Application of compound in prevention and treatment of coronavirus infection and / or diseases caused by coronavirus
The drugs prepared using compounds G96-69, G96-70, G102-35, G110-74, G115-49, and G118-1 have solved the problem of the lack of effective prevention and treatment of coronavirus infection and disease in the existing technology. They have achieved effective inhibition and symptom improvement of multiple coronaviruses, are suitable for humans and animals, and have shown significant effects in in vitro experiments.
Patent Information
- Application Number
- CN202410574676.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-10
- Publication Date
- 2025-11-11
AI Technical Summary
Current technologies lack effective small molecule drugs to prevent and treat coronavirus infection and related diseases, especially intestinal and respiratory diseases caused by coronaviruses in humans and animals, resulting in significant economic losses and health threats.
Compounds G96-69, G96-70, G102-35, G110-74, G115-49, G118-1 and their pharmaceutically acceptable salts are provided for the preparation of drugs for the prevention and treatment of coronavirus infection, coronavirus-induced diseases and the improvement of symptoms, the inhibition of coronavirus replication, and in vitro applications, covering a variety of viruses in the Orthocoronavirus subfamily, including α, β, γ, and δ coronaviruses, as well as specific human and animal coronaviruses.
These compounds showed good antiviral effects, with EC50 significantly inhibiting the replication of multiple coronaviruses in the range of 0.37-5.68 μM. They also exhibited high safety, were suitable for use in various animals, including humans, and showed inhibitory effects comparable to the existing drug Obeldesivir in in vitro experiments.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of pharmaceutical technology, specifically relating to the use of compounds in the prevention and treatment of coronavirus infection and / or diseases caused by coronavirus. Background Technology
[0002] The coronavirus (CoV) family is the largest RNA virus genome discovered in nature to date. Many members of this family are important pathogens causing intestinal and respiratory diseases in humans, poultry, and livestock. Coronaviruses are important pathogens with a wide host range and are extremely dangerous. Besides infecting humans, coronaviruses are also very common in animal species. Porcine epidemic diarrhea virus (PEDV), transmissible gastroenteritis virus (TGEV), and porcine deltacoronavirus (PDCoV, also called deltavirus) can cause severe enteritis, diarrhea, vomiting, and dehydration in pigs, causing huge losses to the pig industry. Feline infectious peritonitis virus (FIPV) can cause fatal disease in felines. Avian infectious bronchitis virus (IBV) infects poultry and is a widespread poultry disease that has a huge economic impact on the poultry industry. To address current and future coronavirus outbreaks, it is necessary to develop more small molecule drugs targeting coronaviruses. Summary of the Invention
[0003] The first aspect of the present invention is to provide the application of the substance.
[0004] A second aspect of the present invention is to provide a method.
[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0006] In a first aspect, the invention provides the use of a substance in any one of (1) to (5);
[0007] The substance comprises A and / or a pharmaceutically acceptable salt thereof, wherein A is selected from any one of B, wherein B is: G96-69, G96-70, G102-35, G110-74, G115-49, and G118-1;
[0008] The chemical structural formulas of G96-69, G96-70, G102-35, G110-74, G115-49, and G118-1 are shown in formulas (Ⅰ), (Ⅱ), (Ⅲ), (Ⅳ), (Ⅴ), and (Ⅵ), respectively:
[0009]
[0010] (1) To prepare drugs for the prevention and / or treatment of coronavirus infection;
[0011] (2) To prepare medicines for the prevention and / or treatment of diseases caused by coronaviruses;
[0012] (3) To prepare drugs to improve symptoms caused by coronavirus;
[0013] (4) Preparation of coronavirus replication inhibitors for in vitro experiments;
[0014] (5) In vitro non-therapeutic destination inhibition of coronavirus replication.
[0015] Preferably, the coronaviruses described in (1) to (5) include viruses of the Orthocoronavirus subfamily.
[0016] Preferably, the viruses of the Orthocoronavirus subfamily include viruses of the genus α-coronavirus, β-coronavirus, γ-coronavirus, and / or δ-coronavirus.
[0017] Preferably, the coronaviruses described in (1) to (5) include one or more of the following: coronaviruses that cause upper respiratory tract infections, coronaviruses that cause lower respiratory tract infections, coronaviruses that cause digestive tract infections, and coronaviruses that cause acute respiratory syndrome; more preferably, coronaviruses that cause upper respiratory tract infections.
[0018] Preferably, the coronavirus causing upper respiratory tract infection comprises human coronaviruses (e.g., HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1) and / or mouse hepatitis viruses (e.g., MHV1, MHV2 [MHV(Pr)], MHV3, MHV4(JHM), MHV-A59, MHVS, MHVZ, and MHVU); further comprises at least one of mouse hepatitis virus MHV-A59, human coronavirus HCoV-229E, human coronavirus HCoV-OC43, and human coronavirus HCoV-NL63; and even further comprises at least one of human coronavirus HCoV-229E, human coronavirus HCoV-OC43, and human coronavirus HCoV-NL63.
[0019] Preferably, the coronavirus causing lower respiratory tract infection is avian infectious bronchitis virus.
[0020] Preferably, the coronavirus causing gastrointestinal infection includes at least one of porcine transmissible gastroenteritis virus, porcine epidemic diarrhea virus, porcine type D coronavirus, and feline infectious peritonitis virus.
[0021] Preferably, the coronavirus causing acute respiratory syndrome is at least one of SARS-related coronavirus and Middle East respiratory syndrome coronavirus.
[0022] Preferably, the SARS-related coronavirus includes at least one of SARS-CoV-1 and SARS-CoV-2.
[0023] Preferably, the substance further comprises C and / or a pharmaceutically acceptable salt thereof;
[0024] The C comprises at least one of the B, and the compound in the C is different from the compound in the A.
