Molecular marker primer group for identifying macadimia nut variety Yunnan No.10, kit and application

Abstract

The invention discloses a molecular marker primer group for identifying a macadamia nut variety Yunnan No.10, a kit and application. The molecular marker primer group is composed of three pairs of primers, and each pair of primers is composed of an upstream primer and a downstream primer. An upstream primer of the first pair of primers is as shown in SEQ ID NO: 1 in a sequence table, a downstream primer of the first pair of primers is as shown in SEQ ID NO: 2 in the sequence table, an upstream primer of the second pair of primers is as shown in SEQ ID NO: 3 in the sequence table, a downstream primer of the second pair of primers is as shown in SEQ ID NO: 4 in the sequence table, an upstream primer of the third pair of primers is as shown in SEQ ID NO: 5 in the sequence table, and a downstream primer of the fourth pair of primers is as shown in SEQ ID NO: 6 in the sequence table. The downstream primer of the third pair of primers is shown as SEQ ID NO: 6 in the sequence table. The molecular marker primer group can accurately identify the macadimia nut variety Yunnan No.10.

Description

TECHNICAL FIELD

[0001] The present disclosure relates to the field of molecular biology and genetic breeding, in particular to a molecular marker primer set for identifying a new variety of Macadamia spp. Yunyan No. 10, a kit and application thereof. BACKGROUND

[0002] Macadamia spp. is native to Australia and is recognized worldwide as a high-end edible nut and woody oil plant, earning the reputation of "King of Nuts". The kernel of Macadamia spp. is rich in nutrients, with high fat content mainly composed of unsaturated fatty acids, which is beneficial to cardiovascular health. The market demand for Macadamia spp. is strong, but the global annual production is far lower than the market demand, resulting in a huge gap between supply and demand. Therefore, the development prospect of Macadamia spp. industry is very broad.

[0003] In recent years, China has become a major production area and important consumption market for Macadamia spp. in the world, but the main varieties currently planted mainly rely on introduction from abroad. The poor climate adaptability of some introduced varieties leads to low yield, with unit area yield only 1 / 3-1 / 2 of that in the original habitat, seriously restricting the industrial benefits. At the same time, with the changes in international trade environment and the strengthening of protection of plant variety rights in the original habitat, the introduction of foreign Macadamia spp. varieties in China is limited, and new varieties with independent intellectual property rights and adapted to local environment are urgently needed.

[0004] Plant variety identification can be based on morphological characteristics, physiological and ecological characteristics, biochemical markers and molecular markers. Morphological characteristic identification is intuitive and simple, but it is easily affected by environment and human factors, and has a long cycle and certain seasonality. Molecular marker identification has significant advantages, is not affected by season and development stage, has rich polymorphism and strong specificity, is fast, efficient and high-precision, and has been applied to DUS testing and substantial derivative variety identification of many plants. At present, there are phenomena of "same name different things" and "same thing different names" in Macadamia spp., which hinders variety breeding, intellectual property protection and industry promotion. Impure or incorrect seedling varieties also damage the economic interests of practitioners, seriously affecting the healthy development of Macadamia spp. industry.

[0005] Yunyan No. 10 is a new variety of Macadamia spp. selected by Yunnan Institute of Tropical Crops, which obtained the Certificate of Registration of New Varieties of Horticultural Plants of Yunnan Province on January 6, 2023, with the certificate number: Yunlin Garden Plant New Variety Registration No. 20230012. The variety information can be found in the 2022 Announcement of the Yunnan Provincial Bureau of Forestry and Grassland Administration Office of Registration of New Varieties of Horticultural Plants (No. 2202). Accurate identification of Yunyan No. 10 is crucial for its popularization and application.

