SiRNA (small interfering ribonucleic acid) functionalized tetrahedral framework nucleic acid composite material as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to a tetrahedral framework nucleic acid combined with siRNA related to a silent NF-kappa Bp65 gene as well as a preparation method and application of the tetrahedral framework nucleic acid. The invention combines the strong cell membrane permeability of tetrahedral framework nucleic acid and the gene targeting specificity of siRNA-NF-kappa Bp65, and provides a tetrahedral framework nucleic acid system combined with siRNA related to silent NF-kappa Bp65 gene, and the system can effectively and continuously down-regulate the expression of NF-kappa Bp65, so that the expression of the siRNA related to silent NF-kappa Bp65 can be effectively and continuously regulated by inhibiting Wnt / beta-catenin, and the expression of siRNA related to silent NF-kappa Bp65 can be effectively and continuously regulated. And the NRF2 / heme oxygenase-1 (HO-1) pathway is up-regulated to inhibit the joint inflammation and promote the repair of the articular cartilage. The delivery system provided by the invention has a more excellent treatment effect in treatment of temporomandibular arthritis, and is expected to become a new way for treatment of temporomandibular arthritis.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to an siRNA-functionalized tetrahedral framework nucleic acid composite material, its preparation method, and its uses. Background Technology

[0002] Temporomandibular joint (TMJ) disorders are among the most common degenerative diseases, with a high male-to-female ratio (2:1), affecting approximately 5-12% of the global population. They are characterized by inflammation, cartilage degeneration, subchondral bone remodeling, chronic joint pain, and functional impairment. Ideally, successful treatment of TMJ should not only reduce or eliminate joint pain but also slow or reverse the loss of condylar cartilage. Current treatments in this regard are unsatisfactory. For example, while nonsteroidal anti-inflammatory drugs (NSAIDs) and intra-articular hyaluronic acid injections can reduce pain and inflammation and improve quality of life, these measures are not very effective and lack specificity, failing to prevent further inflammation. However, the recently emerging gene therapy offers a way to overcome this limitation. One of the target genes for TMJ treatment is nuclear factor κB (NF-κB).

[0003] The NF-κB signaling pathway is a crucial signaling pathway involved in regulating inflammatory responses, immune responses, cell proliferation, and other biological processes. Studies have shown that the NF-κB signaling pathway plays a vital role in the pathogenesis of temporomandibular joint (TMJ) osteoarthritis, serving as a key initiating factor. NF-κB is a transcription factor involved in inflammation and immune activation, and it can be activated by oxidants and cytokines, such as IL-1β and TNF-α, which play important roles in the occurrence and development of OA. Simultaneously, activation of the NF-κB signaling pathway can also promote the production of inflammatory factors such as MMP-1 and MMP-13, as well as the expression of inflammatory stimuli such as IL-1, IL-6, and TNF-α, further exacerbating the production of inflammatory factors. During inflammation, the NF-κB signaling pathway overlaps and crosstalks with multiple signaling pathways related to TMJ development. Therefore, targeted regulation of the NF-κB pathway may be a novel strategy for treating TMJ. However, the specific mechanisms of action and efficacy of NF-κB pathway therapy in treating TMJ require further investigation and validation.

[0004] RNA interference (RNAi) was first discovered by Andrew Fire et al. in 1998. Small interfering RNAs (siRNAs), as a gene-targeting therapy tool, possess extremely high specificity and potent efficacy. siRNAs can induce RNAi silencing in mammalian cells without triggering a non-specific interferon response. They form a cytoplasmic RNA-induced silencing complex (RNA RISC) together with Argonaute proteins. This silencing complex binds to the 3′ untranslated region of the siRNA-targeted mRNA, inhibiting the translation of the target protein and epigenetically regulating the gene of interest. After their discovery, these siRNAs quickly became a popular tool in biological research. However, due to the inherent limitations of siRNAs, such as low targeting specificity, susceptibility to enzymatic degradation under physiological conditions, structural instability, and inability to penetrate cell membranes, the therapeutic potential of this method remains limited, and its clinical application is unclear.

[0005] Tetrahedral DNA nanostructures (tFNAs) are a class of nucleic acid drugs that are synthesized through self-assembly based on the Watson-Crick base pairing rule, forming a DNA nanostructure with a tetrahedral spatial shape. They are renowned for their excellent structural stability, resistance to enzymatic degradation, and cell membrane permeability, enabling them to carry various small molecule drugs, peptides, RNA, and metals for convenient transport. Furthermore, tFNAs possess a variety of biological functions both in vitro and in vivo, such as anti-inflammatory and antioxidant activities, and the ability to promote cell proliferation.

[0006] In summary, the use of siRNAs associated with silencing the NF-κBp65 gene as drugs still faces challenges such as stability and cell membrane penetration. Therefore, there is an urgent need in the field to develop new drug delivery systems for this siRNA. Currently, there are no published reports on the application of tFNA in drug delivery within siRNAs. Summary of the Invention

[0007] To address the problems of existing technologies, this invention provides a tetrahedral framework nucleic acid that binds to siRNA associated with the silencing NF-κBp65 gene, its preparation method, and its uses.

[0008] A functionalized tetrahedral framework nucleic acid, characterized in that: the functionalized tetrahedral framework nucleic acid is modified with siRNA-NF-κB p65.

[0009] Preferably, it involves combining four single-stranded DNA strands with sticky ends with the sticky ends of siRNA-NF-κB p65 to form a DNA-siRNA chain, and assembling the four DNA-siRNA chains through complementary base pairing.