[0025] Preferably, the pharmaceutically acceptable salt comprises at least one of a metal salt, an ammonium salt, a salt formed with an organic base, a salt formed with an inorganic acid, a salt formed with an organic acid, a salt formed with a basic amino acid, and a salt formed with an acidic amino acid.
[0026] Preferably, the metal salt comprises at least one of alkali metal salts (e.g., sodium salts, potassium salts, etc.), alkaline earth metal salts (e.g., calcium salts, magnesium salts, barium salts, etc.), and aluminum salts.
[0027] Preferably, the salt formed with the organic base comprises a salt formed with one or more of the following organic bases: trimethylamine, triethylamine, pyridine, methylpyridine, 2,6-dimethylpyridine, ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine, and N,N'-dibenzylethylenediamine.
[0028] Preferably, the salt formed with the inorganic acid comprises a salt formed with one or more of the following inorganic acids: hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, and phosphoric acid.
[0029] Preferably, the salt formed with the organic acid comprises a salt formed with one or more of the following organic acids: formic acid, acetic acid, trifluoroacetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, and p-toluenesulfonic acid.
[0030] Preferably, the salt formed with the basic amino acid comprises a salt formed with one or more of the following basic amino acids: arginine, lysine, ornithine.
[0031] Preferably, the salt formed with the acidic amino acid comprises a salt formed with one or more of the following acidic amino acids: aspartic acid, glutamic acid.
[0032] Preferably, the drug described in (1) further comprises other active ingredients for the prevention and / or treatment of coronavirus infection, such as: Obeldesivir (ATV006), gossypol acetate (CN116867486A), mecobalamin (CN116867486A), ertapenem (CN116867486A), chamomile (CN116867486A), netilmicin sulfate (CN116867486A), sennoside A (CN116867486A), ellagic acid (CN116867486A), tanshinone I (CN115666576A), cryptotanshinone (CN115666576A), etc. 15666576A), Obatok (CN113197894A), Monensin (CN108721271A), Lycorine (CN108478571A), Finazine (CN108324715A), Pyrrofen (CN108721292A), Mycophenolate mofetil (CN108478562A), Emetine (CN108721293A), Rutin (CN111544442A), Phellinus linteus and Centella asiatica (CN113230289A), Chlorpromazine (CN116549456A), Andrographolide (CN114246859A), etc.
[0033] Preferably, the drug described in (2) further comprises other active ingredients for the prevention and / or treatment of diseases caused by coronaviruses, such as: Obeldesivir (ATV006), gossypol acetate (CN116867486A), mecobalamin (CN116867486A), ertapenem (CN116867486A), chamomile (CN116867486A), netilmicin sulfate (CN116867486A), sennoside A (CN116867486A), ellagic acid (CN116867486A), tanshinone I (CN115666576A), cryptotanshinone (CN115666576A), etc. 115666576A), Obatok (CN113197894A), Monensin (CN108721271A), Lycorine (CN108478571A), Finazine (CN108324715A), Pyrrofen (CN108721292A), Mycophenolate mofetil (CN108478562A), Emetine (CN108721293A), Rutin (CN111544442A), Phellinus linteus and Lysimachia christinae (CN113230289A), Chlorpromazine (CN116549456A), Andrographolide (CN114246859A), etc.
[0034] Preferably, the drug described in (3) further comprises other active ingredients that improve symptoms caused by coronavirus, such as: Obeldesivir (ATV006), gossypol acetate (CN116867486A), mecobalamin (CN116867486A), ertapenem (CN116867486A), chamomile (CN116867486A), netilmicin sulfate (CN116867486A), sennoside A (CN116867486A), ellagic acid (CN116867486A), tanshinone I (CN115666576A), cryptotanshinone (CN115 666576A), Obatoc (CN113197894A), Monensin (CN108721271A), Lycorine (CN108478571A), Finasteride (CN108324715A), Pyrrofen (CN108721292A), Mycophenolate Mofetil (CN108478562A), Emetine (CN108721293A), Rutin (CN111544442A), Phellinus linteus and Centella asiatica (CN113230289A), Chlorpromazine (CN116549456A), Andrographolide (CN114246859A), etc.
[0035] Preferably, the in vitro coronavirus replication inhibitor described in (4) also contains other active ingredients that inhibit coronavirus replication, such as: obatakine (CN113197894A), monensin (CN108721271A), lycorine (CN108478571A), phenapyridine (CN108324715A), pyrimidine (CN108721292A), mycophenolate mofetil (CN108478562A), emetine (CN108721293A), Phellinus linteus and baicalensis (CN113230289A), chlorpromazine (CN116549456A), andrographolide (CN114246859A), etc.
[0036] Preferably, the drugs described in (1) to (3) further contain pharmaceutically acceptable excipients.
[0037] Preferably, the pharmaceutically acceptable excipients include at least one of diluents, excipients, binders, humectants, surfactants, lubricants, and disintegrants.
[0038] Preferably, the dosage form of the drug described in (1) to (3) is a dosage form suitable for children or an adult.
[0039] Preferably, the dosage form is selected from gastrointestinal dosage forms or non-gastrointestinal dosage forms.
[0040] Preferably, the gastrointestinal dosage form includes at least one of the following: powder, tablet, granule, capsule, sustained-release, solution, dry suspension, effervescent tablet, emulsion, suspension, syrup, drops, and chewable tablet.
[0041] Preferably, the non-gastrointestinal drug delivery dosage form includes at least one of the following: injectable dosage forms (e.g., injections, including various injections such as intravenous injections, intramuscular injections, subcutaneous injections, intradermal injections, and intracavitary injections); respiratory dosage forms (e.g., sprays, aerosols, powder inhalers, etc.); skin dosage forms (e.g., topical solutions, lotions, liniments, ointments, plasters, pastes, patches, etc.); mucosal dosage forms (e.g., eye drops, nasal drops, ophthalmic ointments, mouthwashes, sublingual tablets, adhesive tablets, films, etc.); and cavity dosage forms (e.g., suppositories, aerosols, effervescent tablets, drops, pills, etc., for use in the rectum, vagina, urethra, nasal cavity, ear canal, etc.).