[0006] DISCLOSURE

[0007] In order to solve the problem of inaccurate identification of Macadamia integrifolia cultivar Yunyan No.10, the embodiment of the present disclosure provides a molecular marker primer group for identifying Macadamia integrifolia cultivar Yunyan No.10, a kit and an application thereof. The technical solution is as follows:

[0008] In one aspect, the present disclosure provides a molecular marker primer group for identifying Macadamia integrifolia cultivar Yunyan No.10, which consists of three pairs of primers, each pair of primers consisting of an upstream primer and a downstream primer. The upstream primer of the first pair of primers is shown in SEQ ID NO:1 in the sequence listing, the downstream primer of the first pair of primers is shown in SEQ ID NO:2 in the sequence listing, the upstream primer of the second pair of primers is shown in SEQ ID NO:3 in the sequence listing, the downstream primer of the second pair of primers is shown in SEQ ID NO:4 in the sequence listing, the upstream primer of the third pair of primers is shown in SEQ ID NO:5 in the sequence listing, and the downstream primer of the third pair of primers is shown in SEQ ID NO:6 in the sequence listing.

[0009] In another aspect, the present disclosure provides a kit for identifying Macadamia integrifolia cultivar Yunyan No.10, which comprises the above-mentioned molecular marker primer group.

[0010] In yet another aspect, the present disclosure provides an application of a molecular marker primer group for identifying Macadamia integrifolia cultivar Yunyan No.10, characterized in that the application comprises: amplifying a to-be-tested sample using the molecular marker primer group according to claim 1 to obtain an amplification product;

[0011] sequencing the amplification product by next-generation high-throughput sequencing to obtain sequencing data;

[0012] aligning the sequencing data to a Macadamia integrifolia reference genome to obtain a sequencing result of the to-be-tested sample;

[0013] analyzing the sequencing result to obtain different sequence types shown in SEQ ID NO:7 in the sequence listing to SEQ ID NO:44 in the sequence listing;

[0014] when the obtained sequence type is shown in SEQ ID NO:12, SEQ ID NO:15, SEQ ID NO:18, SEQ ID NO:22, SEQ ID NO:32 and SEQ ID NO:40, then the to-be-tested sample is identified as Macadamia integrifolia cultivar Yunyan No.10.

[0015] The application also includes: the molecular marker primer set distinguishes between macadamia cultivars 294, 344, 508, 660, 695, 762, 788, 791, 792, 800, 816, 842, 900, 951, A16, A4, D, D4, H2, JW, O.C, O.V, S, Guang 11, Guire No. 1, Nanya 116, Nanya No. 1, Nanya No. 2, Nanya No. 3 and Yunyan No. 4.

[0016] The technical scheme provided by the embodiments of the present disclosure has the beneficial effects that: the embodiments of the present disclosure provide a molecular marker primer set for identifying macadamia cultivar Yunyan No. 10, a kit and an application. The molecular marker primer set is used to amplify the test sample, the obtained amplification product is sequenced, and the cultivars are distinguished according to the sequencing results. There are differences in multiple bases between the sequences of different cultivars, including substitution, insertion, deletion and repetition, etc. Through these differences, the macadamia cultivar Yunyan No. 10 can be accurately identified. At the same time, the differences can be used to effectively distinguish between Yunyan No. 10 and other 30 macadamia cultivars 294, 344, 508, 660, 695, 762, 788, 791, 792, 800, 816, 842, 900, 951, A16, A4, D, D4, H2, JW, O.C, O.V, S, Guang 11, Guire No. 1, Nanya 116, Nanya No. 1, Nanya No. 2, Nanya No. 3 and Yunyan No. 4. BRIEF DESCRIPTION OF DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present disclosure, the drawings needed in the embodiment description will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present disclosure, and other drawings can also be obtained by those skilled in the art without creative labor.

[0018] Figure 1 is the sequence alignment map of the first pair of primers provided in Embodiment Three of the present disclosure.

[0019] Figure 2 is the sequence alignment map of the second pair of primers provided in Embodiment Three of the present disclosure.

[0020] Figure 3 is the sequence alignment map of the third pair of primers provided in Embodiment Three of the present disclosure. DETAILED DESCRIPTION

[0021] In order to make the purpose, technical scheme and advantages of the present disclosure clearer, the embodiments of the present disclosure will be described in further detail below.

