Primer composition, detection method and detection device for simultaneously detecting pathogenic bacteria genes and drug-resistant genes

Abstract

The invention relates to the technical field of bacterial detection, in particular to a primer composition for simultaneously detecting pathogenic bacteria genes and drug-resistant genes, a detection method and a detection device. The core of the invention lies in synchronous detection of two main bacteria causing sepsis, namely burkholderia pseudomallei and klebsiella pneumoniae, and key drug-resistant genes by using a loop-mediated isothermal amplification (LAMP) technology. Specifically, the primer composition comprises nucleotide sequences as shown in SEQ ID No.1-17, and can be used for detecting a burkholderia pseudomallei recA pathogenic gene, a kfB pathogenic gene of klebsiella pneumoniae, a quinolone antibiotic drug-resistant gene qnrA and a carbapenem antibiotic drug-resistant gene OXA-48 in a targeted manner. The primer composition disclosed by the invention can be used for simultaneously detecting various pathogenic bacteria genes and drug-resistant genes causing sepsis, the detection process is convenient, rapid and accurate, the detection result can be obtained within 40 minutes, and the detection effect is better.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of bacterial detection, and particularly relates to a primer composition for simultaneously detecting pathogenic bacteria genes and drug resistance genes, a detection method and a detection device. BACKGROUND

[0002] Sepsis, as a systemic inflammatory response syndrome induced by infection, seriously threatens human life and health. Related studies show that its mortality rate is as high as 20%-40%. In the treatment process of sepsis, early and accurate identification of pathogenic bacteria and their drug resistance plays a decisive role in improving the prognosis of patients. However, the detection techniques currently used in clinical practice have many limitations that cannot be ignored.

[0003] The gold standard for clinical detection is blood culture combined with drug susceptibility testing, but its positive rate is only 30%-40%, and the identification process takes 48-72 hours. Klebsiella pneumoniae is a common pathogen of sepsis and plays an important role in gram-negative bacterial sepsis. Its resistance rate to various antibacterial drugs is increasing, especially the resistance rate to carbapenems is significantly increased, with an average drug resistance rate of more than 60% in ICU, which seriously threatens the treatment and life safety of patients. Another highly pathogenic Burkholderia pseudomallei mainly infects immunocompromised individuals and can cause sepsis, of which the mortality rate of melioidosis sepsis is as high as 60%. During the "golden 6 hours" rescue window period of sepsis, traditional detection methods cannot provide results in time, which seriously delays treatment.

[0004] qnrA is a quinolone resistance gene, which belongs to one of the quinolone resistance gene families. It encodes a DNA gyrase protective protein that can prevent quinolone antibiotics (such as ciprofloxacin, norfloxacin, etc.) from binding to DNA gyrase, thereby causing bacteria to develop resistance to these drugs. The qnrA gene is usually located on a plasmid and has high horizontal transmission ability, so it is common in clinically resistant strains. OXA-48 is a carbapenem resistance gene, which belongs to the D class of β-lactamase (oxacillinase) family. It can hydrolyze carbapenem antibiotics (such as imipenem, meropenem, etc.), causing bacteria to develop resistance to these drugs. The OXA-48 gene is usually mediated by plasmids and has strong transmission ability, so it is common in carbapenem-resistant Klebsiella pneumoniae (CRKP).

[0005] Although the existing quantitative polymerase chain reaction (qPCR) technology can shorten the detection time to 4-6 hours, it also exposes two obvious defects. On the one hand, most kits on the market can only detect 16S rRNA genes or drug-resistant genes of pathogenic bacteria, resulting in low coverage of drug-resistant gene detection. On the other hand, when facing low load samples, the detection sensitivity of the technology is low, which greatly reduces the accuracy of the detection results.