[0042] Preferably, the drugs mentioned in (1) to (3) are oral drugs or injections.
[0043] Preferably, the drugs described in (1) to (3) are administered to animals.
[0044] Preferably, the animals described in (1) to (3) are mammals; further selected from humans, cats, cattle, sheep, pigs, dogs, chickens, ducks, geese, rabbits, and mice; and even further selected from humans.
[0045] Preferably, as an effective ingredient in the prepared drug, the substance described in (1) to (3) has a mass content of 1% to 20% in the drug, more preferably 1% to 10%, for example 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10%.
[0046] Preferably, the in vitro non-therapeutic target inhibition of coronavirus replication is the in vitro non-therapeutic target inhibition of coronavirus replication in cells.
[0047] Preferably, the cells are animal cells; further comprising at least one of L2 cells (when the coronavirus is MHV-A59), HRT-18 cells (when the coronavirus is HCoV-OC43), Huh7 cells (when the coronavirus is HCoV-229E), and Huh7-ACE2 cells (when the coronavirus is HCoV-NL63).
[0048] A second aspect of the present invention provides a method according to any one of (a1) to (a4):
[0049] (a1) A method for preventing and / or treating coronavirus infection, comprising administering an effective amount of a drug to a subject, said drug being the drug in (1) of the first aspect of the present invention;
[0050] (a2) A method for preventing and / or treating disease caused by coronavirus, wherein an effective amount of a drug is administered to a subject, said drug being the drug in (2) of the first aspect of the present invention;
[0051] (a3) A method for improving symptoms caused by coronavirus, comprising administering an effective amount of a drug to a subject, said drug being the drug in (3) of the first aspect of the present invention;
[0052] (a4) A method for inhibiting coronavirus replication in vitro for non-therapeutic purposes, comprising administering an effective amount of an inhibitor to cells, said inhibitor being the in vitro experimental coronavirus replication inhibitor of the first aspect of the present invention (4).
[0053] Preferably, the coronavirus is the coronavirus of the first aspect of the present invention.
[0054] Preferably, the subject described in (a1) to (a3) is an animal; further, a mammal; even further, selected from humans, cats, cattle, sheep, pigs, dogs, chickens, ducks, geese, rabbits, and mice; and even further, humans.
[0055] Preferably, the cells are animal cells; further comprising at least one of L2 cells (when the coronavirus is MHV-A59), HRT-18 cells (when the coronavirus is HCoV-OC43), Huh7 cells (when the coronavirus is HCoV-229E), and Huh7-ACE2 cells (when the coronavirus is HCoV-NL63).
[0056] The beneficial effects of this invention are:
[0057] This invention discloses for the first time the application of one or more of G96-69, G96-70, G102-35, G110-74, G115-49, and G118-1 in the prevention and treatment of coronavirus infection, coronavirus-induced diseases, improvement of coronavirus-induced symptoms, and in vitro non-therapeutic inhibition of coronavirus replication. G96-69, G96-70, G102-35, G110-74, G115-49, and G118-1 show good efficacy against coronaviruses. Among them, G96-69, G96-70, G102-35, G110-74, G115-49, and G118-1 inhibit the extracorporeal exchange rate (ECLOS) of mouse hepatitis virus (MHV). 50 The effective concentrations were 0.96, 0.82, 0.37, 3.94, 5.68, and 2.2 μM, respectively; G96-69 and G96-70 inhibited the EC50 of human coronavirus HCoV-OC43. 50 The concentrations were 1.31 and 0.41 μM, respectively; EC2 inhibitors of human coronavirus HCoV-229E. 50The concentrations were 0.70 and 0.82 μM, respectively; EC2 inhibitory concentrations of human coronavirus HCoV-NL63 were 0.70 and 0.82 μM. 50 The concentrations were 1.54 and 1.44 μM, respectively; and the CC values of G96-69, G96-70, G102-35, G110-74, G115-49, and G118-1 were... 50 Far greater than its EC 50 It has good security. Attached Figure Description
[0058] Figure 1 This is a graph showing the inhibitory effect of different concentrations of G96-69 on the replication of mouse hepatitis virus (MHV).
[0059] Figure 2 This is a graph showing the inhibitory effect of different concentrations of G96-70 on the replication of mouse hepatitis virus (MHV).
[0060] Figure 3 This is a graph showing the inhibitory effect of different concentrations of G102-35 on the replication of mouse hepatitis virus (MHV).
[0061] Figure 4 This is a graph showing the inhibitory effect of different concentrations of G110-74 on the replication of mouse hepatitis virus (MHV).
[0062] Figure 5 This is a graph showing the inhibitory effect of different concentrations of G115-49 on the replication of mouse hepatitis virus (MHV).
[0063] Figure 6 This is a graph showing the inhibitory effect of different concentrations of G118-1 on the replication of mouse hepatitis virus (MHV).
[0064] Figure 7 This is a graph showing the inhibitory effect of different concentrations of G96-69 on the replication of the human coronavirus HCoV-OC43.
[0065] Figure 8 This is a graph showing the inhibitory effect of different concentrations of G96-70 on the replication of the human coronavirus HCoV-OC43.
[0066] Figure 9 This is a graph showing the inhibitory effect of different concentrations of G96-69 on the replication of the human coronavirus HCoV-229E.
[0067] Figure 10 This is a graph showing the inhibitory effect of different concentrations of G96-70 on the replication of the human coronavirus HCoV-229E.
[0068] Figure 11 This is a graph showing the inhibitory effect of different concentrations of G96-69 on the replication of the human coronavirus HCoV-NL63.
[0069] Figure 12 This is a graph showing the inhibitory effect of different concentrations of G96-70 on the replication of the human coronavirus HCoV-NL63.