[0010] Preferably, the four single-stranded DNA nucleotide sequences are as shown in SEQ ID NO.1-SEQ ID NO.4;

[0011] And / or, the sense strand of siRNA-NF-κB p65 is a nucleotide sequence shown in SEQ ID NO.5 containing two deoxythymidine nucleotides at the 3' end.

[0012] The present invention also provides a method for preparing the above-mentioned functionalized tetrahedral framework nucleic acid, characterized by comprising the following steps: mixing siRNA-NF-κB p65 and 4 pre-designed single-stranded DNAs, incubating, and thus obtaining the product.

[0013] The present invention also provides the use of the above-described functionalized tetrahedral framework nucleic acid in the treatment of temporomandibular joint arthritis.

[0014] Preferably, the drug is used to protect chondrocytes;

[0015] Preferably, the drug is used to reduce cellular oxidative stress;

[0016] Preferably, the drug is used to promote cartilage matrix formation;

[0017] Preferably, the drug is used to significantly reduce the occurrence of osteoarthritis by inhibiting chondrocyte apoptosis, smoothing the cartilage surface, inhibiting extracellular matrix degradation, and increasing synovial thickness.

[0018] The present invention also provides a drug for treating temporomandibular joint arthritis, which is made by adding pharmaceutically acceptable excipients to the above-mentioned functionalized tetrahedral framework nucleic acid as the active ingredient.

[0019] To improve current strategies for treating temporomandibular joint arthritis (TMJ), this invention designs a tetrahedral framework nucleic acid (Tsi) system that binds to siRNA associated with the silencing NF-κBp65 gene. Tsi combines the potent cell membrane permeability of TDN with the gene-targeting specificity of siRNA-NF-κBp65. Tsi effectively and continuously downregulates NF-κBp65 expression, thereby inhibiting joint inflammation and promoting articular cartilage repair by suppressing Wnt / β-catenin and upregulating the NRF2 / heme oxygenase-1 (HO-1) pathway, thus providing more precise treatment for TMS.

[0020] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.

[0021] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description

[0022] Figure 1 Synthesis and characterization of Tsi nanostructures. (A) Schematic diagram of the Tsi synthesis process. (B) Verification of the stepwise loading process of Tsi. (C) Transmission electron microscopy (TEM) image of Tsi (scale, 50 nm; magnification: scale, 25 nm). (D) Atomic force microscopy (AFM) image (scale, 50 nm; magnification: scale, 25 nm). (E) Zeta potentials of tFNA and Tsi. (F) Particle sizes of tFNA and Tsi. (G) Stability of Tsi at 37 °C for 0, 2, 4, 6, 8, 10, 12, and 24 hours in 2% FBS and lysis buffer. (H, I) Flow cytometry analysis of chondrocyte uptake characteristics of siRNA, tFNA, and Tsi after 12 and 24 hours of incubation. (J) The uptake characteristics of Cy5-labeled siRNA, tFNA, and Tsi in chondrocytes after 12 and 24 hours of incubation were detected by confocal microscopy (red: Cy5; blue: nucleus; green: cytoskeleton. Scale: 20 μm).

[0023] Figure 2 (A) Scratch assay to detect the effects of siRNA, tFNA, and Tsi alone on the proliferation and migration of rat chondrocytes. Tsi showed a good effect on promoting cell migration (scale bar: 200 μm). (B) Protein expression levels of NF-κB p65, NF-κB p-p65, IκB-α, and β-catenin. Imprinting lanes: 1. Control group; 2. IL-1β group; 3. IL-1β + siRNA group (si); 4. IL-1β + TDN group (T); 5. IL-1β + Tsi group (Tsi).

[0024] Figure 3 The relative mRNA levels of NF-κB p65 at 1 day and 3 days after different treatment conditions. Quantitative statistics of scratch assay and CCK8 assay. Quantitative analysis of apoptotic and necrotic chondrocytes after different treatment conditions.

[0025] Figure 4 To evaluate apoptotic chondrocytes under different treatment conditions using flow cytometry.

[0026] Figure 5This study aimed to quantitatively analyze the protein expression levels of NF-κB p65, NF-κB p-p65, IκB-α, and β-catenin in Western blotting experiments.

[0027] Figure 6 This study aimed to quantitatively analyze NF-κB p65, NF-κB p-p65, IκB-α, and β-catenin in cellular immunofluorescence assays.

[0028] Figure 7 Immunofluorescence staining images and three-dimensional statistical plots of NF-κB p65, NF-κB p-p65, IκB-α, and β-catenin expression in chondrocytes after different treatments. (Red: detected proteins; blue: cell nucleus; green: cytoskeleton. Scale bar: 20 μm).

[0029] Figure 8 The protein expression levels of IL-1β, TNF-α, iNOS, NRF2, and HO-1 were measured. Imprinting lanes: 1. Control group; 2. IL-1β group; 3. IL-1β + siRNA group (si); 4. IL-1β + TDN group (T); 5. IL-1β + Tsi group (Tsi) and semi-quantitative analysis.

[0030] Figure 9 This is a schematic diagram illustrating how Tsi silences NF-κB in chondrocytes and acts on the wnt / β-catenin and Nrf2 / HO-1 pathways.

[0031] Figure 10 ROS levels in chondrocytes under different treatments were determined using fluorescence microscopy (blue: nucleus; green: ROS. Scale bar: 100 μm).

[0032] Figure 11 Heatmap of relative mRNA expression levels of IL-1β, TNF-α, iNOS, NRF2, and HO-1.

[0033] Figure 12 This study aimed to quantitatively analyze the relative fluorescence intensity of intracellular TNF-α, iNOS, NRF2, and HO-1.

