Exogenous cofactor enhanced yarrowia lipolytica strain, method and application in efficient synthesis of EPA (eicosapentaenoic acid) and lipid
By overexpressing exogenous elongation desaturase and cofactor-related genes in *Yarrowia lipophila* strain, the problem of low EPA yield was solved, achieving efficient production of EPA and lipids and reducing production costs.
Patent Information
- Application Number
- CN202511048666.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-29
- Publication Date
- 2025-11-11
- Estimated Expiration
- 2045-07-29
AI Technical Summary
Existing technologies for producing EPA using Yersinia lipophila suffer from low yields, particularly due to insufficient supply of cofactors such as NADPH, resulting in low EPA synthesis efficiency.
By overexpressing exogenous Δ9 elongase, Δ8 desaturase, Δ5 desaturase and Δ17 desaturase genes in *Yersinia lipolytica* strain, and simultaneously overexpressing glucose-6-phosphate dehydrogenase (G6PDH) and malate (ME), an exogenous cofactor-enhanced *Yersinia lipolytica* strain was constructed to improve EPA synthesis efficiency.
It significantly improved the EPA and lipid production of Yeast Extract, with lipid content and EPA production reaching 2.76 g/L and 0.79 g/L, respectively, significantly improving EPA production efficiency and cost-effectiveness.
Smart Images

Figure CN120924416A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, and in particular to a Yersinia lipophila strain with exogenous cofactor enhancement, a method thereof, and its application in the efficient synthesis of EPA and lipids. Background Technology
[0002] EPA (eicosapentaenoic acid) is a long-chain Omega-3 polyunsaturated fatty acid with anti-inflammatory, immunomodulatory, and cardiovascular protective effects. EPA has been included in several international dietary guidelines (such as the American Heart Association (AHA)). Furthermore, high-purity EPA preparations (such as icosapent ethyl) have been approved for use in specific high-risk cardiovascular populations. Studies also suggest that EPA has potential for expanded applications in areas such as metabolic syndrome and postpartum depression.
[0003] However, EPA is mainly found in deep-sea fish (such as salmon and mackerel) and some microalgae. This limits EPA production capacity and quality control. With increasing focus on environmental friendliness and sustainability, there is growing interest in finding alternative, sustainable, and cost-effective sources. Microbial production of EPA is generally considered a good option due to its short growth cycle, rapid growth rate, and insensitivity to light or climate change.
[0004] Yarrowia lipolytica is an unconventional oil-producing yeast with favorable industrial characteristics, including high-density fermentation, inhibitor tolerance, and a wide range of fermentation substrates. Therefore, Yarrowia lipolytica is considered a potential industrial strain for EPA production. However, EPA production from Yarrowia lipolytica also faces some challenges, primarily including how to increase both EPA and oil yield.
[0005] EPA synthesis requires cofactors such as NADPH, and in *Yarrowia lipolytica*, the NADPH used for EPA synthesis is mainly produced by malic acid esterase (ME) and the pentose phosphate pathway (PPP). A patent (publication number: CN 119432633 A) has successfully increased EPA production in *Yarrowia lipolytica* by overexpressing endogenous malic acid esterase (ME) and glucose-6-phosphate dehydrogenase (G6PDH). However, the effects of exogenous malic acid esterase (ME) and glucose-6-phosphate dehydrogenase (G6PDH) have not been investigated. Summary of the Invention
[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide an engineered yeast strain for the efficient production of eicosapentaenoic acid based on citric acid metabolism regulation, its construction method, and its application.
[0007] The technical solution adopted by this invention to solve its technical problem is:
[0008] An exogenous cofactor-enhanced *Yersinia lipolytica* strain, wherein the substrate strain of the *Yersinia lipolytica* strain is *Yersinia lipolytica* Po1f, and the strain overexpresses partially elongating desaturases in the fatty acid synthesis pathway, mainly including Δ9 elongase, Δ8 desaturase, Δ5 desaturase and Δ17 desaturase genes. On this basis, glucose-6-phosphate dehydrogenase (G6PDH) and malate enzyme (ME) are also overexpressed.
[0009] Furthermore, the Δ9 elongase is derived from Saprolegnia diclina (SdΔ9EL), whose gene sequence is shown in SEQ ID No. 1;
[0010] The Δ8 desaturase is derived from Rhodotorula toruloides NP11 (RtΔ8DE), and its gene sequence is shown in SEQ ID No. 2;
[0011] The Δ5 desaturase is derived from Nannochloropsis oceanica (NoΔ5DE), and its gene sequence is shown in SEQ ID No. 3;
[0012] The Δ17 desaturase is derived from Parietichytrium sp (PaΔ17DE), and its gene sequence is shown in SEQ ID No. 4;
[0013] The glucose-6-phosphate dehydrogenase is derived from Schizochytrium sp. HX-308 (SpG6PDH), and its gene sequence is shown in SEQ ID No. 5;
[0014] The malicase is derived from Schizochytrium sp. HX-308 (SpME2), and its gene sequence is shown in SEQ ID No. 6.
[0015] The application of the exogenous cofactor-enhanced Yersinia lipolyticis strain as described above in the production of EPA and oils.
[0016] The method for constructing the exogenous cofactor-enhanced Yersinia lipolyticis strain as described above includes the following steps:
[0017] Construction of S1 recombinant plasmid pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8DE
[0018] Using plasmid pUC-IntC-HUH-TE as a backbone, the SdΔ9EL and RtΔ8DE genes were inserted into the backbone to obtain the recombinant plasmid pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8DE.
[0019] Construction of S2 recombinant plasmid pUC-SCP2-HUH-TE-NoΔ5DE-PaΔ17DE
[0020] Using plasmid pUC-SCP2-HUH-TE as a backbone, the NoΔ5DE and PaΔ17DE genes were inserted into the backbone to obtain the recombinant plasmid pUC-SCP2-HUH-TE-NoΔ5DE-PaΔ17DE.
