control group. Among them, the epiGs12-7MAX-U6-10×sg plasmid group: take 1 / 3 of the cells in a 10 cm cell culture dish, and electroporate 10 μg of epiGs12-7MAX-U6-10×sg plasmid at a voltage of 520 V; the Gs12-7MAX-U6-10×sg plasmid group: take 1 / 3 of the cells in a 10 cm cell culture dish, and electroporate 10 μg of Gs12-7MAX-U6-10×sg plasmid at a voltage of 520 V; the control group: take 1 / 3 of the cells in a 10 cm cell culture dish, and directly electroporate without plasmid at a voltage of 520 V, as a negative control.

[0091] After electroporation, the cells were transferred to an anti-culture medium, and the next day the cell morphology was normal. The puro drug was used for enrichment (puro concentration: 2.5 ug / ml). After 3 days, 1 / 3 of the cell density was taken to detect the editing efficiency, and then the puro drug was used for enrichment (puro concentration: 1.25 ug / ml). After 3 days of enrichment, 1 / 3 of the cell density was taken to detect the editing efficiency, and the remaining cells were cultured for 3 days. Then 1 / 3 of the cell density was taken to detect the editing efficiency.

[0092] 4.2 Verify the efficiency of the 3-day, 6-day, and 9-day multi-gene fragment deletion vector cell pool.

[0093] PCR amplification of the target fragment of the edited gene, and agarose gel electrophoresis of the amplification product. The editing efficiency of each gene site was determined by ImageLab gray scale analysis. The results are shown in Figure 1 Figure 1 In the epi vector, epiGs12-7MAX-U6-10×sg plasmid was transfected, and ordinary vector represented Gs12-7MAX-U6-10×sg plasmid. Among them, Figure 1 A represents the comparison results of CMAH gene deletion efficiency, and it can be seen that the deletion efficiency of epiGs12-7MAX-U6-10×sg vector is significantly better than that of Gs12-7MAX-U6-10×sg vector, especially at the 6th day, which is significantly higher than that of Gs12-7MAX-U6-10×sg vector (p<0.05); Figure 1 B represents the comparison results of ANPEP gene deletion efficiency, and it can be seen that the deletion efficiency of epiGs12-7MAX-U6-10×sg vector is significantly better than that of Gs12-7MAX-U6-10×sg vector; Figure 1 ​The results of the comparison of the CD163 gene deletion efficiency in C show that the deletion efficiency of the epiGs12-7MAX-U6-10×sg vector is obviously better than that of the Gs12-7MAX-U6-10×sg vector, and is significantly higher than that of the Gs12-7MAX-U6-10×sg vector at the 9th day (p<0.05); Figure 1 The results of the comparison of the MSTN gene deletion efficiency in D show that the deletion efficiency of the epiGs12-7MAX-U6-10×sg vector is obviously better than that of the Gs12-7MAX-U6-10×sg vector, and is extremely significantly higher than that of the Gs12-7MAX-U6-10×sg vector at the 9th day (p<0.01); Figure 1 The results of the comparison of the ANTXR1 gene deletion efficiency in E show that the deletion efficiency of the epiGs12-7MAX-U6-10×sg vector is obviously better than that of the Gs12-7MAX-U6-10×sg vector, and is extremely significantly higher than that of the Gs12-7MAX-U6-10×sg vector at the 6th day (p<0.01). The above results show that both the two kinds of multi-gene editing vectors have fragment deletion efficiency on the target site, but the efficiency of the epiGs12-7MAX-U6-10×sg vector is obviously better than that of the Gs12-7MAX-U6-10×sg vector, which shows that the epiGs12-7MAX-U6-10×sg can significantly improve the gene fragment deletion efficiency, and with the extension of time, the editing (deletion) advantage of the epiGs12-7MAX-U6-10×sg vector is more obvious and the efficiency is higher. It is shown that the epi element in the epiGs12-7MAX-U6-10×sg vector can significantly improve the gene editing efficiency by extending the gene editing time window.

[0094] Example 5, Screening of cell lines in which five gene fragments are all deleted.

[0095] After the epiGs12-7MAX-U6-10×sg vector is electroporated into Yorkshire pig PFF cells, 10 cm cell culture dishes containing 4000 cells are obtained by gradient dilution, and the culture medium with high concentration of serum (20%, the normal serum concentration is 10%) is used for culture, and the culture medium is replaced every 2 days. After 9 days, single cells form groups, as shown in Figure 2As shown, the cell clones were picked up by cloning ring and replaced into 48-well plate for culture. After the cells grew well, 1 / 2 of the cells were taken for genotype identification, and the remaining cells were replaced into 24-well plate for culture. After identification, a positive cell strain was obtained, which was named ANTXR1-ANPEP-CMAH-MSTN-CD163 KO cell strain. In the cell strain, the ANTXR1 gene and the ANPEP gene were homozygous fragment deletions (homozygous fragment deletion: both chromosomes were deleted), and the CMAH gene, the CD163 gene and the MSTN gene were heterozygous fragment deletions (heterozygous fragment deletion: only one chromosome was deleted). The sequencing alignment results are shown below.