[0034] Figure 13 Immunofluorescence staining images and three-dimensional statistical plots of TNF-α, iNOS, NRF2, and HO-1 expression in chondrocytes after different treatments. (Red: detected proteins; blue: cell nucleus; green: cytoskeleton. Scale bar: 20 μm).

[0035] Figure 14The protein expression levels and semi-quantitative analysis of MMP3 / 9 / 13, SOX-9, PCNA, and collage II were performed. Imprint lanes: 1. Control group; 2. IL-1β group; 3. IL-1β + siRNA group (si); 4. IL-1β + TDN group (T); 5. IL-1β + Tsi group (Tsi).

[0036] Figure 15 This is a schematic diagram illustrating the interaction of Tsi with inflammatory factors, matrix metalloproteinases, etc. in chondrocytes.

[0037] Figure 16 Heatmap showing the relative mRNA expression levels of MMP3 / 9 / 13, SOX-9, PCNA, and collagen.

[0038] Figure 17 This study provides a semi-quantitative analysis of the relative fluorescence intensity of MMP13, SOX-9, PCNA, and collagen II expression in cellular immunofluorescence.

[0039] Figure 18 Immunofluorescence staining images and three-dimensional statistical plots of MMP13, SOX-9, PCNA, and collagen II expression in chondrocytes after different treatments. (Red: detected proteins; blue: cell nucleus; green: cytoskeleton. Scale bar: 20 μm)

[0040] Figure 19 This diagram illustrates the method and timing of drug injection into the body, along with the animal sample collection time.

[0041] Figure 20 3D reconstructions of the subchondral bone region of the temporomandibular joint in rats after different treatments at 4 and 8 weeks.

[0042] Figure 21 Quantitative analysis of trabecular bone parameters (relative bone volume (BV / TV), trabecular thickness (Tb.Th), trabecular number (Tb.N), and trabecular space (Tb.Sp)) in the subchondral bone region of the temporomandibular joint of rats after different treatments at 4 and 8 weeks.

[0043] Figure 22 To observe the distribution and metabolism of Cy5-labeled siRNA after intra-articular injection of simple siRNA and Tsi in rats with TMJOA or normal rats at 0, 15, 30, 45, 60, 90, 120, and 180 min, we investigated the effects of injection of siRNA and Tsi alone into the joint cavity of rats with TMJOA or normal rats.

[0044] Figure 23Images of the temporomandibular joint of rats stained with HE, Masson, Safranin O, and Col-II at 4 and 8 weeks after different treatment groups (scale bar: 200 μm). Quantitative statistical analysis of articular cartilage thickness using OARIS and Mankin scores.

[0045] Figure 24 Images of NF-κB, TNF-α, PCNA, and Tunel staining in the temporomandibular joint of rats at 4 and 8 weeks after different treatment groups (scale bar: 200 μm) and quantitative statistics.

[0046] Data are expressed as mean ± standard deviation (SD) (n = 3). Statistical analysis: one-tailed < 0.05, two-tailed < 0.01, three-tailed < 0.001. * indicates "compared with the IL-1β group", # indicates "compared with the Tsi group". Detailed Implementation

[0047] In the following examples and experimental cases, reagents and raw materials not specifically described are all commercially available products.

[0048] Example 1: Functionalized tetrahedral framework nucleic acid and its preparation method

[0049] This embodiment provides a tetrahedral framework nucleic acid system, Tsi, that binds to siRNA associated with the silencing NF-κBp65 gene. It is assembled by binding four pre-designed ssDNA sequences (sS1, sS2, sS3, sS4) with sticky DNA ends to the sticky ends of siRNA-NF-κB p65 based on base complementarity.

[0050] The single-stranded DNA sS1 nucleotide sequence is shown in SEQ ID NO.1: TTGACCTGTGAATTATTTATCACCCGCCATAGTAGACGTATCACCAGGC AGTTGAGACGAACATTCCTAAGTCTGAA;

[0051] The nucleotide sequence of the single-stranded DNA sS2 is shown in SEQ ID NO.2:

[0052] TTGACCTGTGAATTACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG;

[0053] The nucleotide sequence of the single-stranded DNA sS3 is shown in SEQ ID NO.3:

[0054] TTGACCTGTGAATTACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC;

[0055] The nucleotide sequence of the single-stranded DNA sS4 is shown in SEQ ID NO.4:

[0056] TTGACCTGTGAATTACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG;

[0057] The siRNA-NF-κB p65 nucleotide sequence is as follows:

[0058] SEQ ID NO.5: sense(5'-3')GCGACAAGGUGCAGAAAGAdTdT; SEQ ID NO.6: antisense(5'-3')UCUUUCUGCACCUUGUCGCdTdT.

[0059] The preparation method is as follows: Four specially designed ssDNAs (S1, S2, sS3, S4) were added to TM buffer (10 mM Tris base, 50 mM MgCl2, pH 8.0) at equimolar concentrations. After vortex centrifugation, the mixture was heated to 95°C for 10 minutes and cooled to 4°C for 20 minutes in a thermal cycler. The ssDNA then self-assembled into tFNA according to the base pairing principle. Then, siRNA and tFNA (molar ratio 1:1) were mixed and incubated at 37°C for 1 hour to prepare TsiRNA. Figure 1 A).

[0060] Comparative Example 1

[0061] This comparative example provides the control sample used in the experiment:

[0062] 1. tFNA

[0063] This sample was assembled from four pre-designed ssDNAs (sS1, sS2, sS3, and sS4) that were not bound to siRNA-NF-κB p65, based on base complementarity. The preparation method was the same as in Example 1.