[0021] Construction of S3 recombinant plasmid pUC-intF3-HUH-TE-SpG6PDH
[0022] Using plasmid pUC-intF3-HUH-TE as a backbone, the SpG6PDH gene was inserted into the backbone to obtain the recombinant plasmid pUC-intF3-HUH-TE-SpG6PDH;
[0023] Construction of S4 recombinant plasmid pUC-intF3-HUH-TE-SpME2
[0024] Using plasmid pUC-intF3-HUH-TE as a backbone, the SpME2 gene was inserted into the backbone to obtain the recombinant plasmid pUC-intF3-HUH-TE-SpME2;
[0025] Construction of S5 recombinant plasmid pUC-intF3-HUH-TE-SpG6PDH-SpME2
[0026] Using plasmid pUC-intF3-HUH-TE-SpG6PDH as a backbone, the SpME2 gene was inserted into the backbone to obtain the recombinant plasmid pUC-intF3-HUH-TE-SpG6PDH-SpME2;
[0027] Construction of S6 engineered Yersinia lipophila strain for EPA production
[0028] The plasmid pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8DE was transformed into the uracil-auxotrophic *Yersinia lipolytica* strain Po1f (Po1f-ΔURA) to obtain recombinant *Yersinia lipolytica* strain 1, Po1f-A1. Po1f-A1 was inoculated onto YPD solid medium containing 1 g / L 5-FOA. After single-cell growth, it was streaked again in YPD solid medium for activation, yielding *Yersinia lipolytica* Po1f-A1-ΔURA. The plasmid was then... pUC-SCP2-HUH-TE-NoΔ5DE-PaΔ17DE was transferred into the recombinant strain Po1f-A1-ΔURA of *Yersinia lipolytica* to obtain recombinant strain 2, namely Po1f-A2, which is the *Yersinia lipolytica* engineered strain capable of producing EPA. Po1f-A2 was inoculated into YPD-5-FOA solid medium. After single cells grew, it was streaked again in YPD solid medium to activate it, thus obtaining *Yersinia lipolytica* Po1f-A2-ΔURA.
[0029] Construction of S7 exogenous cofactor-enhanced lipophilic yeast strain Po1f-A3
[0030] The plasmid pUC-intF3-HUH-TE-SpG6PDH was transformed into the recombinant Yersinia lipolytica strain Po1f-A2-ΔURA to obtain recombinant Yersinia lipolytica strain 3, namely Po1f-A3, which is the exogenous cofactor-enhanced Yersinia lipolytica engineered strain Po1f-A3.
[0031] Construction of S8 exogenous cofactor-enhanced lipophilic yeast strain Po1f-A4
[0032] The plasmid pUC-intF3-HUH-TE-SpME2 was transformed into the recombinant Yersinia lipolytica strain Po1f-A2-ΔURA to obtain the recombinant Yersinia lipolytica strain 4, namely Po1f-A4, which is the exogenous cofactor-enhanced Yersinia lipolytica engineered strain Po1f-A4.
[0033] Construction of S9 exogenous cofactor-enhanced lipophilic yeast strain Po1f-A5
[0034] The plasmid pUC-intF3-HUH-TE-SpG6PDH-SpME2 was transformed into the recombinant Yersinia lipolytica strain Po1f-A2-ΔURA to obtain recombinant Yersinia lipolytica strain 5, namely Po1f-A5, which is the exogenous cofactor-enhanced Yersinia lipolytica engineered strain Po1f-A5.
[0035] Furthermore, during the strain construction process, the promoters of each extended desaturase gene expression cassette were P. TEF promoter, P EXP promoter, P FBA promoter or PYAT One type of promoter, with T as the terminator. CYC1t Termination, T xpr2t One of the terminators;
[0036] Alternatively, in step S6, the strain transformation method is achieved through lithium acetate transformation.
[0037] The method for producing EPA and lipids by fermentation using the engineered strain of *Yarrowia lipolyticis* as described above includes the following steps:
[0038] In the process of fermenting and producing EPA and lipids using the engineered strain of Yersinia lipophila, a shaker culture is used at a temperature of 28-30℃, a fermentation time of 96-120h, and a shaker speed of 180-220rpm.
[0039] Furthermore, the specific steps are as follows:
[0040] Activation of S1 Yersinia lipophila engineered strain
[0041] The engineered Yersinia lipolyticis was streaked onto YPD solid medium and cultured in an incubator at 30°C for 72 h; a single colony was picked and inoculated into YPD liquid medium and cultured in a shaker at 28°C and 280 r / min for 24 h to obtain the fermentation seed liquid;
[0042] Fermentation of S2 lipophilic yeast engineered strain
[0043] The fermentation seed liquid was inoculated into the fermentation medium at a ratio of 5%, and cultured in a shaker at 30℃ and 220r / min for 120h to obtain the fermentation broth.
[0044] Furthermore, the YPD liquid culture medium has the following composition: pH 6.5, components including 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, and water as solvent, and is sterilized at 115°C for 30 minutes.
[0045] Among them, YPD plate medium is YPD liquid medium with 2% agar added to the final concentration;
[0046] The fermentation medium is: pH 6.5, consisting of 1.7 g / L of amino acid-free and ammonium sulfate-free YNB, 2.5 g / L of yeast extract, 60 g / L of glucose, and pure water as solvent, sterilized at 115°C for 30 minutes.