[0022] Embodiment One

[0023] The embodiment provides a molecular marker primer group for identifying Macadamia integrifolia cultivar Yunyan No.10, which is composed of three pairs of primers, and each pair of primers is composed of an upstream primer and a downstream primer. The upstream primer of the first pair of primers is shown in SEQ ID NO:1 in the sequence listing, and specifically is GC ATAGCCGTTCCCTTGAAATTTAT. The downstream primer of the first pair of primers is shown in SEQ ID NO:2 in the sequence listing, and specifically is GGGTTT ATACGTGTCGAAGGTTAGG. The upstream primer of the second pair of primers is shown in SEQ ID NO:3 in the sequence listing, and specifically is CAAAATAGTTCA CAACACCCACTCA. The downstream primer of the second pair of primers is shown in SEQ ID NO:4 in the sequence listing, and specifically is ACCTAAAATGGTTG AACAATGAGGT. The upstream primer of the third pair of primers is shown in SEQ ID NO:5 in the sequence listing, and specifically is AGCAACATAAGGTATAT CAGTCCACA. The downstream primer of the third pair of primers is shown in SEQ ID NO:6 in the sequence listing, and specifically is TTGAGCTCGTTTAAAAACT ATGTACT. The related information of the three pairs of primers is shown in Table 1.

[0024] Table 1 is related information of the three pairs of primers

[0025] Primer pair Chromosome Start End First primer pair GWHBAUK00000003_1 16117309 16117580 Second primer pair GWHBAUK00000006_1 20258512 20258711 Third primer pair GWHBAUK00000007_1 6725174 6725432

[0026] Embodiment two

[0027] The disclosure provides a kit for identifying Macadamia integrifolia cultivar Yunyan No.10, which comprises the molecular marker primer group provided in embodiment one.

[0028] Embodiment three

[0029] The disclosure provides an application of the molecular marker primer group for identifying Macadamia integrifolia cultivar Yunyan No.10, which comprises: using the molecular marker primer group provided in embodiment one to identify Macadamia integrifolia cultivar Yunyan No.10.

[0030] Further, the application further comprises: using the molecular marker primer group provided in embodiment one to effectively distinguish 30 Macadamia cultivars 294, 344, 508, 660, 695, 762, 788, 791, 792, 800, 816, 842, 900, 951, A16, A4, D, D4, H2, JW, O.C, O.V, S, Guang 11, Guire No.1, Nanya 116, Nanya No.1, Nanya No.2, Nanya No.3 and Yunyan No.4.

[0031] Specifically, 31 macadamia varieties are taken as the samples to be tested, and the variety names are shown in Table 2. The 31 samples to be tested are all from the Macadamia Germplasm Garden of the Ministry of Agriculture and Rural Affairs, which has perfect germplasm preservation conditions and standardized management measures. All the macadamia varieties involved in the embodiment are planted and preserved in China.

[0032] Table 2 shows the variety names of the 31 samples to be tested

[0033]

[0034] DNA of the above-mentioned 31 samples to be tested is extracted. In the implementation, a new plant genomic DNA extraction kit produced by Tiangen Biosciences (Beijing) Co., Ltd. is used to extract the DNA of the samples to be tested. The specific operation is performed according to the instructions of the new plant genomic DNA extraction kit.

[0035] The DNA of the 31 samples to be tested is amplified by using the molecular marker primer set provided in the first embodiment of the present application. Specifically, the amplification system comprises 50 ng of DNA of the sample to be tested, 0.5 μL of 10 mM dNTP (deoxy-ribonucleoside triphosphate), 0.5 μL of each upstream primer, 0.5 μL of each downstream primer, 2.5 μL of Tap Buffer buffer, 0.2 μL of Taq enzyme, and ddH2O is added to make up the amplification system to 20 μL. The amplification program comprises: 95℃ for 3 min; (95℃ for 30 sec, 60℃ for 30 sec) x 30 cycles; 72℃ for 6 min.