[0064] The single-stranded DNA sS1 nucleotide sequence is shown in SEQ ID NO.1: TTGACCTGTGAATTATTTATCACCCGCCATAGTAGACGTATCACCAGGC AGTTGAGACGAACATTCCTAAGTCTGAA

[0065] The nucleotide sequence of the single-stranded DNA sS2 is shown in SEQ ID NO.2:

[0066] TTGACCTGTGAATTACATGCGAGGGTCCAATACCGACGATTACAGCTTG

[0067] CTACACGATTCAGACTTAGGAATGTTCG

[0068] The single-stranded DNA sS3 nucleotide sequence is shown in SEQ ID NO.3:

[0069] TTGACCTGTGAATTACTACTATGGCGGGTGATAAAACGTGTAGCAAGCT

[0070] GTAATCGACGGGAAGAGCATGCCCATCC

[0071] The nucleotide sequence of the single-stranded DNA sS4 is shown in SEQ ID NO.4:

[0072] TTGACCTGTGAATTACGGTATTGGACCCTCGCATGACTCAACTGCCTGG

[0073] TGATACGAGGATGGGCATGCTCTTCCCG

[0074] 2. siRNA

[0075] This sample contains siRNA that silences the NF-κBp65 gene.

[0076] The nucleotide sequence of siRNA-NF-κB p65 is as follows:

[0077] SEQ ID NO.5: sense(5'-3')GCGACAAGGUGCAGAAAGAdTdT;

[0078] SEQ ID NO.6: antisense(5'-3')UCUUUCUGCACCUUGUCGCdTdT.

[0079] The technical solution of the present invention will be further explained through experiments below.

[0080] Example 1: Characterization of Tsi nanostructures

[0081] This experimental example characterizes the Tsi nanostructure prepared in Example 1. tFNA and siRNA were prepared according to Comparative Example 1 and Comparative Example 2.

[0082] I. Experimental Methods

[0083] The successful preparation of tFNA and Tsi was confirmed by GelRed-stained agarose gel electrophoresis (2%) (120V, 30min) and high-performance capillary electrophoresis (HPCE). The morphology and size of the tFNA and Tsi nanomaterials were examined using atomic force microscopy (AFM) (Shimadzu, Kyoto, Japan) and transmission electron microscopy (TEM) (HT770, Hitachi, Japan). The size and zeta potential of the tFNA and Tsi nanostructures were measured in a Zetasizer Nano (ZS90, Malvern, UK). Cell membrane permeability of Tsi was assessed using immunofluorescence and flow cytometry. The cells were grouped into Control (C), siRNA (Si), tFNA (T), and Tsi groups. The Control group received no special treatment. The concentrations of siRNA, tFNA, and Tsi in cell treatment were all 250 nM.

[0084] II. Experimental Results

[0085] As shown in the gel image, to visually confirm the synthesis of Tsi, siR was labeled with Cy5. Co-localization of Cy5 fluorescence (red) and tFNA fluorescence (blue) confirmed that siR was successfully loaded onto tFNA, resulting in a purple (…). Figure 1 B). Transmission electron microscopy (TEM) and atomic force microscopy (AFM) were used to observe the synthesized Tsi, revealing a tetrahedral structure with sharp edges and uniform distribution in solution. Figure 1 C, D). The zeta potential and particle size of tFNA and Tsi were determined by dynamic light scattering (DLS) measurements. Figure 1 E, F), tFNA and Tsi are all negatively charged, with zeta potentials of -7.72±3.97mV and -11.84±0.51mV, respectively, and sizes of 8.31±0.81nm and 12.35±0.89nm, respectively. They all exhibit small size and negative charge, which ensures the cell's efficient uptake of them.

[0086] Tsi was incubated in 2% serum to simulate the serum concentration of Tsi used in subsequent in vitro experiments, and the degree of siRNA degradation was determined based on its fluorescence intensity. Figure 1 (G). The results showed that Tsi maintained a strong fluorescent band at 24 h, exhibiting good structural stability. In conclusion, Tsi has a protective effect against siRNA degradation, laying the foundation for the effective delivery of siRNA to cells to achieve gene silencing.

[0087] Cell membrane permeability of Tsi was assessed (12 and 24 hours) using immunofluorescence and flow cytometry. Under confocal microscopy, almost no fluorescence was observed in the siRNA group at both 12 and 24 hours. Figure 1 J), chondrocytes showed extremely poor cellular uptake of siRNA alone. However, tFNA (250 nM) and Tsi (250 nM) exhibited significant endocytosis. Flow cytometry also confirmed that Tsi significantly enhanced cellular uptake of siRNA in a time-dependent manner, with uptake rates of 44.4% and 78.5% at 12 h and 24 h, respectively, far exceeding the 24.1% and 48.6% in the siRNA-only group. Figure 1 H, I).

[0088] The above experimental results demonstrate the outstanding ability of Tsi nanostructures as siRNA therapeutic carriers, showing great potential in maintaining siRNA stability and enhancing its cellular uptake capacity.

[0089] Experiment 2 investigated the therapeutic effect and regulatory mechanism of Tsi on temporomandibular joint arthritis in vitro.

[0090] The siRNA, tFNA, and Tsi samples used in this experiment were prepared according to the methods of Comparative Example 2, Comparative Example 1, and Example 1. The experimental groups were Ctrl group (C), model group (OA, IL-1β, or TMJOA groups in the figure can all represent the model group), siRNA group (Si), tFNA group (T), and Tsi group (T-si).