[0047] Furthermore, the method also includes the following steps:
[0048] S3 fermentation product analysis
[0049] After fermentation, 30 mL of fermentation broth was placed into a pre-weighed 50 mL centrifuge tube and centrifuged at 4000 g for 5 min. The resulting bacterial cells were then freeze-dried in a freeze dryer for 48 h. The freeze-dried samples were then placed in a drying oven and dried to constant weight. The weight was measured and the weight of the empty centrifuge tube was subtracted to obtain the dry weight of the bacterial cells.
[0050] After fermentation, 200 μL of fermentation broth was centrifuged at 4000g for 5 min, and the resulting cells were freeze-dried for 48 h. The freeze-dried sample was then removed and 500 μL of 1M NaOH-methanol solution was added, followed by shaking in a shaker for 6 h. After shaking, 40 μL of concentrated sulfuric acid was added to terminate methyl esterification, followed by 100 μL of 2 g / L methyl undecanoate solution as an internal standard. Then, 500 μL of n-hexane was added for extraction, followed by shaking in a shaker for 2 h. The upper organic phase was collected for gas phase analysis.
[0051] The advantages and positive effects of this invention are as follows:
[0052] 1. This invention uses *Yarrowia lipolytica* strain Po1f as the starting strain, overexpressing exogenous Δ9 elongase, Δ8 desaturase, Δ5 desaturase, and Δ17 desaturase genes to construct the *Yarrowia lipolytica* engineered strain Po1f-A2, achieving an oil content of 0.78 g / L and an EPA yield of 0.22 g / L. Simultaneously, overexpressing exogenous glucose-6-phosphate dehydrogenase (G6PDH) and malate (ME) genes, the *Yarrowia lipolytica* engineered strains Po1f-A3 and Po1f were constructed. The oil content of strains -A4 and Po1f-A5 reached 1.34 g / L, 1.89 g / L, and 2.76 g / L, respectively, and the EPA yield reached 0.39 g / L, 0.53 g / L, and 0.79 g / L, respectively, thus improving the EPA and lipid yield of *Yersinia lipophila*. This invention is applicable to the construction of genetically engineered strains with high EPA and lipid production, providing a basis for the production of EPA-rich oils by *Yersinia lipophila*, and solving the problems of unsustainability and high cost associated with obtaining EPA from fish.
[0053] 2. This invention constructs three recombinant plasmids, pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8DE, pUC-SCP2-HUH-TE-NoΔ5DE-PaΔ17DE, and pUC-intF3-HUH-TE-SpG6PDH-SpME2, and transforms them into *Yersinia lipophilia* Po1f, thereby constructing an engineered strain Po1f-A5 that can produce high-value EPA-rich lipids. The lipid content and EPA yield reached 2.76 g / L and 0.79 g / L, respectively, significantly improving the EPA and lipid yield of the engineered *Yersinia lipophilia* strain, and the strain exhibits good stability.
[0054] 3. This invention expresses multiple exogenous elongation desaturase genes and cofactor-related genes in *Yersinia lipolytica*. Compared with strains that do not express exogenous elongation desaturase genes and cofactor-related genes, the modified *Yersinia lipolytica* strain can produce a more diverse range of fatty acids. Furthermore, during fermentation, the yield of oil and EPA increased by 211.59% and 79.51%, respectively, providing an effective approach for the commercial production of eicosapentaenoic acid using *Yersinia lipolytica*.
[0055] 4. This invention provides a heterologous expression of elongation desaturase genes and cofactor genes in *Yersinia lipolytica* strain, its construction method, and its application. The *Yersinia lipolytica* Po1f strain expresses elongation desaturase genes from multiple sources, as well as glucose-6-phosphate dehydrogenase (G6PDH) and malate (ME) genes from *Schizochytrium* HX-308, constructing an engineered strain with good stability, short culture cycle, high oil content, and high EPA yield. This significantly reduces EPA production costs and significantly improves efficiency.
[0056] 5. This invention is applicable to constructing engineered strains of Yersinia lipolytica that express elongation desaturase and cofactor-related genes. The constructed engineered strains of Yersinia lipolytica can be used for fermentation production of functional oils rich in EPA. The operation is simple and suitable for industrial fermentation production of functional oils. Attached Figure Description
[0057] Figure 1 The image shows the recombinant plasmid pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8DE in Example 1 of this invention.
[0058] Figure 2 The image shows the recombinant plasmid pUC-SCP2-HUH-TE-NoΔ5DE-PaΔ17DE in Example 2 of this invention;
[0059] Figure 3 The image shows the recombinant plasmid pUC-intF3-HUH-TE-SpG6PDH in Example 3 of this invention;
[0060] Figure 4 The image shows the recombinant plasmid pUC-intF3-HUH-TE-SpME2 in Example 4 of this invention;
[0061] Figure 5 The image shows the recombinant plasmid pUC-intF3-HUH-TE-SpME2-SpG6PDH in Example 4 of this invention;
[0062] Figure 6 This is a colony PCR result diagram from Example 7 of the present invention, verifying whether the left homologous arm of strain Po1f-A5 is linked to the target gene.
[0063] Figure 7 This is a colony PCR result diagram from Example 7 of the present invention, verifying whether the right homologous arm of strain Po1f-A5 is linked to the target gene.
[0064] Figure 8 This is a comparison chart of the dry weight and oil yield of the engineered Yersinia lipophila strains Po1f-A2, Po1f-A3, Po1f-A4, and Po1f-A5 in Example 8 of the present invention.
[0065] Figure 9 A comparative diagram of the fatty acid composition of the engineered strains Po1f-A2, Po1f-A3, Po1f-A4, and Po1f-A5 of Yersinia lipophila in Example 8 of the present invention;
[0066] Figure 10 This is a comparison chart of EPA production of the engineered strains Po1f-A2, Po1f-A3, Po1f-A4, and Po1f-A5 of Yersinia lipophila in Example 8 of the present invention. Detailed Implementation
[0067] The present invention will be further described below with reference to the embodiments. The following embodiments are descriptive and not limiting, and should not be used to limit the scope of protection of the present invention.