[0006] In addition, existing rapid detection devices such as microfluidic chips and lateral flow test strips also have a series of problems. Their multiple target detection capability is generally limited; the detection sensitivity is greatly reduced compared to laboratory professional equipment, and pathogen identification and drug resistance analysis cannot be achieved simultaneously. However, among existing point-of-care testing (POCT) devices, the proportion of products that can simultaneously integrate pathogen detection and rapid analysis of such key drug resistance genes is insufficient, which severely restricts accurate treatment response. Therefore, clinical diagnosis and treatment urgently need to break through the technical bottlenecks of "single detection target", "insufficient drug resistance gene coverage", and "lagging response speed". SUMMARY

[0007] The purpose of the present application is to provide a primer composition, a detection method and a detection device for simultaneously detecting pathogenic bacteria genes and drug resistance genes causing sepsis. The present application uses comparative genomics analysis and loop-mediated isothermal amplification technology to find specific nucleic acid sequences of two sepsis-related pathogenic bacteria at the genomic level, and develops loop-mediated isothermal amplification detection primer sets for these sequences. The detection method and detection device developed by the present application can simultaneously detect two specific genes of two sepsis-related pathogenic bacteria and two drug resistance genes, have the characteristics of rapidness and accuracy, and can complete the whole process from sample processing to result analysis within 40 minutes. They can be used for clinical instant diagnosis and realize early warning of diseases, providing basis for subsequent treatment and targeted drug selection of patients.

[0008] The purpose of the present application is achieved by the following technical solutions:

[0009] The present application provides a primer composition for simultaneously detecting pathogenic bacteria genes and drug resistance genes causing sepsis, characterized in that the primer composition comprises nucleotide sequences as shown in SEQ ID No. 1-17, the pathogenic bacteria genes include Burkholderia pseudomallei recA pathogenic gene and Klebsiella pneumoniae skfB pathogenic gene, and the drug resistance genes include quinolone antibiotic resistance gene qnrA and carbapenem resistance gene OXA-48.

[0010] Further, the nucleotide sequences of the primer composition for detecting the Burkholderia pseudomallei recA pathogenic gene are shown in SEQ ID No. 1-4. Further, the nucleotide sequences of the primer composition for detecting the Burkholderia pseudomallei recA pathogenic gene are shown in SEQ ID No. 1-4.

[0011] Further, the nucleotide sequence of the primer composition for detecting the Klebsiella pneumoniae skfB pathogenic gene is shown as SEQ ID No. 5-8.

[0012] Further, the nucleotide sequence of the primer composition for detecting the quinolone antibiotic resistance gene qnrA is shown as SEQ ID No. 9-13.

[0013] Further, the nucleotide sequence of the primer composition for detecting the carbapenem antibiotic resistance gene OXA-48 is shown as SEQ ID No. 14-17.

[0014] Further, the primer composition further comprises a DNA molecule having the same function as the nucleotide sequence shown as SEQ ID No. 1-17 after substitution and / or deletion and / or addition of one or more nucleotides.

[0015] The present application also provides a method for simultaneously detecting pathogenic bacteria genes and drug resistance genes, which comprises the step of detecting by loop-mediated isothermal amplification method using the primer composition.

[0016] Further, the reaction conditions of the loop-mediated isothermal amplification method are as follows: reaction temperature 60-65℃, reaction time 40 minutes; the molar concentration ratio of the primer composition for detecting the Burkholderia pseudomallei recA pathogenic gene is 1:1:4-16:4-16; the molar concentration ratio of the primer composition for detecting the Klebsiella pneumoniae skfB pathogenic gene is 1:1:4-16:4-16; the molar concentration ratio of the primer composition for detecting the quinolone antibiotic resistance gene qnrA is 1:1:4-16:4-16:2-8; the molar concentration ratio of the primer composition for detecting the carbapenem antibiotic resistance gene OXA-48 is 1:1:4-16:4-16.

[0017] The present application also provides a sepsis-related bacterial pathogenic gene and drug resistance gene detection device based on loop-mediated isothermal amplification technology, which comprises the primer composition, and the detection device comprises a kit and / or a gene chip.