[0091] I. Experimental Methods

[0092] 1. Extraction and culture of temporomandibular joint chondrocytes

[0093] All procedures strictly adhered to ethical guidelines and were reviewed and approved by the Institutional Review Committee of Sichuan University. Chondrocytes were extracted from the temporomandibular joint cartilage of neonatal Sprague-Dawley rats. After shearing the articular cartilage, the tissue was washed three times with phosphate-buffered saline (PBS) and digested for 30 min at 37°C with 0.25% (w / v) EDTA-containing trypsin, followed by digestion for 2 h at 37°C with 0.2% (w / v) type II collagenase. The cartilage tissue fragments were centrifuged (1000 rpm, 10 min) and resuspended in freshly prepared DMEM medium. All cell cultures were conducted in T25 flasks in a cell culture incubator (5% CO2, 37°C), using chondrocytes from passage 1 to passage 4 (CH cells).

[0094] 2. CCK8

[0095] Cells were seeded in 96-well plates and then stimulated with 250 nM siRNA, tFNAs, or Tsi for 24 h under inflammatory conditions. Cell viability was assessed by measuring the OD value at 450 nm after incubation with CCK-8 solution for 90 min.

[0096] 3. IL-1β-induced in vitro temporomandibular inflammation model and grouping

[0097] Chondrocytes were stimulated with 10 ng / ml interleukin (IL-1β) for 24 hours. Following inflammatory stimulation, in the treatment group, cells were starved for 2 hours with 2% FBS. Then, rat chondrocytes were treated with 250 nM siRNA, tFNA, or Tsi for 24 hours. In the control group, chondrocytes received no treatment.

[0098] 4. Uptake of siRNA, tFNAs, or Tsi by chondrocytes.

[0099] Chondrocytes seeded on confocal culture dishes were cultured with IL-1β for 24 hours to induce an in vitro inflammation model, while normal chondrocytes were left untreated. Chondrocytes from each group were treated according to the above method. After washing with PBS, the chondrocytes were digested with trypsin without EDTA and collected by centrifugation. Flow cytometry (CytoFlex, Beckman Coulter, USA) was used to detect the uptake of siRNA, tFNAs, or Tsi by the cells. Chondrocytes treated with each group were fixed with 4% paraformaldehyde, and the nuclei were stained with DAPI, while the cytoplasm was stained with FITC-labeled phalloidin. Observation was then performed directly under a confocal microscope (Olympus, FV3000, Japan).

[0100] 5. Scratch closure test

[0101] 6. RT-Qpcr

[0102] 7. Western blot experiment

[0103] 8. Cellular immunofluorescence

[0104] 9. ROS detection and determination

[0105] A reactive oxygen species (ROS) assay kit (Beyotime, S0033S, China) was used to measure IL-1β-induced ROS levels. Cells were incubated with DCFH-DA solution (1:1000) for 20 min and Hoechst 33342 solution (1:1000) for 10 min. Intracellular ROS images were captured using fluorescence microscopy.

[0106] 10. Flow cytometry was used to observe the effects of each group of drugs on chondrocytes.

[0107] II. Experimental Results

[0108] 1. Tsi inhibits inflammation, promotes cell proliferation, and has anti-apoptotic effects by silencing NF-κB p65.

[0109] Scratch closure assay results showed that the proliferation of CH cells was inhibited in the presence of IL-1β. The improvement effect of siRNA alone was minimal compared to the IL-1β group. However, in the Tsi group, CH cell closure reached nearly twice that of the IL-1β group at 6 and 12 hours after scratching. Even at 24 hours, the improvement effect was still significant, greatly promoting chondrocyte proliferation and migration. Figure 2 A).

[0110] Western blot experiments also demonstrated that IL-1β stimulation significantly upregulated the expression of NF-κB p65 and NF-κB p-p65 in chondrocytes, while significantly decreasing IκB-α, leading to increased inflammation. Both tFNA and Tsi significantly downregulated the expression of NF-κB and its phosphorylated products, and upregulated IκB-α, with Tsi showing the most significant effect. Figure 2 B Figure 5 Cellular immunofluorescence ( Figure 6 , Figure 7 This trend was also confirmed. This result further confirms that Tsi, through efficient cell entry and accurate gene silencing, provides superior siRNA delivery and protection, reversing the activation effect of IL-1β stimulation on NF-κB and its downstream pathways.

[0111] In Western blot experiments, IL-1β-induced β-catenin expression was significantly enhanced in chondrocytes compared to the control group. tFNA and Tsi reduced β-catenin expression levels in chondrocytes, consistent with the effect of NF-κB silencing, with Tsi showing the most significant effect. These results indicate that Tsi can also protect chondrocytes by inhibiting the Wnt / β-catenin signaling pathway. Figure 2 B)

[0112] The CCK-8 assay was used to evaluate the effects of siRNA, tFNA, and Tsi (250 nM) on chondrocyte viability. Results showed that tFNA and Tsi slightly enhanced IL-1β-damaged chondrocyte proliferation. Figure 3RT-QPCR was used to detect the silencing efficiency of siRNA and Tsi alone on NF-κBp65 signaling. Results showed that on day 1, under inflammatory conditions, NF-κB gene expression increased 10-fold to the non-inflammatory control group. Treatment with siRNA alone reduced target gene expression to 4.5-fold of the control group, while treatment with Tsi reduced it to 2.5-fold, significantly lower than the expression level in the OA inflammatory group. After 3 days, the target gene expression in the siRNA-containing treatment was approximately 4.5-fold higher than the control group. However, NF-κB in the Tsi-transfected group remained at a low level. This demonstrates the sustained effect of the Tsi system on siRNA-carrying cells and its good target gene silencing effect. Figure 3 ).

[0113] Flow cytometry results showed that, under conditions where IL-1β significantly promoted chondrocyte apoptosis, siRNA alone only had a certain protective effect against chondrocyte apoptosis. However, tFNA and Tsi were more effective in inhibiting chondrocyte apoptosis, with Tsi exhibiting the strongest inhibitory effect. Figure 4 ).