[0070] Figure 13 This is a graph showing the cell safety test results for G96-69, G96-70, G102-35, G110-74, G115-49, and G118-1. Detailed Implementation
[0071] The present invention will be further described in detail below through specific embodiments.
[0072] It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.
[0073] Experimental methods in the following examples, unless otherwise specified, are generally performed under standard conditions or as recommended by the manufacturer. Unless otherwise specified, the materials and reagents used in these examples are commercially available.
[0074] The present invention will be further described in detail below with reference to specific embodiments. These descriptions are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in commonly used reference books in the field, such as "Molecular Cloning: A Laboratory Manual" (3rd edition, Science Press, 2005), or according to the conditions recommended by the reagent manufacturers.
[0075] The compounds involved in the following examples—G96-69, G96-70, G102-35, G110-74, G115-49, and G118-1—are described in detail below:
[0076] G96-69, its chemical formula is C 19 H 18 N4O, with a molecular weight of 318.37 g / mol, has the chemical name 1-(1H-benzimidazol-2-yl)-3-methyl-4-(3-methylbenzyl)-1H-pyrazol-5-ol (1-(1H-benzimidazol-2-yl)-3-methyl-4-(3-methylbenzyl)-1H-pyrazol-5-ol), CAS number 944788-43-6, and its chemical structural formula is shown in formula (Ⅰ).
[0077] G96-70, its chemical formula is C 19 H 18N4O, with a molecular weight of 318.37 g / mol, has the chemical name 1-(1H-benzimidazol-2-yl)-3-methyl-4-(2-methylbenzyl)-1H-pyrazol-5-ol (1-(1H-benzimidazol-2-yl)-3-methyl-4-(2-methylbenzyl)-1H-pyrazol-5-ol), CAS number 944782-90-5, and its chemical structure is shown in formula (II).
[0078] G102-35, its chemical formula is C 18 H 28 FN3O2S, with a molecular weight of 369.50 g / mol, has the chemical name 1-(4-fluorophenyl)sulfonyl-4-(1-propylpiperidin-4-yl)piperazine (1-(4-fluorophenyl)sulfonyl-4-(1-propylpiperidin-4-yl)piperazine), CAS number 428841-79-6, and its chemical structure is shown in formula (Ⅲ).
[0079] G110-74, its chemical formula is C 15 H 12 FNO2S, with a molecular weight of 289.33 g / mol, has the chemical name Methyl4-(3-fluorobenzyl)-4H-thieno[3,2-B]pyrrole-5-carboxylate (4-(3-fluorobenzyl)-4H-thieno[3,2-B]pyrrole-5-carboxylate), CAS number 902969-63-5, and its chemical structure is shown in formula (Ⅳ).
[0080] G115-49, its chemical formula is C 16 H 21 F3N4O3S2, with a molecular weight of 438.49 g / mol, has the chemical name N-[3-(4-methylpiperazin-1-yl)propyl]-5-[5-(trifluoromethyl)-1,2-oxazol-3-yl]thiophene-2-sulfonamide (N-[3-(4-methylpiperazin-1-yl)propyl]-5-[5-(trifluoromethyl)-1,2-oxazol-3-yl]]thiophene-2-sulfonamide), CAS number 932521-29-4, and its chemical structure is shown in formula (V).
[0081] G118-1, its chemical formula is C 18 H 16N2O2, with a molecular weight of 292.33 g / mol, has the chemical name N-(3-ethylphenyl)-8-hydroxyquinoline-2-carboxamide (N-(3-ethylphenyl)-8-hydroxyquinoline-2-carboxamide), CAS number 933235-08-6, and its chemical structure is shown in formula (VI).
[0082]
[0083]
[0084] The specific source information of the viruses (MHV-A59, HCoV-OC43, HCoV-229E, HCoV-NL63) involved in the following examples is as follows: HCoV-229E, HCoV-NL63, and HCoV-OC43 were donated by Professor Zhao Jincun's team at the State Key Laboratory of Respiratory Diseases in Guangzhou (published in the following literature: Liu, D., Chen, C., Chen, D., Zhu, A., Li, F., Zhuang, Z., Mok, CKP, Dai, J., Li, X., Jin, Y., et al. (2023). Mouse models susceptible to HCoV-229E and HCoV-NL63 and cross protection from challenge with SARS-CoV-2. ProcNatl Acad Sci US A120,e2202820120.10.1073 / pnas.2202820120.;Xie,P.,Fang,Y.,Baloch,Z.,Yu,H.,Zhao,Z.,Li,R.,Zhang,T.,Li,R.,Zhao,J.,Yang,Z.,etal.(2022).AMouse-Adapted Model of HCoV-OC43 and Its Usage to the Evaluation of Antiviral Drugs.Front Miicrobiol 13,845269.10.3389 / fmicb.2022.845269.), Wild-type MHV-A59 was donated by Professor Ye Rong's team at Fudan University (published in the following literature: Ye,R.,Montalto-Morrison,C.,and Masters,PS(2004).Genetic analysis of determinants for spikeglycoprotein assembly into murine coronavirus virions: distinct roles for charge-rich and cysteine-rich regions of the endodomain. J Virol 78,9904-9917.10.1128 / JVI.78.18.9904-9917.2004.).
[0085] Example 1: Detection of the in vitro anti-mouse hepatitis virus (MHV) efficacy of G96-69
[0086] L2 cells were loaded at 2x10 4 Cells were seeded at a density of 100 cells per well in 48-well cell culture plates and cultured in a 5% CO2, 37°C incubator. After the cells had fully adhered, the negative control group, experimental group, and positive control group were inoculated with wild-type mouse hepatitis virus (MHV-A59) at an MOI of 0.05. After 1 hour of infection (the blank control group was not inoculated with wild-type mouse hepatitis virus MHV), the culture medium was changed: the negative control group and blank control group used DMEM complete medium, the experimental group used DMEM complete medium containing G96-69 with final concentrations of 10, 5, 2.5, 1.25, 0.625, and 0.3125 μM, respectively, and the positive control group used DMEM complete medium containing Obeldesivir (ATV006) with a final concentration of 10 μM. After 16 hours of virus infection (i.e., 15 hours of drug treatment), the cell supernatant was collected.