[0068] The various experimental operations involved in the specific embodiments are all conventional techniques in the field. For parts not specifically annotated in this document, those skilled in the art can refer to various commonly used reference books, scientific and technological documents or related instructions and manuals prior to the filing date of this invention to carry out the operations.
[0069] An exogenous cofactor-enhanced *Yersinia lipolytica* strain, wherein the substrate strain of the *Yersinia lipolytica* strain is *Yersinia lipolytica* Po1f, and the strain overexpresses partially elongating desaturases in the fatty acid synthesis pathway, mainly including Δ9 elongase, Δ8 desaturase, Δ5 desaturase and Δ17 desaturase genes. On this basis, glucose-6-phosphate dehydrogenase (G6PDH) and malate enzyme (ME) are also overexpressed.
[0070] Preferably, the Δ9 elongase is derived from Saprolegnia diclina (SdΔ9EL), whose gene sequence is shown in SEQ ID No. 1;
[0071] The Δ8 desaturase is derived from Rhodotorula toruloides NP11 (RtΔ8DE), and its gene sequence is shown in SEQ ID No. 2;
[0072] The Δ5 desaturase is derived from Nannochloropsis oceanica (NoΔ5DE), and its gene sequence is shown in SEQ ID No. 3;
[0073] The Δ17 desaturase is derived from Parietichytrium sp (PaΔ17DE), and its gene sequence is shown in SEQ ID No. 4;
[0074] The glucose-6-phosphate dehydrogenase is derived from Schizochytrium sp. HX-308 (SpG6PDH), and its gene sequence is shown in SEQ ID No. 5;
[0075] The malicase is derived from Schizochytrium sp. HX-308 (SpME2), and its gene sequence is shown in SEQ ID No. 6.
[0076] The application of the exogenous cofactor-enhanced Yersinia lipolyticis strain as described above in the production of EPA and oils.
[0077] The method for constructing the exogenous cofactor-enhanced Yersinia lipolyticis strain as described above includes the following steps:
[0078] Construction of S1 recombinant plasmid pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8DE
[0079] Using plasmid pUC-IntC-HUH-TE as a backbone, the SdΔ9EL and RtΔ8DE genes were inserted into the backbone to obtain the recombinant plasmid pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8DE.
[0080] Construction of S2 recombinant plasmid pUC-SCP2-HUH-TE-NoΔ5DE-PaΔ17DE
[0081] Using plasmid pUC-SCP2-HUH-TE as a backbone, the NoΔ5DE and PaΔ17DE genes were inserted into the backbone to obtain the recombinant plasmid pUC-SCP2-HUH-TE-NoΔ5DE-PaΔ17DE.
[0082] Construction of S3 recombinant plasmid pUC-intF3-HUH-TE-SpG6PDH
[0083] Using plasmid pUC-intF3-HUH-TE as a backbone, the SpG6PDH gene was inserted into the backbone to obtain the recombinant plasmid pUC-intF3-HUH-TE-SpG6PDH;
[0084] Construction of S4 recombinant plasmid pUC-intF3-HUH-TE-SpME2
[0085] Using plasmid pUC-intF3-HUH-TE as a backbone, the SpME2 gene was inserted into the backbone to obtain the recombinant plasmid pUC-intF3-HUH-TE-SpME2;
[0086] Construction of S5 recombinant plasmid pUC-intF3-HUH-TE-SpG6PDH-SpME2
[0087] Using plasmid pUC-intF3-HUH-TE-SpG6PDH as a backbone, the SpME2 gene was inserted into the backbone to obtain the recombinant plasmid pUC-intF3-HUH-TE-SpG6PDH-SpME2;
[0088] Construction of S6 engineered Yersinia lipophila strain for EPA production
[0089] The plasmid pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8DE was transformed into the uracil-auxotrophic *Yersinia lipolytica* strain Po1f (Po1f-ΔURA) to obtain recombinant *Yersinia lipolytica* strain 1, Po1f-A1. Po1f-A1 was inoculated into YPD solid medium containing 1 g / L 5-FOA. After single-cell growth, it was streaked again in YPD solid medium for activation, yielding *Yersinia lipolytica* Po1f-A1-ΔURA. Particle pUC-SCP2-HUH-TE-NoΔ5DE-PaΔ17DE was transferred into the recombinant strain Po1f-A1-ΔURA of *Yersinia lipolytica* to obtain recombinant strain 2, namely Po1f-A2, which is the *Yersinia lipolytica* engineered strain capable of producing EPA. Po1f-A2 was inoculated into YPD-5FOA solid medium. After single cells grew, it was streaked again in YPD solid medium to activate it, thus obtaining *Yersinia lipolytica* Po1f-A2-ΔURA.
[0090] Construction of S7 exogenous cofactor-enhanced lipophilic yeast strain Po1f-A3
[0091] The plasmid pUC-intF3-HUH-TE-SpG6PDH was transformed into the recombinant Yersinia lipolytica strain Po1f-A2-ΔURA to obtain recombinant Yersinia lipolytica strain 3, namely Po1f-A3, which is the exogenous cofactor-enhanced Yersinia lipolytica engineered strain Po1f-A3.
[0092] Construction of S8 exogenous cofactor-enhanced lipophilic yeast strain Po1f-A4
[0093] The plasmid pUC-intF3-HUH-TE-SpME2 was transformed into the recombinant Yersinia lipolytica strain Po1f-A2-ΔURA to obtain the recombinant Yersinia lipolytica strain 4, namely Po1f-A4, which is the exogenous cofactor-enhanced Yersinia lipolytica engineered strain Po1f-A4.