[0114] The above experimental results demonstrate that Tsi treats temporomandibular joint inflammation by silencing NF-κB p65 to inhibit inflammation, promote cell proliferation and anti-apoptosis, and inhibit the Wnt / β-catenin signaling pathway to protect chondrocytes.

[0115] 2. Tsi promotes the NRF2 / OH-1 pathway, reduces ROS, and decreases cellular oxidative stress.

[0116] The expression of NRF2 and HO-1 in IL-1β-stimulated rat chondrocytes was detected by Western blotting and immunofluorescence. The results are as follows: Figure 8 As shown, under IL-1β stimulation, Tsi treatment significantly increased the protein levels of NRF2 and HO-1, and tFNA also significantly increased the expression of NRF2 and HO-1. Under IL-1β stimulation, TNF-α and IL-1β levels in chondrocytes were greatly increased, and iNOS also increased significantly. tFNA treatment significantly downregulated the expression levels of these inflammatory factors in chondrocytes. After siRNA treatment, the expression levels of TNF-α and iNOS were consistent with those in the tFNA group, but the downregulation of IL-1β was not very significant. Tsi showed a very significant effect, reaching or even lower than the control group levels. Immunofluorescence was used to detect intracellular ROS levels (…). Figure 10 ), compared with untreated chondrocytes as a control. Compared with the control group, IL-1β treatment significantly upregulated ROS production in chondrocytes; in contrast, tFNA and Tsi treatment significantly reduced ROS production, with Tsi showing the strongest effect. Immunofluorescence and gene quantification also confirmed this trend. Figure 11-13 Therefore, Tsi has an antioxidant effect.

[0117] The above experimental results demonstrate that Tsi has anti-inflammatory and antioxidant effects, and improves temporomandibular joint inflammation by promoting the NRF2 / OH-1 pathway.

[0118] 3. Tsi reduces the production of matrix metalloproteinases and promotes cartilage matrix formation.

[0119] The results of Western blot analysis are as follows: Figure 14 As shown, compared with the control group, the production of catabolic enzymes (MMP3 / 9 / 13) was significantly upregulated after IL-1β induction. Reversal of IL-1β-induced extracellular matrix destruction was observed in chondrocytes treated with tFNA and Tsi, with Tsi showing the most significant effect and exhibiting the strongest inhibitory effect, while siRNA showed no significant effect. Further analysis of chondrocyte proliferation-related genes (including PCNA and SOX9) and the expression of an important component of the chondrocyte extracellular matrix (COL-II) was performed. Figure 15 This diagram illustrates the interaction between Tsi and inflammatory factors and matrix metalloproteinases within chondrocytes. Figure 16 As shown, the gene expression of PCNA and SOX9 in the siRNA, tFNA, and Tsi groups was higher than that in the IL-1β group. Compared with other experimental groups, Tsi had the greatest promoting effect. Immunofluorescence staining was used to determine the expression levels. Figure 17-18 Studies have shown that, consistent with RT-qPCR results, COL-II protein secretion in IL-1β-stimulated chondrocytes is upregulated after treatment with the aforementioned nanomedicines (especially Tsi). This indicates that Tsi can significantly reduce the production of matrix metalloproteinases and promote cartilage matrix formation.

[0120] The above experimental results indicate that Tsi inhibits inflammation by silencing NF-κB p65, promotes cell proliferation and anti-apoptosis, and protects chondrocytes by inhibiting the Wnt / β-catenin signaling pathway and promoting the NRF2 / OH-1 pathway, reducing cellular oxidative stress and promoting cartilage matrix formation, thus exhibiting more prominent cartilage-protective properties and achieving the goal of treating temporomandibular joint arthritis. Its mechanism of action is as follows: Figure 9 As shown.

[0121] Experiment 3 investigated the therapeutic effect and regulatory mechanism of Tsi on temporomandibular joint arthritis at the in vivo level.

[0122] The siRNA, tFNA, and Tsi samples used in this experiment were prepared according to the methods of Comparative Example 2, Comparative Example 1, and Example 1.

[0123] I. Experimental Methods

[0124] 1. Establishing the TMJOA animal model

[0125] Animal experiments were conducted according to the guidelines of the Animal Ethics Committee of the West China School of Stomatology, Sichuan University. Rats (6 weeks old) were randomly divided into five groups (sham-operated group, TMJOA group (abbreviated as OA group), siRNA group, tFNA group, and Tsi group). After 7 days of acclimatization, except for the sham-operated group, 30 μL of type II collagenase was injected into the supraarticular space of the bilateral temporomandibular joints of the rats using a 30-gauge needle. Type II collagenase induced persistent inflammation, increased expression of pro-inflammatory cytokines, leading to TMJOA-like changes and inducing the TMJOA model. Two weeks after TMJOA induction, rats were injected intra-articularly with 30 μL of siRNA, tFNA, and Tsi at a concentration of 250 nM, once a week for 4 weeks, 8 weeks, and 9 weeks respectively. Figure 19 Rats in the sham-operated group received only needle pricks instead of injections of type II collagenase and other group materials. The rats were housed under controlled temperatures with a 12-hour light / dark cycle and were allowed free movement and access to food and water.

[0126] 2. Distribution of organisms within the body

[0127] To observe the distribution of siRNA and Tsi drugs in vivo and the ability of Tsi to protect siRNA, siRNA labeled with Cy5 fluorescence was injected into the temporomandibular joint of rats. The distribution and degradation of the drug in the temporomandibular joint cavity were examined using a fluorescence imaging system (IVIS Lumina III series, PerkinElmer, USA) at different time points (days 1, 2, 3, 4, and 5).