[0087] Viral load (viral copy number) was detected by real-time quantitative polymerase chain reaction (qRT-PCR), as follows: Viral RNA was extracted from cell supernatant, and the obtained RNA was subjected to qRT-PCR. The viral primer and probe sequences are as follows: Upstream primer sequence (MHV-A59-N-FP): GGAACTTCTCGTTGGGCATTATACT, SEQ ID NO:1; Downstream primer sequence (MHV-A59-N-RP): ACCACAAGATTATCATTTTCACAACATA, SEQ ID NO:2; Probe sequence (MHV-A59-N-Prb): ACATGCTACGGCTCGTGTAACCGAACTGT, SEQ ID NO:3, with FAM as the 5' fluorescent group and BHQ1 as the 3' quencher group; The reaction system was Novizan. The II U+One Step qRT-PCR Probe Kit components include: 2×One Step U+Mix: 7.5 μL; One Step U+Enzyme Mix: 0.75 μL; forward and reverse primers: 0.3 μL each (10 μM concentration); probe: 0.15 μL (10 μM concentration); and cell supernatant: 6 μL. The reaction program was: 55℃ for 15 min, 95℃ for 30 s, 95℃ for 10 s, 60℃ for 30 s, for 45 cycles, followed by fluorescence signal acquisition after extension. Each sample was performed in triplicate. The CT values of the samples were then calculated, and the viral copy number was determined by substituting the measured CT values into a standard curve. The inhibition rate (%) was calculated using the formula: (Negative control group - Drug control group (i.e., experimental group or positive control group)) / Negative control group × 100%.
[0088] Plotting the concentration of G96-69 on the x-axis and the inhibition rate on the y-axis, a curve was constructed using the mean and standard deviation of the inhibition efficiency calculated with Graphpad Prism software. The EC50 of G96-69 was then calculated after converting the drug concentration to logarithm. 50 The result is as follows Figure 1 As shown: G96-69 can effectively inhibit the replication of mouse hepatitis virus MHV-A59 in L2 cells (its inhibitory effect at a concentration of 10 μM is comparable to that of Obeldesivir (ATV006)), and its EC50... 50 It is 0.96 μM.
[0089] Example 2: Detection of the in vitro anti-mouse hepatitis virus (MHV) efficacy of G96-70
[0090] The in vitro anti-mouse hepatitis virus (MHV) efficacy detection method of G96-70 is the same as that in Example 1, except that G96-69 in Example 1 is replaced with G96-70.
[0091] The results are as follows Figure 2 As shown: G96-70 can effectively inhibit the replication of mouse hepatitis virus MHV-A59 in L2 cells (its inhibitory effect at a concentration of 10 μM is comparable to that of Obeldesivir (ATV006)), and its EC50... 50 It is 0.82 μM.
[0092] Example 3: Detection of the in vitro anti-mouse hepatitis virus (MHV) efficacy of G102-35
[0093] The method for detecting the in vitro anti-mouse hepatitis virus (MHV) efficacy of G102-35 is the same as in Example 1, except that G96-69 in Example 1 is replaced with G102-35.
[0094] The results are as follows Figure 3 As shown: G102-35 can effectively inhibit the replication of mouse hepatitis virus MHV-A59 in L2 cells, and its EC50... 50 It is 0.37 μM.
[0095] Example 4: Detection of the in vitro anti-mouse hepatitis virus (MHV) efficacy of G110-74
[0096] The in vitro anti-mouse hepatitis virus (MHV) efficacy detection method of G110-74 is the same as that in Example 1, except that G96-69 in Example 1 is replaced with G110-74.
[0097] The results are as follows Figure 4As shown: G110-74 effectively inhibited the replication of mouse hepatitis virus MHV-A59 in L2 cells (its inhibitory effect at a concentration of 10 μM was comparable to that of Obeldesivir (ATV006)), and its EC50... 50 The value is 3.94 μM.
[0098] Example 5: Detection of the in vitro anti-mouse hepatitis virus (MHV) efficacy of G115-49
[0099] The method for detecting the in vitro anti-mouse hepatitis virus (MHV) efficacy of G115-49 is the same as in Example 1, except that G96-69 in Example 1 is replaced with G115-49.
[0100] The results are as follows Figure 5 As shown: G115-49 can effectively inhibit the replication of mouse hepatitis virus MHV-A59 in L2 cells (its inhibitory effect at a concentration of 10 μM is comparable to that of Obeldesivir (ATV006)), and its EC50... 50 It is 5.68 μM.
[0101] Example 6: Detection of the in vitro anti-mouse hepatitis virus (MHV) efficacy of G118-1
[0102] The in vitro anti-mouse hepatitis virus (MHV) efficacy detection method of G118-1 is the same as that in Example 1, except that G96-69 in Example 1 is replaced with G118-1.
[0103] The results are as follows Figure 6 As shown: G118-1 can effectively inhibit the replication of mouse hepatitis virus MHV-A59 in L2 cells (its inhibitory effect at a concentration of 10 μM is comparable to that of Obeldesivir (ATV006)), and its EC50... 50 The value is 2.2 μM.