[0094] Construction of S9 exogenous cofactor-enhanced lipophilic yeast strain Po1f-A5
[0095] The plasmid pUC-intF3-HUH-TE-SpG6PDH-SpME2 was transformed into the recombinant Yersinia lipolytica strain Po1f-A2-ΔURA to obtain recombinant Yersinia lipolytica strain 5, namely Po1f-A5, which is the exogenous cofactor-enhanced Yersinia lipolytica engineered strain Po1f-A5.
[0096] Preferably, during strain construction, the promoter of each extended desaturase gene expression cassette is P. TEF promoter, P EXP promoter, P FBA promoter or P YAT One type of promoter, with T as the terminator. CYC1t Termination, T xpr2t One of the terminators;
[0097] Alternatively, in step S6, the strain transformation method is achieved through lithium acetate transformation.
[0098] The method for producing EPA and lipids by fermentation using the engineered strain of *Yarrowia lipolyticis* as described above includes the following steps:
[0099] In the process of fermenting and producing EPA and lipids using the engineered strain of Yersinia lipophila, a shaker culture is used at a temperature of 28-30℃, a fermentation time of 96-120h, and a shaker speed of 180-220rpm.
[0100] Preferably, the specific steps are as follows:
[0101] Activation of S1 Yersinia lipophila engineered strain
[0102] The engineered Yersinia lipolyticis was streaked onto YPD solid medium and cultured in an incubator at 30°C for 72 h; a single colony was picked and inoculated into YPD liquid medium and cultured in a shaker at 28°C and 280 r / min for 24 h to obtain the fermentation seed liquid;
[0103] Fermentation of S2 lipophilic yeast engineered strain
[0104] The fermentation seed liquid was inoculated into the fermentation medium at a ratio of 5%, and cultured in a shaker at 30℃ and 220r / min for 120h to obtain the fermentation broth.
[0105] Preferably, the YPD liquid culture medium has the following composition: pH 6.5, comprising 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, and water as the solvent, and is sterilized at 115°C for 30 minutes.
[0106] Among them, YPD plate medium is YPD liquid medium with 2% agar added to the final concentration;
[0107] The fermentation medium is: pH 6.5, consisting of 1.7 g / L of amino acid-free and ammonium sulfate-free YNB, 2.5 g / L of yeast extract, 60 g / L of glucose, and pure water as solvent, sterilized at 115°C for 30 minutes.
[0108] Preferably, the method further includes the following steps:
[0109] S3 fermentation product analysis
[0110] After fermentation, 30 mL of fermentation broth was placed into a pre-weighed 50 mL centrifuge tube and centrifuged at 4000 g for 5 min. The resulting bacterial cells were then freeze-dried in a freeze dryer for 48 h. The freeze-dried samples were then placed in a drying oven and dried to constant weight. The weight was measured and the weight of the empty centrifuge tube was subtracted to obtain the dry weight of the bacterial cells.
[0111] After fermentation, 200 μL of fermentation broth was centrifuged at 4000g for 5 min, and the resulting cells were freeze-dried for 48 h. The freeze-dried sample was then removed and 500 μL of 1M NaOH-methanol solution was added, followed by shaking in a shaker for 6 h. After shaking, 40 μL of concentrated sulfuric acid was added to terminate methyl esterification, followed by 100 μL of 2 g / L methyl undecanoate solution as an internal standard. Then, 500 μL of n-hexane was added for extraction, followed by shaking in a shaker for 2 h. The upper organic phase was collected for gas phase analysis.
[0112] Specifically, the relevant preparation and testing methods are as follows:
[0113] The lithium acetate conversion method of Yeast lipolyticis was prepared according to the method described in the paper "High-efficiency yeast transformation using the LiAc / SScarrier DNA / PEG method" published in Nature Protocols, Vol. 2, 2007, pp. 31-34.
[0114] Cell dry weight determination method: After fermentation, take 30 mL of fermentation broth and place it in a pre-weighed 50 mL centrifuge tube. Centrifuge at 4000 g for 5 min. Place the obtained cells in a freeze dryer and freeze dry for 48 h. Take out the freeze-dried sample and place it in a drying oven to dry to constant weight. Weigh the sample and subtract the weight of the empty centrifuge tube to obtain the cell dry weight.
[0115] Methods for detecting oil content and fatty acid profile: After fermentation, take 200 μL of fermentation broth, centrifuge at 4000g for 5 min, and freeze-dry the obtained cells in a freeze dryer for 48 h. Take out the freeze-dried sample and add 500 μL of NaOH-methanol solution (1M), and shake in a shaker for 6 h. After shaking, add 40 μL of concentrated sulfuric acid to terminate methyl esterification, and then add 100 μL of methyl undecanoate solution (2 g / L) as an internal standard. Then add 500 μL of n-hexane for extraction and shake in a shaker for 2 h. Collect the upper organic phase for gas phase analysis.
[0116] The chromatographic column used in the experiment was DB-23 (60.0m × 0.25mm × 0.25μm); the detection conditions were: injection port temperature 250℃, injection volume 1.0μL, split ratio 69.8:1; the chromatographic conditions were: initial temperature 100℃, increased to 196℃ at 25℃ / min, then increased to 220℃ at 2℃ / min and held for 21 min.
[0117] After the gas chromatography analysis was completed, different fatty acids were identified by comparison with relevant external standards (Sigma, USA). In this gas chromatography analysis, non-endogenous fatty acids (C11:0) were used as internal standards, and the content of individual fatty acids was estimated from the peak area on the chromatogram.
[0118] YPD liquid medium: pH 6.5, ingredients include 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, solvent is water, sterilized at 115℃ for 30 minutes, YPD plate medium is supplemented with 2% agar.