[0036] After amplification, the amplification product is obtained, and the amplification product is subjected to second-generation high-throughput sequencing to obtain sequencing data. The sequencing data is aligned to the macadamia reference genome (version number GWHBAUK00000000.1) by using the Bowtie2 software to obtain the sequencing results of each sample to be tested.

[0037] According to the upstream primer sequence and the downstream primer sequence of the molecular marker primer pair, e-PCR is performed by using the software TBtools to verify that the three primer pairs all belong to specific amplification.

[0038] According to the upstream primer sequence, the downstream primer sequence and the related information in Table 1 of the molecular marker primer pair, the target sequences of the three primer pairs on the reference genome are extracted by using the software TBtools, and are represented by the numbers 01, 02 and 03, respectively.

[0039] The sequencing results were analyzed by using Microsoft Office Excel software. There were 11 different sequence types for the first pair of primers. The 11 different sequence types were named as a1, b1, c1, d1, e1, f1, g1, h1, i1, j1 and k1, respectively, and were specifically shown in the sequence listing as SEQ ID NO: 7-SEQ ID NO: 17.

[0040] The sequence alignment was performed by using software DNAMAN, and the sequence alignment results are shown in Figure 1 Figure 1 In the sequence alignment results, the number 01 represents the target sequence of the first pair of primers on the reference genome, and specifically is: GCATAGCCGTTCCCTTGAAATTTATATCACATGTTTGACTGTCCATCCGAAATCTCACGATTTCCACGTGTCGGAAAGATGCTAGCCAACCCGATACTTTATATAGCTGTTTCCTTCCCGAATTCCGACTGTAGAATGATCGTACAAAGAGTGAGAACTGTGTGAGAAGAGACTCTGCTAGAGAGACAGAAAAGGTTAGAAAGGCATCTAGTCATCAGTGAGTTTTCCTTAACGGTGGTAGCAGAATCCTAACCTTCGACACGTATAAACCC (as shown in the sequence listing as SEQ ID NO: 8), wherein the sequence b1 is the same as the target sequence 01 on the reference genome, and the remaining sequences are different.

[0041] There were 13 different sequence types for the second pair of primers, and the 13 different sequence types were named as a2, b2, c2, d2, e2, f2, g2, h2, i2, j2, k2, l2 and m2, respectively, and were specifically shown in the sequence listing as SEQ ID NO: 18-SEQ ID NO: 30.

[0042] The sequence alignment was performed by using software DNAMAN, and the sequence alignment results are shown in Figure 2 ​As shown, the number 02 represents the target sequence of the second pair of primers on the reference genome, specifically: CAAAATAGTTCACAACACCCACTCACCTGTTGTCCCTATGAGTTGCGTATTGCCGATGACTTCATGTCGAGTTTCCTCACCGCTTGACAGCTCTATTTATAGGAAACATAAATGGTTTCTAGGTCAAGCAATATACACTCCTAATTCTCTTCTTATGGTGTTGATCATAACCCCCACCTCATTGTTCAACCATTTTAGGT (as shown in SEQ ID NO: 21 in the Sequence Listing), wherein sequence d2 is identical to the target sequence 02 on the reference genome, and the rest of the sequences are different.

[0043] The third pair of primers has 14 different sequence types, which are named a3, b3, c3, d3, e3, f3, g3, h3, i3, j3, k3, l3, m3 and n3 respectively, as shown in SEQ ID NO: 31-SEQ ID NO: 44 in the Sequence Listing.

[0044] The number 03 represents the target sequence of the third pair of primers on the reference genome, specifically: AGCAACATAAGGTATATCAGTCCACAAAATTAGAATTCAATTGTCAATAACTTATTGAGACAATCCCATGTAGGACTAACTACTGGTATCAACTAGTCTCAATTGTTTTCAGTCAAGCTAACGCCATTACTGCTCATTTAGGTAATCAAGCCTCAAAGGCCAAGGTGTAGACACATTTCTATTCGTTTGGTTACTGCTCATAATTAGGCTTATACATCTTTATCAAACTATATAGTACATAGTTTTTAAACGAGCTCAA (as shown in SEQ ID NO: 45 in the Sequence Listing).