[0104] Example 7: Detection of the in vitro anti-infection efficacy of G96-69 against human coronavirus HCoV-OC43
[0105] HRT-18 cells were used at a rate of 2 x 10 4Cells were seeded at a density of 100 cells per well in 48-well cell culture plates and cultured in a 5% CO2, 33°C incubator. After the cells had fully adhered, the negative control group, experimental group, and positive control group were inoculated with HCoV-OC43 at an MOI of 0.05. After 2 hours of infection (the blank control group was not inoculated with HCoV-OC43), the culture medium was changed: the negative control group and blank control group used DMEM complete medium, the experimental group used DMEM complete medium containing G96-69 with final concentrations of 10, 5, 2.5, 1.25, 0.625, and 0.3125 μM, respectively, and the positive control group used DMEM complete medium containing Obeldesivir (ATV006) with a final concentration of 10 μM. After 48 hours of viral infection (i.e., 46 hours of drug treatment), the cell supernatant was collected.
[0106] Viral load (viral copy number) was detected by real-time quantitative polymerase chain reaction (qRT-PCR) as follows: Viral RNA was extracted from cell supernatant, and the obtained RNA was subjected to qRT-PCR. The primer and probe sequences for the virus are as follows: Upstream primer sequence (HCoV-OC43-N-FP): TCGCTAGCAACCAGGCTGAT, SEQ ID NO:4; Downstream primer sequence (HCoV-OC43-N-RP): TTGGGTCCCGATCGACAA, SEQ ID NO:5; Probe sequence (HCoV-OC43-N-Prb): CAATACCCCGGCTGAC, SEQ ID NO:6; The 5' fluorescent group was FAM, the 3' quencher group was BHQ1, and the reaction system was Novizan. The II U+One Step qRT-PCR Probe Kit components include: 2×One Step U+Mix: 7.5 μL; One Step U+Enzyme Mix: 0.75 μL; forward and reverse primers: 0.3 μL each (10 μM concentration); probe: 0.15 μL (10 μM concentration); and cell supernatant: 6 μL. The reaction program was: 55℃ for 15 min, 95℃ for 30 s, 95℃ for 10 s, and 60℃ for 30 s, for 45 cycles. Fluorescence signals were acquired after extension. Each sample was performed in triplicate. Finally, the CT values of the samples were calculated, and the viral copy number in the samples was calculated by substituting the measured CT values into the standard curve. The inhibition rate (%) was calculated using the formula: (Negative control group - Drug control group (i.e., experimental group or positive control group)) / Negative control group × 100%.
[0107] Plotting the concentration of G96-69 on the x-axis and the inhibition rate on the y-axis, a curve was constructed using the mean and standard deviation of the inhibition efficiency calculated with Graphpad Prism software. The EC50 of G96-69 was then calculated after converting the drug concentration to logarithm. 50 The result is as follows Figure 7 As shown: G96-69 can effectively inhibit the replication of human-infecting coronavirus HCoV-OC43 in HRT18 cells (its inhibitory effect at a concentration of 10 μM is comparable to that of Obeldesivir (ATV006)), and its EC50... 50 The value is 1.31 μM.
[0108] Example 8: Detection of the in vitro anti-infection efficacy of G96-70 against human coronavirus HCoV-OC43
[0109] The method for detecting the in vitro anti-infective efficacy of G96-70 against human coronavirus HCoV-OC43 is the same as in Example 7, except that G96-69 in Example 7 is replaced with G96-70.
[0110] The results are as follows Figure 8 As shown: G96-70 can effectively inhibit the replication of human-infecting coronavirus HCoV-OC43 in HRT18 cells (its inhibitory effect at a concentration of 10 μM is comparable to that of Obeldesivir (ATV006)), and its EC50... 50 It is 0.41 μM.
[0111] Example 9: Detection of the in vitro anti-infection efficacy of G96-69 against human coronavirus HCoV-229E
[0112] Huh7 cells were used at a rate of 2 x 10 4 Cells were seeded at a density of 100 cells per well in 48-well cell culture plates and cultured in a 5% CO2, 33°C incubator. After the cells had fully adhered, the negative control group, experimental group, and positive control group were inoculated with HCoV-229E at an MOI of 0.05. After 2 hours of infection (the blank control group was not inoculated with HCoV-229E), the culture medium was changed: the negative control group and blank control group used DMEM complete medium, the experimental group used DMEM complete medium containing G96-69 with final concentrations of 10, 5, 2.5, 1.25, 0.625, and 0.3125 μM, respectively, and the positive control group used DMEM complete medium containing Obeldesivir (ATV006) with a final concentration of 10 μM. After 48 hours of viral infection (i.e., 46 hours of drug treatment), the cell supernatant was collected.
[0113] Viral load (viral copy number) was detected by real-time quantitative polymerase chain reaction (qRT-PCR), as follows: Viral RNA was extracted from cell supernatant, and the obtained RNA was subjected to qRT-PCR. The primer and probe sequences for the virus are as follows: Upstream primer sequence (HCoV-229E-N-FP): TGGCACAGGACCCCATAAAG, SEQ ID NO:7; Downstream primer sequence (HCoV-229E-N-RP): CAACCCAGACGACACCTTCA, SEQ ID NO:8; Probe sequence (HCoV-229E-N-Prb): TGCAAAATTTAGAGAGCGTG, SEQ ID NO:9; The 5' fluorescent group was FAM, the 3' quencher group was BHQ1, and the reaction system was Novizan. The II U+One Step qRT-PCR Probe Kit components include: 2×One Step U+Mix: 7.5 μL; One Step U+Enzyme Mix: 0.75 μL; forward and reverse primers: 0.3 μL each (10 μM concentration); probe: 0.15 μL (10 μM concentration); and cell supernatant: 6 μL. The reaction program was: 55℃ for 15 min, 95℃ for 30 s, 95℃ for 10 s, and 60℃ for 30 s, for 45 cycles. Fluorescence signals were acquired after extension. Each sample was performed in triplicate. Finally, the CT values of the samples were calculated, and the viral copy number in the samples was calculated by substituting the measured CT values into the standard curve. The inhibition rate (%) was calculated using the formula: (Negative control group - Drug control group (i.e., experimental group or positive control group)) / Negative control group × 100%.