[0119] Fermentation medium: pH 6.5, consisting of 1.7 g / L amino acid-free and ammonium sulfate-free YNB, 2.5 g / L yeast extract, 60 g / L glucose, and pure water as solvent, sterilized at 115°C for 30 minutes.
[0120] Specifically, the present invention will be further described in conjunction with the embodiments:
[0121] Example 1: Construction of recombinant plasmid pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8DE
[0122] This embodiment describes a method for constructing the recombinant plasmid pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8DE, which includes the following steps performed sequentially:
[0123] Construction of S1 recombinant plasmid pUC-IntC-HUH-TE-SdΔ9EL
[0124] S11 SdΔ9EL gene fragment amplification
[0125] Primers were designed as 9EL-F / 9EL-R (SEQ ID No. 7 / SEQ ID No. 8). Using the synthesized SdΔ9EL gene as a template, the desired Δ9 elongase gene fragment was obtained by PCR using PrimerStar high-fidelity polymerase (Nanjing, Novizan) according to the product instructions. The PCR program was: 98℃ for 30s, 56℃ for 30s, 70℃ for 1min, for 32 cycles. The PCR product was then purified. Purification was performed using a gel extraction kit from Nanjing Qingke, following the instructions. The purified product was verified by agarose gel electrophoresis.
[0126] The connection reaction between the S12 gene fragment and the backbone
[0127] The pUC-IntC-HUH-TE plasmid (disclosed in patent publication CN119432633 A) was digested with BamHI (Nanjing BioShenggong). The digested product was recovered by agarose gel electrophoresis using the same method as described in "S11SdΔ9EL gene fragment amplification". The digested backbone was ligated to the SdΔ9EL fragment, and one-step cloning was performed using the ClonExpress MultiS One Step Cloning Kit (Nanjing Novizan). The experiment was conducted according to the product instructions to construct the plasmid pUC-IntC-HUH-TE-SdΔ9EL. Ligation system (10 μL): 4 μL gene fragment, 1 μL digested backbone, 5 μL ligase buffer, ligation at 50℃ for 50 min. Enzyme digestion system (50 μL): 4 μg plasmid vector, 2 μL BamHI enzyme, 5 μL 10X SpeedyOne Buffer, and ddH2O were added to a volume of 50 μL. The enzyme digestion experiment was carried out according to the instructions.
[0128] S13 transformed E. coli DH5α competent cells
[0129] (1) Under sterile conditions, take 100 μL of Escherichia coli DH5α (Nanjing, Qingke) competent cells, add the ligation product, mix well, and place on ice for 30 min.
[0130] (2) Heat shock at 42℃ for 90s, then quickly place on ice for 3min.
[0131] (3) Add 1000 μL of LB medium and incubate at 37°C and 220 r / min for 40 min.
[0132] (4) Spread 200 μL onto an LB plate containing 50 μg / mL Amp resistance. Incubate inverted at 37°C overnight.
[0133] (5) Positive transformants were selected, plasmids were extracted, and sequencing was performed to verify the results. Finally, the pUC-IntC-HUH-TE-SdΔ9EL plasmid was successfully constructed.
[0134] Construction of S2 recombinant plasmid pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8DE
[0135] Expansion of the S21 RtΔ8DE gene fragment
[0136] Primers were designed as 8DE-F / 8DE-R (SEQ ID No. 9 / SEQ ID No. 10). Using the synthesized RtΔ8DE gene as a template, PrimerStar high-fidelity polymerase (Nanjing, Novizan) was used to obtain the desired Δ8 desaturase gene fragment via PCR (according to the product instructions). The PCR procedure and product recovery method were the same as those for "S11 SdΔ9EL gene fragment amplification".
[0137] The connection reaction between the S22 gene fragment and the backbone
[0138] The pUC-IntC-HUH-TE-SdΔ9EL plasmid was digested with PacI (Nanjing BioShenggong). The digested products were recovered by agarose gel electrophoresis using the same method as described in "S11 SdΔ9EL Gene Fragment Amplification". The backbone obtained from the digestion was ligated to the RtΔ8DE fragment. The ligation and digestion methods were the same as in "Lie-up of S12 Gene Fragment and Backbone".
[0139] S23 transformation of E. coli DH5α competent cells
[0140] The transformation method was the same as that used for "S13 transformation of E. coli DH5α competent cells", and the pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8DE plasmid was successfully constructed. Figure 1 The image shows the skeleton of the recombinant plasmid pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8DE from Example 1.
[0141] The relevant gene sequences mentioned in Example 1 are as follows:
[0142] SEQ ID No. 1 SdΔ9EL gene fragment:
[0143]
[0144] SEQ ID No. 2 RtΔ8DE gene fragment:
[0145]
[0146] SEQ ID No. 7:
[0147] CACAGGGAACCCGAAAACTAAGCCACCATGACCTCTCACGCCAAGGG
[0148] SEQ ID No. 8:
[0149] GCGTGACATAACTAATTACATGATCATGCTGCTTTCGCCTTGG
[0150] SEQ ID No. 9:
[0151] CCCCAAGTCGCTCGTTCAACAATGGCCGATGCCACCCCTGC
[0152] SEQ ID No. 10:
[0153] CACAAGTTCCGTAGTTGGATCTCAATGTTGGAGCTCGCCCTTG
[0154] Example 2: Construction of recombinant plasmid pUC-SCP2-HUH-TE-NoΔ5DE-PaΔ17DE
[0155] This embodiment describes a method for constructing the recombinant plasmid pUC-SCP2-HUH-TE-NoΔ5DE-PaΔ17DE, which includes the following steps:
[0156] Construction of S1 recombinant plasmid pUC-SCP2-HUH-TE-NoΔ5DE
[0157] S11 NoΔ5DE gene fragment amplification
[0158] Primers were designed as 5DE-F / 5DE-R (SEQ ID No. 11 / SEQ ID No. 12), and the NoΔ5DE gene synthesized by the company was used as a template. PrimerStar high-fidelity polymerase (Nanjing, Novizan) was used to obtain the desired Δ5 desaturase gene fragment by PCR (according to the product instructions). The enzyme digestion reaction and product recovery were the same as in S11 of Example 1.