[0018] Further, the detection step of the detection device comprises:

[0019] (1) extracting genomic nucleic acid in the bacteria to be detected or other types of samples to be detected;

[0020] (2) using the genomic nucleic acid extracted in step (1) as a template, using the primer composition to perform loop-mediated isothermal amplification on Burkholderia pseudomallei recA pathogenic gene, Klebsiella pneumoniae skfB pathogenic gene, quinolone antibiotic resistance gene qnrA, and carbapenem antibiotic resistance gene OXA-48.

[0021] Among them, the primer composition of the present application can be used to detect whether the sample contains pathogenic bacteria: Burkholderia pseudomallei and Klebsiella pneumoniae, and whether the pathogenic bacteria contain drug resistance genes: quinolone antibiotic resistance gene and carbapenem antibiotic resistance gene.

[0022] If the genomic template in the sample can be specifically amplified using the primer composition described above, it indicates that the sample to be tested contains or is suspected to contain Burkholderia pseudomallei and Klebsiella pneumoniae pathogenic genes, and quinolone antibiotic resistance genes and carbapenem antibiotic resistance genes; on the contrary, if specific amplification cannot be performed, it indicates that the sample to be tested does not contain these pathogenic genes and quinolone antibiotic resistance genes and carbapenem antibiotic resistance genes.

[0023] Advantages:

[0024] The present application provides a primer composition for detecting common pathogenic bacteria pathogenic genes and drug resistance genes causing sepsis, which can simultaneously detect Burkholderia pseudomallei, Klebsiella pneumoniae pathogenic genes, and quinolone antibiotic resistance genes and carbapenem antibiotic resistance genes. The primer composition has the characteristics of convenience, rapidness and accuracy, and the detection result can be obtained within 40 minutes, and has strong specificity and high sensitivity.

[0025] In addition, the detection method of the present application uses loop-mediated isothermal amplification technology, which has the advantages of high efficiency, rapidness, low cost, high sensitivity and strong resistance, and is a key technology for the diagnosis of sepsis, especially in the medical care of the elderly disabled population. The technology can accurately prevent, diagnose, treat and guide the use of drugs for critical and severe cases, and provide scientific basis for the prognosis and rehabilitation of patients and the elderly, and is a key link to protect the health of this special group. BRIEF DESCRIPTION OF DRAWINGS

[0026] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and those skilled in the art can also obtain other drawings according to these drawings without creative labor.

[0027] Figure 1The fluorescence curve diagram of Burkholderia pseudomallei primer amplification of Burkholderia pseudomallei, Klebsiella pneumoniae, quinolone antibiotic resistance gene, carbapenem antibiotic resistance gene, human genome and blank control in the embodiment 1 of the present application;

[0028] Figure 2 The fluorescence curve diagram of Klebsiella pneumoniae primer amplification of Burkholderia pseudomallei, Klebsiella pneumoniae, quinolone antibiotic resistance gene, carbapenem antibiotic resistance gene, human genome and blank control in the embodiment 2 of the present application;

[0029] Figure 3 The fluorescence curve diagram of quinolone antibiotic resistance gene primer amplification of Burkholderia pseudomallei, Klebsiella pneumoniae, quinolone antibiotic resistance gene, carbapenem antibiotic resistance gene, human genome and blank control in the embodiment 3 of the present application;

[0030] Figure 4 The fluorescence curve diagram of carbapenem antibiotic resistance gene primer amplification of Burkholderia pseudomallei, Klebsiella pneumoniae, quinolone antibiotic resistance gene, carbapenem antibiotic resistance gene, human genome and blank control in the embodiment 4 of the present application;

[0031] Figure 5 The fluorescence curve diagram of Burkholderia pseudomallei primer amplification of 10 4 copies / μL Burkholderia pseudomallei, 10 3 copies / μL Burkholderia pseudomallei, 10 2 copies / μL Burkholderia pseudomallei, human genome and blank control in the embodiment 1 of the present application;

[0032] Figure 6 The fluorescence curve diagram of Klebsiella pneumoniae primer amplification of 10 4 copies / μL Klebsiella pneumoniae, 10 3 copies / μL Klebsiella pneumoniae, 10 2 copies / μL Klebsiella pneumoniae, human genome and blank control in the embodiment 2 of the present application;