[0045] When the sequence alignment is performed by the software DNAMAN, the result shows that sequence e3 is identical to the target sequence 03 on the reference genome. Because there are many sequence types, the sequence alignment chart is large, and it is not clear when compressed into one page.

[0046] Variety identification is to compare the differences between different varieties. In order to clearly present the sequence alignment chart in one page, data processing is carried out. The 26 base sequences at the 5' end of the 14 sequences and the 03 sequence, i.e. the upstream primer sequence, are removed, and the specific sequence is AGCAACATAAGGTATATCAGTCCACA (as shown in SEQ ID NO: 7 in the sequence listing). The 26 base sequences at the 3' end, i.e. the reverse complementary sequence of the downstream primer sequence, are removed, and the specific sequence is AGTACATAGTTTTTAAACGAGCTCAA (as shown in SEQ ID NO: 46 in the sequence listing). The two sequences are homogeneous parts of all samples to be tested, and the processing does not affect the variety identification result.

[0047] The sequence alignment result after removing the two end bases is shown in Table 3. Figure 3 The processed sequence e3 is the same as the processed sequence 03, and the other sequences are different.

[0048] The specific genotypes of the 31 samples to be tested are shown in Table 3. In order to improve the efficiency of variety identification, the same genotypes of the same primer pair are not listed, i.e. the repeated values in the same column of Table 3 are deleted and only shown in the form of spaces. The only genotype amplified by the same primer pair, i.e. the non-space unique value in the same column of Table 3, is regarded as a specific genotype.

[0049] Table 3 is the specific genotype of the 31 samples to be tested

[0050]

[0051]

[0052] As can be seen from Table 3, each of the above-mentioned 31 samples has at least one specific genotype, indicating that the molecular marker primer set provided in Example 1 of the present application can distinguish the 31 samples to be tested.

[0053] Specifically, as sample No. 1 is also variety 294, there is only one specific genotype, i.e. the specific genotype of the third primer pair is b3c3, and the specific genotype of the third primer pair of sample No. 30, which is also variety Yunyan No. 10, is b3j3, c3 and j3 are different, indicating that the third primer pair can distinguish variety 294 and Yunyan No. 10.

[0054] For example, sample No. 30, which is also variety Yunyan No. 10, is different from the specific genotypes of the first primer pair of sample Nos. 2, 4, 5, 7, 12, 13, 15, 16, 18, 19, 23, 26, 27, 28 and 29, indicating that the first primer pair can distinguish sample No. 30, which is also variety Yunyan No. 10, from sample Nos. 2, 4, 5, 7, 12, 13, 15, 16, 18, 19, 23, 26, 27, 28 and 29.

[0055] Yunyan 10 has three specific genotypes, with the specific genotype combination being f1i1+a2e2+b3j3, which allows for accurate identification of Yunyan 10. Furthermore, based on the differences in specific genotypes and combinations, it can effectively distinguish 30 other macadamia nut varieties: 294, 344, 508, 660, 695, 762, 788, 791, 792, 800, 816, 842, 900, 951, A16, A4, D, D4, H2, JW, OC, OV, S, Guang 11, Guire 1, Nanya 116, Nanya 1, Nanya 2, Nanya 3, and Yunyan 4.

[0056] Accuracy analysis of molecular marker primer set identification

[0057] Accuracy analysis was performed using two reproducibility experiments. In this embodiment, two independent experiments were conducted using different personnel, different batches of reagents, and different laboratories to simulate the identification of different batches of macadamia nuts. The high reproducibility rate means that the identification results from different laboratories can be accurately compared with each other.

[0058] A reproducibility experiment was conducted using 31 test samples. The results of each experiment were analyzed, and specific genotypes and combinations were recorded. See Table 4 for details.