[0114] Plotting the concentration of G96-69 on the x-axis and the inhibition rate on the y-axis, a curve was constructed using the mean and standard deviation of the inhibition efficiency calculated with Graphpad Prism software. The EC50 of G96-69 was then calculated after converting the drug concentration to logarithm. 50 The result is as follows Figure 9 As shown: G96-69 can effectively inhibit the replication of human-infecting coronavirus HCoV-229E in Huh7 cells (its inhibitory effect at a concentration of 10 μM is comparable to that of Obeldesivir (ATV006)), and its EC50... 50 It is 0.70 μM.
[0115] Example 10G96-70: In vitro anti-infection efficacy against human coronavirus HCoV-229E.
[0116] The method for detecting the inhibitory effect of G96-70 on human coronavirus HCoV-229E is the same as in Example 9, except that G96-69 in Example 9 is replaced with G96-70.
[0117] The results are as follows Figure 10 As shown: G96-70 can effectively inhibit the replication of human-infecting coronavirus HCoV-229E in Huh7 cells (its inhibitory effect at a concentration of 10 μM is comparable to that of Obeldesivir (ATV006)), and its EC50... 50 It is 0.82 μM.
[0118] Example 11: Detection of the in vitro anti-infection efficacy of G96-69 against human coronavirus HCoV-NL63
[0119] Huh7-ACE2 cells (the stable cell line Huh7-ACE2, i.e., Huh7 cells overexpressing ACE2, constructed using conventional methods in the art, specifically by electroporation of pCMV-hACE2 plasmid into Huh7 cells, followed by selection with hygromycin B to obtain ACE2-stable positive cells) were used at 2 x 10⁻⁶ cells / year. 4 Cells were seeded at a density of 100 cells per well in 48-well cell culture plates and cultured in a 5% CO2, 33°C incubator. After the cells had fully adhered, the negative control group, experimental group, and positive control group were inoculated with HCoV-NL63 at an MOI of 0.05. After 2 hours of infection (the blank control group was not inoculated with HCoV-NL63), the culture medium was changed: the negative control group and blank control group used DMEM complete medium, the experimental group used DMEM complete medium containing G96-69 with final concentrations of 10, 5, 2.5, 1.25, 0.625, and 0.3125 μM, respectively, and the positive control group used DMEM complete medium containing Obeldesivir (ATV006) with a final concentration of 10 μM. After 48 hours of viral infection (i.e., 46 hours of drug treatment), the cell supernatant was collected.
[0120] Viral load (viral copy number) was detected by real-time quantitative polymerase chain reaction (qRT-PCR) as follows: Viral RNA was extracted from cell supernatant and subjected to qRT-PCR. The primer and probe sequences for the virus were as follows: upstream primer sequence (HCoV-NL63-N-FP): GTCACCTAGTTCTTCTGGTACTTCCA, SEQ ID NO:10; downstream primer sequence (HCoV-NL63-N-RP): GCTTATCAGCCCTGGGTTGA, SEQ ID NO:11; probe sequence (HCoV-NL63-N-Prb): AGAAACCTAATAAGCCTCTTT, SEQ ID NO:12; the 5' fluorescent group was FAM, the 3' quencher group was BHQ1, and the reaction system was Novizan. The II U+One Step qRT-PCR Probe Kit components include: 2×One Step U+Mix: 7.5 μL; One Step U+Enzyme Mix: 0.75 μL; forward and reverse primers: 0.3 μL each (10 μM concentration); probe: 0.15 μL (10 μM concentration); and cell supernatant: 6 μL. The reaction program was: 55℃ for 15 min, 95℃ for 30 s, 95℃ for 10 s, and 60℃ for 30 s, for 45 cycles. Fluorescence signals were acquired after extension. Each sample was performed in triplicate. Finally, the CT values of the samples were calculated, and the viral copy number in the samples was calculated by substituting the measured CT values into the standard curve. The inhibition rate (%) was calculated using the formula: (Negative control group - Drug control group (i.e., experimental group or positive control group)) / Negative control group × 100%.
[0121] Plotting the concentration of G96-69 on the x-axis and the inhibition rate on the y-axis, a curve was constructed using the mean and standard deviation of the inhibition efficiency calculated with Graphpad Prism software. The EC50 of G96-69 was then calculated after converting the drug concentration to logarithm. 50 The result is as follows Figure 11 As shown: G96-69 can effectively inhibit the replication of human coronavirus HCoV-NL63 in Huh7-ACE2 cells (its inhibitory effect at a concentration of 10 μM is comparable to that of Obeldesivir (ATV006)), and its EC50... 50 The value is 1.54 μM.
[0122] Example 12: Detection of the in vitro anti-infection efficacy of G96-70 against human coronavirus HCoV-NL63
[0123] The method for detecting the inhibitory effect of G96-70 on human coronavirus HCoV-NL63 is the same as in Example 11, except that G96-69 in Example 11 is replaced with G96-70.
[0124] The results are as follows Figure 12 As shown: G96-70 effectively inhibited replication in Huh7-ACE2 cells (its inhibitory effect at a concentration of 10 μM was comparable to that of Obeldesivir (ATV006)), and its EC50... 50 The value is 1.44 μM.
[0125] Example 13: Cell safety testing of G96-69, G96-70, G102-35, G110-74, G115-49, and G118-1
[0126] L2 cells were 1x10 4 Cells were seeded at a density of 100 μL / well in 96-well cell culture plates and incubated in a 5% CO2, 37°C incubator. After complete cell adhesion, sample solutions with different concentration gradients were prepared according to drug concentrations. Approximately 100 μL of the drug-treated cell suspension was added to each well (final drug concentrations were 200, 100, 50, 25, 12.5, 6.25, 3.125, 1.56, 0.78, and 0.39 μM, with three replicates for each concentration; blank wells and negative control wells contained no drug or cells compared to the experimental wells). Cells were cultured for another 48 hours, and 10 μL of CCK8 was added to each well. The color change of Formazan was observed after 1.5 hours, and the absorbance was measured at 450 nm using a microplate reader. The results were processed and analyzed using Excel and Graphpad Prism. The experimental results were calculated using the formula: Cell viability = [(experimental wells - blank wells) / (negative control wells - blank wells)] × 100%.