[0096] 5.1, ANTXR1 gene sequence alignment.

[0097] Wild-type cell strain sequence:

[0098] ATCAGGAAGTGTGCTGCACCACTGGAATGAAATCTATTACTTTGTGGAACAGTTGGCTCATAAA

[0099] TTCATCAGGTGAGAACCATAACATGTACTTCTCTGTCATGAGTGAAACCAGCCTATGTTCGCTGT

[0100] TCCGCTAATTACTAACTGCTTTGGGGATGCTTTTTGACTAAGATAGACTCTCGGGTCTTGGAATAGAGA.

[0101] ANTXR1-ANPEP-CMAH-MSTN-CD163 KO cell strain sequence (deletion of 148 bp in two chromosomes): ATCAGGAAGTGTGCTGCACCACTGGAATGAAATCTATTA … TGGAATAGAGA. 5.2, ANPEP gene sequence alignment.

[0102] Wild-type cell strain sequence:

[0103] AAATACCTCAGGAAGCAGGTCGAACCCCTCTTCCAACATTTCGAAACTCTCACTAAAAACTGG

[0104] ACCGAGCGCCCAGAAAATCTGATGGACCAGTGAGTATGAGCTCGCTTGGTCTGGAGATCATGG

[0105] GAGTGGTGCAGGTAGCCTGACCTGGGGGCCCATAGCAAGTCCAGCAGCATCCTCTCTGGAGCTCC

[0106] GAGTGGTGCAGGTAGCCTGACCTGGGGGCCCATAGCAAGTCCAGCAGCATCCTCTCTGGAGCTCC

[0107] GAGTGGTGCAGGTAGCCTGACCTGGGGGCCCATAGCAAGTCCAGCAGCATCCTCTCTGGAGCTCC

[0108] GAGTGGTGCAGGTAGCCTGACCTGGGGGCCCATAGCAAGTCCAGCAGCATCCTCTCTGGAGCTCC

[0109] GAGTGGTGCAGGTAGCCTGACCTGGGGGCCCATAGCAAGTCCAGCAGCATCCTCTCTGGAGCTCC

[0110] GAGTGGTGCAGGTAGCCTGACCTGGGGGCCCATAGCAAGTCCAGCAGCATCCTCTCTGGAGCTCC

[0111] 5.3, CD163 gene sequence alignment.

[0112] Wild type cell line sequence:

[0113] GAGTGGTGCAGGTAGCCTGACCTGGGGGCCCATAGCAAGTCCAGCAGCATCCTCTCTGGAGCTCC

[0114] GAGTGGTGCAGGTAGCCTGACCTGGGGGCCCATAGCAAGTCCAGCAGCATCCTCTCTGGAGCTCC

[0115] ANTXR1-ANPEP-CMAH-MSTN-CD163 KO cell line sequence (chromosome 1, deletion of 88 bp): CCTCCTGGGGGGAGCTC …………………… CC GCCCTGACGGGACATGTAGCC. ANTXR1-ANPEP-CMAH-MSTN-CD163 KO cell line sequence (chromosome 2, indel at sg location):

[0116] CCTCCTGGGGG ……………… TGGAGAAGGAAGTGGACAGATCTGGGCTGAAGAATTCCAGTGTG AGGGGCACGAGTCCCACCTTTCACTCTGCCCAGTAGC..CCCCGCCCTGACGGGACATGTAGCC. 5.4, CMAH gene sequence alignment.

[0117] Wild type cell line sequence:

[0118] TATTTAAGAATAAGAGCCGCCTGAAGGCATGTAAGAACATGTGCAAGCACCAAGGAGGCCTCT

[0119] TCATTAAAGACATTGAGGATCTAAATGGAAGGTACTGAGAATCCTTTGCTTTCTCCCTGGCGATC

[0120] CTTTCTCCCAATTAGGTTTGGCAGGAAATGTGCTCATTGAGAAATTTTAAATGATCCAATCAACATGCT.