[0059] Table 4 shows the results of the two repeated experiments.

[0060]

[0061]

[0062] As shown in Table 4, the specific genotypes and combinations were identical in both replicate experiments. Therefore, the accuracy of the molecular marker primer set provided by this invention is 100%.

[0063] The third embodiment of the present invention shows that the variety identification conclusions between different laboratories or different batches of the same laboratory have a high degree of consistency, thus eliminating the need to use parallel experiments to reduce experimental errors, which greatly facilitates the identification of macadamia varieties.

[0064] The application provides a molecular marker primer group for identifying macadamia cultivar Yunyan No.10, a kit and application thereof. The molecular marker primer group is used for amplifying a to-be-tested sample, and the amplification product is sequenced, and the cultivars are distinguished according to the sequencing results, and there are multiple base differences between the sequences of different cultivars, the differences including substitution, insertion, deletion and repetition, and the accurate identification of the macadamia cultivar Yunyan No.10 is realized through the differences. Meanwhile, the differences can be used for effectively distinguishing Yunyan No.10 and other 30 macadamia cultivars 294, 344, 508, 660, 695, 762, 788, 791, 792, 800, 816, 842, 900, 951, A16, A4, D, D4, H2, JW, O.C, O.V, S, Guang 11, Guire No.1, Nanya 116, Nanya No.1, Nanya No.2, Nanya No.3 and Yunyan No.4, and the identification result is not affected by the environment and other human factors.

[0065] The application amplifies the target sequence through the high polymorphism molecular marker primer group, and compares the base differences between different cultivars, so that the efficient macadamia cultivar identification is realized, and the reproducibility experiment further verifies the accuracy and reliability of the technology.

[0066] The above only describes optional embodiments of the present disclosure, and does not limit the present disclosure, and any modification, equivalent replacement, improvement and the like made within the spirit and principle of the present disclosure shall be included in the protection scope of the present disclosure.

Claims

1. A molecular marker primer set for identifying macadamia cultivar Yunyan No. 10, characterized in that, The molecular marker primer set consists of three pairs of primers, each pair of primers consisting of an upstream primer and a downstream primer, the upstream primer of the first pair of primers being as shown in SEQ ID NO: 1 in the sequence listing, the downstream primer of the first pair of primers being as shown in SEQ ID NO: 2 in the sequence listing, the upstream primer of the second pair of primers being as shown in SEQ ID NO: 3 in the sequence listing, the downstream primer of the second pair of primers being as shown in SEQ ID NO: 4 in the sequence listing, the upstream primer of the third pair of primers being as shown in SEQ ID NO: 5 in the sequence listing, and the downstream primer of the third pair of primers being as shown in SEQ ID NO: 6 in the sequence listing.

2. A kit for identifying the macadamia cultivar Yunnan 10, characterized in that, The kit comprises the molecular marker primer set according to claim 1.

3. Use of a molecular marker primer set for identifying Macadamia integrifolia cultivar Yunyan No. 10, characterized in that, The application comprises: amplifying the sample to be tested using the molecular marker primer set according to claim 1 to obtain an amplification product; sequencing the amplification product by next-generation high-throughput sequencing to obtain sequencing data; aligning the sequencing data to the macadamia reference genome to obtain sequencing results of the sample to be tested; analyzing the sequencing results to obtain different sequence types; when the obtained sequence type is as shown in SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 22, SEQ ID NO: 32 and SEQ ID NO: 40 in the sequence listing, then the sample to be tested is identified as macadamia cultivar Yunyan No.

10.

4. Use according to claim 3, characterized in that, The application further comprises: using the molecular marker primer set to distinguish between macadamia cultivars 294, 344, 508, 660, 695, 762, 788, 791, 792, 800, 816, 842, 900, 951, A16, A4, D, D4, H2, JW, O.C, O.V, S, Guang 11, Guire No. 1, Nanya 116, Nanya No. 1, Nanya No. 2, Nanya No. 3 and Yunyan No. 4.

Images