[0033] Figure 7 The fluorescence curve diagram of quinolone antibiotic resistance gene primer amplification of 10 4 copies / μL quinolone antibiotic resistance gene, 10 3 copies / μL quinolone antibiotic resistance gene, 10 2 copies / μL quinolone antibiotic resistance gene, human genome and blank control in the embodiment 3 of the present application;

[0034] Figure 8 Figure 10 is a fluorescence curve plot of the carbapenem antibiotic resistance gene, 10 copies / μL carbapenem antibiotic resistance gene, 10 4 copies / μL carbapenem antibiotic resistance gene, 10 3 copies / μL carbapenem antibiotic resistance gene, 10 2 Figure 10 is a fluorescence curve plot of the carbapenem antibiotic resistance gene, 10 copies / μL carbapenem antibiotic resistance gene, 10 DETAILED DESCRIPTION

[0035] Various exemplary embodiments of the present application will now be described in detail, with reference to the figures. The detailed description is merely intended to teach a few examples of the present application and is not intended to limit the scope of the application. Rather, the detailed description is intended to convey the overall spirit and scope of the present application to those skilled in the art.

[0036] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. In addition, where particular ranges of values are given, it is intended to include every intervening value between the upper and lower limits of the range. Every smaller range that falls within the broader ranges is also included. The upper and lower limits of these smaller ranges can independently be included or excluded in the smaller ranges.

[0037] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the documents are cited. In case of conflict, the present specification will control.

[0038] Various modifications and changes can be made to the specific embodiments described herein without departing from the scope or spirit of the application. Other embodiments will be apparent to those of ordinary skill in the art from consideration of the description and practice of the application. The description and examples are illustrative only.

[0039] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean including, but not limited to.

[0040] The chemical reagents, biochemical reagents and materials used in the present application are commercially available unless otherwise specified.

[0041] The application will be described in detail below with reference to the drawings, so that the advantages and features of the application can be more easily understood by those skilled in the art, and the protection scope of the application can be more clearly defined, but the application is not limited in the scope of the embodiments. The reagents and raw materials used in the following embodiments are commercially available, and the test methods not specifically mentioned in the following embodiments are generally carried out according to conventional conditions or according to the conditions recommended by the manufacturers. In addition, unless otherwise specified, the experimental methods, detection methods, and preparation methods disclosed in the application all use conventional techniques in the fields of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields.

[0042] The primer composition of the primer composition for simultaneously detecting the Burkholderia pseudomallei recA pathogenic gene, the Klebsiella pneumoniae skfB pathogenic gene, the quinolone antibiotic resistance gene qnrA, and the carbapenem antibiotic resistance gene OXA-48 in the application comprises the nucleotide sequences shown as SEQ ID No. 1-17.

[0043] The method for detection using the above primer composition is as follows:

[0044] (1) Extracting genomic nucleic acid in the bacteria to be detected or other types of samples to be detected;

[0045] (2) Using the genomic nucleic acid extracted in step (1) as a template, using the above primer composition to perform loop-mediated isothermal amplification for detecting the Burkholderia pseudomallei recA pathogenic gene, the Klebsiella pneumoniae skfB pathogenic gene, the quinolone antibiotic resistance gene qnrA, and the carbapenem antibiotic resistance gene OXA-48.

[0046] Example 1

[0047] This embodiment is used for detecting the Burkholderia pseudomallei recA pathogenic gene, and the specific method comprises:

[0048] The plasmid containing the Burkholderia pseudomallei recA pathogenic gene synthesized by Beijing Qianke Biotechnology Co., Ltd. is used to detect Burkholderia pseudomallei using a detection kit. The synthesized plasmid is used as a template, and the reaction system is shown in Table 1. The prepared reaction system is set according to Table 2 on a fluorescence quantitative PCR instrument to set the loop-mediated isothermal amplification reaction program, and the fluorescence excitation light of 480-500 nm is detected.