[0127] The results are as follows Figure 13 As shown: CC of G96-69 and G96-70 50 The CC values for G115-49 were 90.27 μM and 126.2 μM, respectively. 50 The CC values for G102-35, G110-74, and G118-1 were 96.91 μM. 50 All are greater than 200 μM; it can be seen that the CC of G96-69, G96-70, G102-35, G110-74, G115-49 and G118-1 are... 50 Far greater than its EC 50 It has good security.
[0128] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. The application of the substance in any one of (1) to (5); The substance comprises A and / or a pharmaceutically acceptable salt thereof, wherein A is selected from any one of B, wherein B is: G96-69, G96-70, G102-35, G110-74, G115-49, and G118-1; The chemical structural formulas of G96-69, G96-70, G102-35, G110-74, G115-49, and G118-1 are shown in formulas (Ⅰ), (Ⅱ), (Ⅲ), (Ⅳ), (Ⅴ), and (Ⅵ), respectively: (1) To prepare drugs for the prevention and / or treatment of coronavirus infection; (2) To prepare medicines for the prevention and / or treatment of diseases caused by coronaviruses; (3) To prepare drugs to improve symptoms caused by coronavirus; (4) Preparation of coronavirus replication inhibitors for in vitro experiments; (5) In vitro non-therapeutic target inhibition of coronavirus replication.
2. The application according to claim 1, characterized in that: The coronaviruses described in (1) to (5) include viruses of the Orthocoronavirus subfamily; Preferably, the viruses of the Orthocoronavirus subfamily include viruses of the genus α-coronavirus, β-coronavirus, γ-coronavirus, and / or δ-coronavirus. Preferably, the coronaviruses described in (1) to (5) include one or more of the following: coronaviruses that cause upper respiratory tract infections, coronaviruses that cause lower respiratory tract infections, coronaviruses that cause digestive tract infections, and coronaviruses that cause acute respiratory syndrome; more preferably, coronaviruses that cause upper respiratory tract infections. Preferably, the coronavirus causing upper respiratory tract infection comprises human coronavirus and / or mouse hepatitis virus; Preferably, the coronavirus causing lower respiratory tract infection comprises avian infectious bronchitis virus; Preferably, the coronavirus causing gastrointestinal infection includes at least one of porcine transmissible gastroenteritis virus, porcine epidemic diarrhea virus, porcine type D coronavirus, and feline infectious peritonitis virus; Preferably, the coronavirus causing acute respiratory syndrome includes at least one of SARS-related coronaviruses and Middle East respiratory syndrome coronaviruses; Preferably, the SARS-related coronavirus includes at least one of SARS-CoV-1 and SARS-CoV-2.
3. The application according to any one of claims 1 to 2, characterized in that: The substance also contains C and / or its pharmaceutically acceptable salts; The C comprises at least one of the B, and the compound in the C is different from the compound in the A.
4. The application according to any one of claims 1 to 3, characterized in that: The drug described in (1) also contains other active ingredients for the prevention and / or treatment of coronavirus infection; or (2) The drug described also contains other active ingredients for the prevention and / or treatment of diseases caused by coronaviruses; or The drug described in (3) also contains other active ingredients that improve symptoms caused by coronavirus; or The in vitro coronavirus replication inhibitor described in (4) also contains other active ingredients that inhibit coronavirus replication.
5. The application according to any one of claims 1 to 4, characterized in that: The drugs described in (1) to (3) also contain pharmaceutically acceptable excipients; Preferably, the pharmaceutically acceptable excipients include at least one of diluents, excipients, binders, humectants, surfactants, lubricants, and disintegrants.
6. The application according to any one of claims 1 to 5, characterized in that: The dosage forms of the drugs mentioned in (1) to (3) are dosage forms suitable for children or dosage forms suitable for adults.
7. The application according to claim 6, characterized in that: The dosage form is selected from gastrointestinal dosage forms or non-gastrointestinal dosage forms; Preferably, the gastrointestinal dosage form includes at least one of the following: powder, tablet, granule, capsule, sustained-release, solution, dry suspension, effervescent tablet, emulsion, suspension, syrup, drops, and chewable tablet; Preferably, the non-gastrointestinal dosage form includes at least one of the following: injectable dosage form, respiratory dosage form, skin dosage form, mucosal dosage form, and cavity dosage form.
8. The application according to claim 7, characterized in that: The drugs mentioned in (1) to (3) are oral drugs or injections.
9. The application according to any one of claims 1 to 5, characterized in that: The drugs described in (1) to (3) are administered to animals; Preferably, the animal is a mammal; further selected from humans, cats, cattle, sheep, pigs, dogs, chickens, ducks, geese, rabbits, and mice; and even further selected from humans.
10. The application according to any one of claims 1 to 5, characterized in that: The mass content of the substances mentioned in (1) to (3) in the drug is 1% to 20%.
Citation Information
Patent Citations
Application of phenazopyridine to preparation of broad-spectrum anti-coronavirus medicine
CN108324715A
Application of mycophenolic acid and its derivative mycophenolate mofetil in preparation of broad-spectrum anti-coronavirus drugs
CN108478562A
Application of lycorine in preparation of broad-spectrum anti-coronavirus drugs
CN108478571A
Application of monensin in preparation of broad-spectrum anti-coronavirus drugs
CN108721271A
Application of PP (pyrvinium pamoate) in preparation of broad-spectrum anti-CoV (coronavirus) drug
CN108721292A
Cited By
Application of monensin in preparation of anti-coronavirus drugs
CN121337790A