[0121] ANTXR1-ANPEP-CMAH-MSTN-CD163 KO cell line sequence (chromosome 1, deletion of 146 bp): TATTTAAGAATAAGAGCCG …………………… AGAGAAATTTTAAATGATCCAATCAACATGCT. ANTXR1-ANPEP-CMAH-MSTN-CD163 KO cell line sequence (chromosome 2, indel at sg location):

[0122] TATTTAAGAATAAGAGCC AGGCATGTAAGAACATGTGCAAGCACCAAGGAGGCCTCTTCATTAAAGACATTGAGGATCTAAATGGAAGGTACTGAGAATCCTTTGCTTTCTCCCTGGC GATCCTTTCTCCCAATTAGATTTGGCAGGAAATGTGCTCAT CAACATGCT

[0123] Wild type cell line sequence:

[0124] GACTCGACTGTGATGAGCACTCAACAGAATCTCGATGCTGTCGTTACCCTCTAACTGTGGATTT TGAAGCTTTTG ATGC.TCTGGATTATTGCACCCAAAAGATATAAGGCCAATTACTGCTCTGGAGAG.

[0125] TGAAGCTTTTGGATGGGACTGGATTATTGCACCCAAAAGATATAAGGCCAATTACTGCTCTGGA GAG.

[0126] ANTXR1-ANPEP-CMAH-MSTN-CD163 KO cell line sequence (chromosome 1, sg position creates base insertion deletion):

[0127] GACTCGACTGTGAT……TCACAGAATCTCGATGCTGTCGTTACCCTCTAACTGTGGATTTTGAAGCTTTTG……ATGC.TCTGGATTATTGCACCCAAAAGATATAAGGCCAATTACTGCTCTGGAGAG. ANTXR1-ANPEP-CMAH-MSTN-CD163 KO cell line sequence (chromosome 2, deletion of 69bp): GACTCGACTGTGCTC………………………………………………GGATTATTGCACCCAAAAGATATAAGGCCAATTACTGCTCTGGAGAG.

[0128] Therefore, the ANTXR1-ANPEP-CMAH-MSTN-CD163 KO cell line not only proves the high efficiency of the multi-gene editing fragment and multi-gene editing vector deletion system, but also the cell line can be used for subsequent research, providing a new method and tool for genetic improvement or new breed cultivation of pigs.

[0129] In summary, the application discloses a multi-gene editing fragment / vector / cell line and a preparation method and application thereof, the multi-gene editing fragment can be used for simultaneously editing pig CMAH, ANPEP, CD163, ANTXR1 and MSTN genes, a nucleotide sequence of the fragment is shown as SEQ ID No:1, and the multi-gene editing fragment can be used for preparing a multi-gene editing vector and a cell line, and further used for preparing a multi-gene editing pig. Since sgRNA in the multi-gene editing fragment is screened in a large quantity and arranged and combined creatively, the most optimal, shortest and most efficient connection mode is determined, and finally the multi-gene editing fragment shown as SEQ ID No:1 is formed. Since the multi-gene editing fragment is creatively designed, five genes (CMAH, ANPEP, CD163, ANTXR1 and MSTN genes) can be simultaneously targeted and edited, and the gene editing efficiency of the multi-gene editing vector and the cell line can be greatly improved, a foundation is laid for subsequent efficient gene editing research, and a new method and tool are further provided for pig gene improvement or new breed cultivation.

Claims

1. A multi-gene editing fragment, characterized in that, The fragment can be used to simultaneously edit the pig CMAH, ANPEP, CD163, ANTXR1 and MSTN genes, and the nucleotide sequence of the fragment is shown as SEQ ID No:

1.

2. The fragment of claim 1 is used in pig gene editing or used in preparing a multi-gene editing vector or used in preparing a multi-gene editing cell line or used in preparing a multi-gene editing pig.

3. A multi-gene editing vector, characterized by, The vector comprises the fragment of claim 1, and the vector can be used to simultaneously edit the pig CMAH, ANPEP, CD163, ANTXR1 and MSTN genes.

4. The carrier of claim 3, wherein, The nucleotide sequence of the vector is shown as SEQ ID No:

3.

5. The carrier of claim 3, wherein The nucleotide sequence of the vector is shown as SEQ ID No:

2.

6. The vector of any one of claims 3-5 is used in pig gene editing or used in preparing a multi-gene editing cell line or used in preparing a multi-gene editing pig.

7. A multi-gene edited cell line, characterized in that, The CMAH, ANPEP, CD163, ANTXR1 and MSTN genes in the cell line are simultaneously knocked out.

8. A method of making a multi-gene edited cell line, characterized in that, The method comprises: connecting the fragment of claim 1 to a vector containing the Gs12-7MAX protein coding sequence, then transfecting the vector into cells and performing drug screening to obtain a multi-gene editing cell line; or transfecting the vector of any one of claims 3-5 into cells and performing drug screening to obtain a multi-gene editing cell line.

9. A multi-gene editing cell line prepared by using the fragment of claim 1 or a multi-gene editing cell line prepared by using the vector of any one of claims 3-5 or a multi-gene editing cell line prepared by using the method of claim 8.

10. The multi-gene editing cell line of claim 9 is used in preparing a multi-gene editing pig or used in pig genetic improvement or used in pig new breed breeding.

Images