[0159] S12 connection reaction
[0160] The pUC-SCP2-HUH-TE plasmid (disclosed in patent publication CN 119432633A) was digested using BamHI (Nanjing Biotech). The digested plasmid backbone was then ligated with the NoΔ5DE gene fragment. The ligation and digestion methods were the same as in S12 of Example 1.
[0161] S13 transformed E. coli DH5α competent cells
[0162] Following the same procedure as S13 in Example 1, the pUC-SCP2-HUH-TE-NoΔ5DE plasmid was successfully constructed.
[0163] Construction of S2 recombinant plasmid pUC-SCP2-HUH-TE-NoΔ5DE-PaΔ17DE
[0164] Primers designed in S21 were 17DE-F / 17DE-R (SEQ ID No. 13 / SEQ ID No. 14). Using the PaΔ17DE gene synthesized by the company as a template, the desired Δ17 desaturase gene fragment was obtained by PCR using PrimerStar high-fidelity polymerase (Nanjing, Novizan) (according to the product instructions). The enzyme digestion reaction and product recovery were the same as in S11 of Example 1.
[0165] S22 connection reaction
[0166] The pUC-SCP2-HUH-TE-NoΔ5DE plasmid was digested with PacI (Nanjing BioShenggong), and the digested plasmid backbone was ligated with the PaΔ17DE gene fragment. The ligation method and enzyme digestion method were the same as S12 in Example 1.
[0167] S23 transformation of E. coli DH5α competent cells
[0168] Following the same procedure as S13 in Example 1, the pUC-SCP2-HUH-TE-NoΔ5DE-PaΔ17DE plasmid was successfully constructed. Figure 2 The image shows the skeleton of the recombinant plasmid pUC-SCP2-HUH-TE-NoΔ5DE-PaΔ17DE from Example 2.
[0169] The relevant gene sequences mentioned in Example 2 are as follows:
[0170] SEQ ID No. 3 NoΔ5DE gene sequence:
[0171]
[0172] SEQ ID No. 4 PaΔ17DE gene sequence:
[0173]
[0174] SEQ ID No. 11:
[0175] GTATAAGAATCATTCAAAATGCCATTGACAAGGCTGC
[0176] SEQ ID No. 12:
[0177] CGTGACATAACTAATTACATGATCAATGGAGCTTCTTCTCTC
[0178] SEQ ID No. 13:
[0179] CACAAGACATATCTACAGCAATGGCTGTAGAGGCCAATTTG
[0180] SEQ ID No. 14:
[0181] CAACACAAGTTCCGTAGTTGGATCTCATTTAGCCCGAGCAGGAG
[0182] Example 3: Construction of recombinant plasmid pUC-intF3-HUH-TE-SpG6PDH
[0183] This embodiment describes a method for constructing the recombinant plasmid pUC-intF3-HUH-TE-SpG6PDH, which includes the following steps:
[0184] S1 SpG6PDH gene fragment amplification
[0185] Primers were designed as G6PDH-F / G6PDH-R (SEQ ID No. 15 / SEQ ID No. 16), and the SpG6PDH gene synthesized by the company was used as a template. PrimerStar high-fidelity polymerase (Nanjing, Novizan) was used to obtain the desired SpG6PDH gene fragment by PCR (according to the product instructions). The enzyme digestion reaction and product recovery were the same as in S11 of Example 1.
[0186] S12 connection reaction
[0187] The pUC-intF3-HUH-TE plasmid (disclosed in patent publication number CN 119432633A) was digested with BamHI (Nanjing Biotech). The digested plasmid backbone was then ligated to the SpG6PDH gene fragment. The ligation and digestion methods were the same as in S12 of Example 1.
[0188] S13 transformed E. coli DH5α competent cells
[0189] Following the same procedure as S13 in Example 1, the pUC-intF3-HUH-TE-SpG6PDH plasmid was successfully constructed. Figure 3 The image shows the backbone of the recombinant plasmid pUC-intF3-HUH-TE-SpG6PDH in Example 3.
[0190] The relevant gene sequences mentioned in Example 3 are as follows:
[0191] SEQ ID No. 5 SpG6PDH gene sequence:
[0192]
[0193] SEQ ID No. 15:
[0194] GTGACATAACTAATTACATGATCACTTCTTTCTGGATTCCTTCC
[0195] SEQ ID No. 16:
[0196] CTGAGTATAAGAATCATTCAAAATGCTAGACCAGATGATGTCTG
[0197] Example 4: Construction of recombinant plasmid pUC-intF3-HUH-TE-SpME2
[0198] This embodiment describes a method for constructing the recombinant plasmid pUC-intF3-HUH-TE-SpME2, which includes the following steps:
[0199] Amplification of the S1SpME2 gene fragment
[0200] Primers were designed as ME2-F / ME2-R (SEQ ID No. 17 / SEQ ID No. 18), and the synthesized SpME2 gene was used as a template. PrimerStar high-fidelity polymerase (Nanjing, Novizan) was used to obtain the desired SpME2 gene fragment via PCR (according to the product instructions). The enzyme digestion reaction and product recovery were the same as in S11 of Example 1.
[0201] S22 connection reaction
[0202] The pUC-intF3-HUH-TE plasmid (disclosed in patent publication number CN 119432633A) was digested with BamHI (Nanjing Biotech). The digested plasmid backbone was then ligated to the SpME2 gene fragment. The ligation method and digestion method were the same as in S12 of Example 1.