[0128] 3. Micro-CT analysis

[0129] Animals were euthanized at 4 and 8 weeks post-treatment, and bilateral temporomandibular joints were surgically removed. The dissected temporomandibular joint condyles were fixed in 10% (v / v) neutral buffered formalin (pH 7.4) for 2 days, and the temporomandibular joints were scanned using a micro-CT scanner (45μCT; SCANCO Medical, Switzerland). Samples were coronally scanned at 55 kV and 100 μA with an effective pixel size of 10 μm. Sagittal and top images of the condyles were reconstructed. Subsequent analyses were performed on bone volume percentage (BV / TV, %), trabecular thickness (Tb·Th, mm), trabecular separation (Tb·Sp, mm), and trabecular number (Tb·N, 1 / mm).

[0130] 4. Histological analysis

[0131] Following micro-CT examination, fixed temporomandibular joint specimens were decalcified in formalin-EDTA. Subsequently, all samples were dehydrated using an ethanol gradient. After embedding in paraffin, serial sections were prepared. H&E, Masson, and Safranin-O staining was used to obtain the general morphology of the condylar cartilage. Immunohistochemical staining was then performed to detect indicators such as nfkb and PCNA. Based on the stained sections, the quality of joint repair was assessed by three blinded independent observers using the Mankin Histological Scoring System and the OARIS score, and articular cartilage thickness was measured. For semi-quantitative analysis of the expression levels of nfkb, PCNA, and Tnfα, positively stained cells were counted at 200× magnification in three fields of view, and expressed as a percentage of positive cells. TUNEL staining (Roche, Mannheim, Germany) was used to stain all samples and analyze chondrocyte apoptosis in different groups. For immunofluorescence analysis, staining for an important protein in cartilage (COL-II) was performed to estimate the recovery rate of OA.

[0132] 5. Statistical Analysis

[0133] All experimental analyses in this study were performed independently at least three times. Experimental data are presented as standard deviation ± mean. All experimental data were recorded and analyzed using ImageJ and GraphPad Prism version 9 (San Diego, USA). Data are presented as mean ± standard deviation. One-way ANOVA was used to compare differences between groups, followed by Tukey's multiple test correction. Here, p < 0.05, p < 0.01, and p < 0.001 were considered statistically significant.

[0134] II. Experimental Results

[0135] 1. The silencing efficiency of Tsi in NF-κB in the temporomandibular joint cartilage of TMJOA rats and its protective effect on the joint.

[0136] Micro-computed tomography (microCT) was used to examine changes in the subchondral bone of the temporomandibular joint in rats. A region of interest was selected for three-dimensional reconstruction, and observations were performed from the top view to the sagittal view. Figure 20 The study analyzed bone-related parameters (i.e., percentage of bone volume to total volume (BV / TV), trabecular thickness (Tb·Th), trabecular separation (Tb.Sp), and trabecular number (Tb·N)) and three-dimensional structure. Figure 21 After 4 weeks of tFNA treatment, BV / TV increased by 19.6% compared to the TMJOA group (P < 0.05), Tb·Th increased by 0.11 mm (P < 0.01), and bone loss was reduced. However, the other two parameters, Tb·Sp and Tb·N (…), showed… Figure 21There were no statistically significant differences. Compared to the TMJOA group, the BV / TV and Tb·Th in the TMJOA+Tsi group were 77.5% (P = 0.011) and 0.28 mm, respectively, and Tb.Sp was 0.09 mm, all of which were significantly different from the TMJOA group, with the trend consistent at week 8. The four bone structure parameters in the siRNA-only treatment group were comparable to those in the TMJOA group, indicating that Tsi has a stronger protective effect on subchondral bone than siRNA and tFNA alone.

[0137] Imaging and acquisition of the temporomandibular joint region were performed at seven different time points using an in vivo imaging system (IVIS). Examples include fluorescence images. Figure 22 As shown in the figure, at all time points, in both the healthy group and the OA group, the fluorescence intensity of the joints injected with Tsi was significantly higher than that of free siRNA, indicating that Tsi effectively enhanced the stability of siRNA and prolonged its effective interaction time. In arthritic rats, the Tsi group showed good retention in the first 30 minutes, with no significant decrease in fluorescence intensity. A significant decrease only began in the 30-45 minute period, and fluorescence intensity was still present after 180 minutes, indicating that Tsi's effect on the joint can reach 180 minutes. Compared to siRNA alone, it provides a longer-lasting and more effective protective effect on the joint. In the joint cavity of the healthy group, the decrease in Tsi was also relatively slow, but the retention rate was lower than that of the OA group, indicating that the inflammatory microenvironment of OA increases the retention effect of Tsi. The experiment shows that Tsi effectively promotes the retention of siRNA in the joint cavity of temporomandibular joint arthritis.

[0138] HE staining revealed that in the OA group, over time, the condylar surface exhibited cartilage damage, an uneven articular surface, thinning of the cartilage layer, disordered cellular structure, and significant loss of cartilage collagen. The Tsi group significantly promoted the repair of inflammation-induced ECM loss, increased the continuity of the condylar surface, and increased the thickness of the condylar cartilage (especially the thickness of the mature layer + hypertrophic layer). Masson staining reflected the level of glycosaminoglycans in the cartilage, observing significant ECM degradation and a substantial decrease in glycosaminoglycans in the OA group at 8 weeks. Tsi reversed this effect. Figure 23 AF)

[0139] The OARSI grading is a semi-quantitative scoring scale for temporomandibular joint (OA). The Mankin score is a cartilage damage grading system based on histological morphology. Higher scores on both indicate more severe temporomandibular joint and cartilage damage. Experimental data showed that treatment with siRNA, tFNA, and Tsi resulted in cartilage regeneration, thicker synovium, more intact articular cartilage, and a smoother, more orderly cartilage surface. Therefore, lower OARSI and Mankin scores generally correlate with higher scores. Figure 23 GJ).