[0049] Table 1 10 μL reaction system of Escherichia coli fluorescence quantitative PCR reaction tube

[0050]

[0051] Table 2 Loop-mediated isothermal amplification reaction program

[0052]

[0053] F3 (SEQ ID No. 1): AGAACGACGAGGTGATCGG

[0054] B3 (SEQ ID No. 2): GCGCGCGTTGTCCTTG

[0055] FIP (SEQ ID No. 3): ATCGCTTCGCGGAACGGCG-CAACGAAACGCGCGTGAAG

[0056] BIP (SEQ ID No. 4): GCGCCAGGGCGAGATCATC-GCCGCTATAGCTGTACCAC

[0057] The results after reaction are shown in Figure 1 and Figure 5 It can be seen from Figure 1 that the Burkholderia pseudomallei plasmid fluorescence curve is a specific S-type curve; the Klebsiella pneumoniae pathogenic gene, quinolone antibiotic resistance gene, carbapenem antibiotic resistance gene, human genome and blank control fluorescence curves are baseline, so it can be seen that the above primer combination can specifically detect Burkholderia pseudomallei. It can be seen from Figure 5 that 10 4 copies / μL of Burkholderia pseudomallei plasmid, 10 3 copies / μL of Burkholderia pseudomallei plasmid, and 10 2 copies / μL of Burkholderia pseudomallei plasmid all appear specific S-type fluorescence curves within 40 minutes. It can be seen that the above primer combination can detect Burkholderia pseudomallei within 40 minutes at a template concentration of 10 2 copies / μL, with high sensitivity.

[0058] Example 2

[0059] This example is used to detect Klebsiella pneumoniae skfB pathogenic gene, and the specific method comprises:

[0060] A plasmid containing Klebsiella pneumoniae skfB pathogenic gene is synthesized by Beijing Qikang Biotechnology Co., Ltd., which is used to detect Klebsiella pneumoniae by using the detection kit. The synthesized plasmid is used as a template, and the reaction system and reaction procedure are the same as in Example 1; the nucleotide sequences of the Klebsiella pneumoniae primers are as follows:

[0061] F3 (SEQ ID No. 5): CGCGACTACCCGATGGT

[0062] B3 (SEQ ID No. 6): AGCGACCACCTGCTCG

[0063] FIP (SEQ ID No. 7): CGTCATCGGCTTCCAGCTC-AATTCGTTCTCCACCGGCACA

[0064] BIP (SEQ ID No. 8): GCCAGTTCTACGGGTGGGC-GCGCGGGCGATCTGTT

[0065] The results after the reaction are shown in Figure 2 and Figure 6 It can be seen from Figure 2 that the plasmid fluorescence curve of Klebsiella pneumoniae is a specific S-type curve; the Burkholderia pseudomallei pathogenic gene, quinolone antibiotic resistance gene, carbapenem antibiotic resistance gene, human genome and blank control fluorescence curve are baseline, so the above primer combination can specifically detect Klebsiella pneumoniae. It can be seen from Figure 6 that 10 4 copies / μL of Klebsiella pneumoniae plasmid, 10 3 copies / μL of Klebsiella pneumoniae plasmid, and 10 2 copies / μL of Klebsiella pneumoniae plasmid all appear specific S-type fluorescence curves within 40 minutes. Therefore, the above primer combination can detect Klebsiella pneumoniae within 40 minutes at a template concentration of 10 2 copies / μL, and has high sensitivity.

[0066] Example 3

[0067] This example is used to detect the quinolone antibiotic resistance gene qnrA, and the specific method comprises:

[0068] The plasmid containing the quinolone antibiotic resistance gene qnrA is synthesized by Beijing Qikang Biotechnology Co., Ltd., and is used to detect the quinolone antibiotic resistance by the detection kit. The synthesized plasmid is used as a template, the reaction system is the same as that in Example 1, and the reaction procedure is the same as that in Example 1; the nucleotide sequences of the primers of the quinolone antibiotic resistance gene are as follows:

[0069] F3 (SEQ ID No. 9): AGGATTTCTCACGCCAGGAT

[0070] B3 (SEQ ID No. 10): AGTTGGCCAAAGACAGACG

[0071] FIP (SEQ ID No. 11): GCAGCTGACAGTGGCTGA- GTCTTGAGTGACAGCCGTTTTCG

[0072] BIP (SEQ ID No. 12): TGCAGTTTCATTGAAAGCG- GCGGGCCTTGAAACTGGCATCG

[0073] LB (SEQ ID No. 13): CCGTTGAAGGGTGTCACTTC

[0074] The results obtained after the reaction are shown in Figure 3 and Figure 7 It can be seen from Figure 3 that the fluorescence curve of the quinolone antibiotic resistance gene plasmid is a specific S-type curve; the fluorescence curves of the melioidosis Burkholderia pathogenic gene, the quinolone antibiotic resistance gene, the Klebsiella pneumoniae pathogenic gene, the carbapenem antibiotic resistance gene human genome, and the blank control are baselines. Therefore, the above primer combination can specifically detect quinolone antibiotic resistance. It can be seen from Figure 7 that 10 4 copies / μL of the quinolone antibiotic resistance gene plasmid, 10 3 copies / μL of the quinolone antibiotic resistance gene plasmid, and 10 2 copies / μL of the quinolone antibiotic resistance gene plasmid all appear specific S-type fluorescence curves within 40 minutes. Therefore, the above primer combination can detect quinolone antibiotic resistance genes within 40 minutes at a template concentration of 10 2 copies / μL, and has high sensitivity.

[0075] Example 4

[0076] This example is used to detect the carbapenem antibiotic resistance gene OXA-48. The specific method comprises:

[0077] The plasmid containing the carbapenem antibiotic resistance gene OXA-48 synthesized by Beijing Qianke Biological Technology Co., Ltd. is used to detect the carbapenem antibiotic resistance of the kit. The synthesized plasmid is used as a template, the reaction system is the same as that in Example 1, and the reaction procedure is the same as that in Example 1. The nucleotide sequences of the primers of the carbapenem antibiotic resistance gene are as follows:

[0078] F3 (SEQ ID No. 14): ATCACAGGGCGTAGTTGT

[0079] B3 (SEQ ID No. 15): CGTCTGTCCATCCCACTT

[0080] FIP (SEQ ID No. 16): TGCTTGGTTCGCCCGTTTA- ACTCTGGAATGAGAATAAGCAG

[0081] BIP (SEQ ID No. 17): TACCCGCATCTACCTTTAA-AATTCCAAGACTTGGTGTTCATCCT

[0082] The results after the reaction are shown in Figure 4 and Figure 8 It can be seen from Figure 4 that the fluorescence curve of the carbapenem antibiotic resistance gene plasmid is a specific S-shaped curve; the fluorescence curves of the melioidosis Burkholderia pathogen gene, the Klebsiella pneumoniae genome, the quinolone antibiotic resistance gene, the human genome, and the blank control are baselines, so it can be seen that the above primer combination can specifically detect carbapenem antibiotic resistance. It can be seen from Figure 8 that 10 4 copies / μL of the carbapenem antibiotic resistance gene plasmid, 10 3 copies / μL of the carbapenem antibiotic resistance gene plasmid, and 10 2 copies / μL of the carbapenem antibiotic resistance gene plasmid all appear specific S-shaped fluorescence curves within 40 minutes. It can be seen that the above primer combination can detect the carbapenem antibiotic resistance gene within 40 minutes at a template concentration of 10 2 copies / μL, and has high sensitivity.

[0083] The primer combination prepared in Examples 1-4 was used to diagnose sepsis by loop-mediated isothermal amplification method, wherein the molar concentration ratio of the primer combination F3, B3, FIP, and BIP in Example 1 was 1:1:4-16:4-16; wherein the molar concentration ratio of the primer combination F3, B3, FIP, and BIP in Example 2 was 1:1:4-16:4-16; wherein the molar concentration ratio of the primer combination F3, B3, FIP, BIP, and LB in Example 3 was 1:1:4-16:4-16:2-8; and the molar concentration ratio of the primer combination F3, B3, FIP, and BIP in Example 4 was 1:1:4-16:4-16; the loop-mediated isothermal amplification reaction conditions were constant temperature detection at 60-65°C for 40 minutes. It was finally found that the primer combination in the method can specifically detect the corresponding pathogen gene fragment, has high sensitivity, is specific for human genome and other pathogen detection, the results can be read within 40 minutes, and the experiment is repeatable.