[0140] In summary, these observations indicate that Tsi reduces tissue damage and / or enhances tissue repair in the temporomandibular joint, effectively inhibits the loss of cartilage collagen, maintains cartilage integrity, and reduces the development of TMJOA.

[0141] 2. The silencing effect of Tsi on NF-κB in the temporomandibular joint of rats, anti-inflammatory effect, and promotion of cartilage matrix formation.

[0142] Safranin-O staining analysis revealed that the Tsi group showed a significantly larger red staining area at all time points compared to other treatment groups, indicating excellent protection of the cartilage matrix. Figure 23 Representative images of the medial temporomandibular joint stained with TUNEL staining showed an increase in the number of apoptotic chondrocytes in the OA group at 4 and 8 weeks. Figure 24 siRNA, tFNAs, and Tsi can reduce the number of apoptotic chondrocytes, especially Tsi. Immunofluorescence was used for evaluation. Representative images at 4 weeks and 8 weeks showed (…). Figure 23 Compared with the control group, the fluorescence intensity of COL-II in the OA group decreased sharply. Treatment with siRNA, tFNAs, and Tsi increased the content of COL-II in the synovium and articular cartilage to varying degrees. The results indicate that Tsi significantly attenuates the occurrence of OA by inhibiting chondrocyte apoptosis, smoothing the cartilage surface, inhibiting ECM degradation, and increasing synovial thickness, thus effectively and efficiently protecting articular cartilage.

[0143] The histochemical results of NF-κB showed that ( Figure 24 The targeted silencing effect of Tsi on NF-κB in TMJOA was significantly higher than that of the siRNA group in both the early and late stages, demonstrating the high efficiency of the tetrahedral nucleic acid framework as a carrier of siRNA in tissue penetration and cell entry for targeted gene silencing.

[0144] Immunohistochemical results showed that at week 4, TNF-α expression was significantly increased in the OA group compared to the control group, while PCNA expression was decreased. TNF-α expression levels in the siRNA and tFNA groups were significantly lower than in the OA group. However, PCNA expression showed no significant difference between the two groups. Figure 24 The percentage of PCNA cells was significantly higher in the Tsi group compared to the OA group (P < 0.001). At week 8 of temporomandibular joint arthritis treatment, TNF-α and PCNA levels differed significantly between the OA and control groups. Compared to the OA group, Tsi reduced TNF-α levels. PCNA showed the opposite trend; the number of PCNA-positive cells was significantly increased in the Tsi group compared to the OA group, indicating that Tsi plays a significant role in inhibiting matrix metalloproteinase release and promoting cartilage proliferation.

[0145] The above in vivo experiments demonstrate that the tetrahedral nucleic acid framework, as a carrier of siRNA, has high efficiency in targeting and silencing genes, and can treat temporomandibular joint arthritis from multiple perspectives.

[0146] In the above experiments, Tsi, compared with siRNA alone, showed superior performance in inhibiting pro-inflammatory factors such as TNF-α and iNOS, reducing MMP, reducing apoptosis, promoting cell proliferation, and protecting the degradation of cartilage matrix, thus playing a multi-faceted and comprehensive protective role in the occurrence and development of temporomandibular joint arthritis.

[0147] Therefore, overall, the construction of this Tsi delivery system carrying siRNA provides new opportunities and methods for anti-inflammatory and proliferative treatment of temporomandibular joint arthritis in clinical practice, and has extremely bright prospects and great clinical potential.

Claims

1. A functionalized tetrahedral framework nucleic acid, characterized in that: The functionalized tetrahedral framework nucleic acid is modified with siRNA-NF-κB p65.

2. The functionalized tetrahedral framework nucleic acid according to claim 1, characterized in that: It involves combining four single-stranded DNA strands with sticky ends with the sticky ends of siRNA-NF-κB p65 to form a DNA-siRNA chain, and then assembling the four DNA-siRNA chains through complementary base pairing.

3. The functionalized tetrahedral framework nucleic acid according to claim 2, characterized in that: The four single-stranded DNA nucleotide sequences are shown in SEQ ID NO.1-SEQ ID NO.4; And / or, the sense strand of siRNA-NF-κB p65 is the nucleotide sequence shown in SEQ ID NO.5 with two deoxythymidine nucleotides.

4. The method for preparing the functionalized tetrahedral framework nucleic acid according to any one of claims 1-3, characterized in that, The process includes the following steps: mixing siRNA-NF-κB p65 with four pre-designed single-stranded DNA molecules, incubating, and then obtaining the final product.

5. Use of the functionalized tetrahedral framework nucleic acid according to any one of claims 1-3 in the treatment of temporomandibular joint arthritis.

6. The use according to claim 5, characterized in that: The drug is used to protect chondrocytes.

7. The use according to claim 5, characterized in that: The drug is used to reduce cellular oxidative stress.

8. The use according to claim 5, characterized in that: The drug is used to promote cartilage matrix formation.

9. The use according to claim 5, characterized in that: The drug is used to significantly reduce the occurrence of osteoarthritis by inhibiting chondrocyte apoptosis, smoothing the cartilage surface, inhibiting extracellular matrix degradation, and increasing synovial thickness.

10. A drug for treating temporomandibular joint arthritis, characterized in that: It is made by adding pharmaceutically acceptable excipients to the functionalized tetrahedral framework nucleic acid as described in any one of claims 1-3 as the active ingredient.

Images