[0084] The above embodiments only express several implementation manners of the present application, and the description is more specific and detailed, but it should not be understood as a limitation on the scope of the patent. It should be noted that for ordinary skilled persons in the art, without departing from the concept of the present application, several modifications and improvements can be made, which are within the scope of protection of the present application. Therefore, the protection scope of the patent of the present application should be subject to the appended claims.

Claims

1. A primer composition for simultaneously detecting pathogenic bacteria genes and drug resistance genes causing sepsis, characterized by, The primer composition comprises the nucleotide sequences shown as SEQ ID No. 1-17, the pathogenic gene comprises Burkholderia pseudomallei recA pathogenic gene, Klebsiella pneumoniae skfB pathogenic gene, the drug resistance gene comprises quinolone antibiotic resistance gene qnrA and carbapenem antibiotic resistance gene OXA-48.

2. The primer composition of claim 1, wherein The nucleotide sequence of the primer composition for detecting the Burkholderia pseudomallei recA pathogenic gene is shown as SEQ ID No. 1-4.

3. The primer composition of claim 1, wherein The nucleotide sequence of the primer composition for detecting the Klebsiella pneumoniae skfB pathogenic gene is shown as SEQ ID No. 5-8.

4. The primer composition of claim 1, wherein The nucleotide sequence of the primer composition for detecting the quinolone antibiotic resistance gene qnrA is shown as SEQ ID No. 9-13.

5. The primer composition of claim 1, wherein The nucleotide sequence of the primer composition for detecting the carbapenem antibiotic resistance gene OXA-48 is shown as SEQ ID No. 14-17.

6. The primer composition of claim 1, wherein The primer composition further comprises a DNA molecule having the same function as the above-mentioned nucleotide sequences after substitution and / or deletion and / or addition of one or more nucleotides to the nucleotide sequences shown as SEQ ID No. 1-17.

7. A method for simultaneous detection of pathogenic bacteria genes and drug resistance genes, characterized in that, The method comprises the step of detecting by loop-mediated isothermal amplification using the primer composition according to any one of claims 1-6.

8. The method of claim 7, wherein, The reaction conditions of the loop-mediated isothermal amplification method are as follows: reaction temperature 60-65℃, reaction time 40 minutes; the molar concentration ratio of the primer composition for detecting the Burkholderia pseudomallei recA pathogenic gene is 1:1:4-16:4-16; The molar concentration ratio of the primer composition for detecting the Klebsiella pneumoniae skfB pathogenic gene is 1:1:4-16:4-16; The molar concentration ratio of the primer composition for detecting the quinolone antibiotic resistance gene qnrA is 1:1:4-16:4-16:2-8; the molar concentration ratio of the primer composition for detecting the carbapenem antibiotic resistance gene OXA-48 is 1:1:4-16:4-16.

9. A device for detecting sepsis-related bacterial pathogenic genes and drug-resistant genes based on loop-mediated isothermal amplification technology, characterized in that, The detection device comprises the primer composition according to any one of claims 1-6, and the detection device comprises a kit and / or a gene chip.

10. The detection device of claim 9, wherein, The detection step of the detection device comprises: (1) extracting genomic nucleic acid in the bacteria to be detected or other types of samples to be detected; (2) using the genomic nucleic acid extracted in step (1) as a template, and using the primer composition according to any one of claims 1-6 to perform loop-mediated isothermal amplification on the Burkholderia pseudomallei recA pathogenic gene, the Klebsiella pneumoniae skfB pathogenic gene, the quinolone antibiotic resistance gene qnrA, and the carbapenem antibiotic resistance gene OXA-48.

Images