[0203] S23 transformation of E. coli DH5α competent cells
[0204] Following the same procedure as S13 in Example 1, the pUC-intF3-HUH-TE-SpME2 plasmid was successfully constructed. Figure 4 This is a skeleton diagram of the recombinant plasmid pUC-intF3-HUH-TE-SpME2 in Example 4.
[0205] The relevant gene sequences mentioned in Example 4 are as follows:
[0206] SEQ ID No. 6 SpME2 gene sequence:
[0207]
[0208] SEQ ID No. 17:
[0209] GTAAGCGTGACATAACTAATTACATGATCACGTCCGGGTCCACATAG
[0210] SEQ ID No. 18
[0211] CCTTCTGAGTATAAGAATCATTCAAAATGATCGCCAGGGCGGCCCG
[0212] Example 5: Construction of recombinant plasmid pUC-intF3-HUH-TE-SpG6PDH-SpME2
[0213] This embodiment describes a method for constructing the recombinant plasmid pUC-intF3-HUH-TE-SpG6PDH-SpME2, which includes the following steps:
[0214] Construction of S1 recombinant plasmid pUC-intF3-HUH-TE-SpG6PDH
[0215] S11 SpG6PDH gene fragment amplification
[0216] Primers were designed as G6PDH-F / G6PDH-R (SEQ ID No. 15 / SEQ ID No. 16), and the SpG6PDH gene synthesized by the company was used as a template. PrimerStar high-fidelity polymerase (Nanjing, Novizan) was used to obtain the desired SpG6PDH gene fragment by PCR (according to the product instructions). The enzyme digestion reaction and product recovery were the same as in S11 of Example 1.
[0217] S12 connection reaction
[0218] The pUC-intF3-HUH-TE plasmid (disclosed in patent publication number CN 119432633A) was digested with BamHI (Nanjing Biotech). The digested plasmid backbone was then ligated to the SpG6PDH gene fragment. The ligation and digestion methods were the same as in S12 of Example 1.
[0219] S13 transformed E. coli DH5α competent cells
[0220] Following the same procedure as S13 in Example 1, the pUC-intF3-HUH-TE-SpG6PDH plasmid was successfully constructed.
[0221] Construction of S2 recombinant plasmid pUC-intF3-HUH-TE-SpG6PDH-SpME2
[0222] Primers designed for S21 were ME2-F / ME2-R (SEQ ID No. 19 / SEQ ID No. 20), respectively. Using the synthesized SpME2 gene as a template, the desired SpME2 gene fragment was obtained by PCR using PrimerStar high-fidelity polymerase (Nanjing, Novizan) (according to the product instructions). The enzyme digestion reaction and product recovery were the same as in S11 of Example 1.
[0223] S22 connection reaction
[0224] The pUC-intF3-HUH-TE-SpG6PDH plasmid was digested with PacI (Nanjing BioShenggong), and the digested plasmid backbone was ligated to the SpME2 gene fragment. The ligation method and digestion method were the same as in S12 of Example 1.
[0225] S23 transformation of E. coli DH5α competent cells
[0226] Following the same procedure as S13 in Example 1, the pUC-intF3-HUH-TE-SpG6PDH-SpME2 plasmid was successfully constructed. Figure 5 The image shows the skeleton of the recombinant plasmid pUC-intF3-HUH-TE-SpG6PDH-SpME2 in Example 5.
[0227] The relevant gene sequences mentioned in Example 5 are as follows:
[0228] SEQ ID No. 19:
[0229] CATCAACACAAGTTCCGTAGTTGGATCTCACCGTCCGGGTCCACATAG
[0230] SEQ ID No. 20:
[0231] CTTACACACAAGACATATCTACAGCAATGATCGCCAGGGCGGCCCG
[0232] Example 6: Construction of an engineered strain of Yersinia lipophila for EPA production
[0233] This embodiment describes a method for constructing an engineered strain of Yersinia lipophila for producing EPA, which mainly includes the following steps performed in sequence:
[0234] Construction of the S1 engineered Yersinia lipophila strain (Po1f-ΔURA)
[0235] The uracil auxotrophic yeast *Yarrowia lipolytica* Polf (Po1f-ΔURA) was constructed by knocking out the uracil-encoding gene in *Yarrowia lipolytica* Po1f using CRISPR / Cas9 technology. The specific construction method was based on the method described in the paper "Harnessing *Yarrowia lipolytica* Peroxisomes as a Subcellular Factory for α-Humulene Overproduction" published in the *Journal of Agricultural and Food Chemistry*, Vol. 69, No. 46, 2021, pp. 13831-13837.
[0236] After the strain was constructed, it was inoculated into 5 mL of YPD liquid medium and cultured at 28°C and 280 rpm for 24 h to obtain the culture medium. 5 μL of the culture medium was streaked onto YPD solid medium containing 1 g / L pentafluoroorotic acid (5-FOA). The solid medium was then incubated at 28°C. Under the action of 5-FOA, the strain discards uracil, allowing for the recycling of the selection marker. After single colonies grew, they were streaked onto YPD solid medium for activation. The solid medium was then incubated at 28°C for 72 h to obtain the engineered *Yarrowia lipolytica* strain Polf (Po1f-ΔURA).
[0237] Construction of S2 Yersinia lipophila strain Po1f-A1
[0238] A single colony of the Po1f-ΔURA strain on YPD solid medium was picked and inoculated into 5 mL of YPD liquid medium. The colony was then cultured at 28°C and 280 rpm for 18 h to obtain the culture medium.
[0239] Take 2 mL of culture medium, centrifuge at 4000 g for 3 min at 4℃, collect the bacterial cells, add 5 μL of salmon extract (1 M) preheated to 95℃, 5 μL of DTT (1 mol / L) at room temperature, 5 μL of lithium acetate (2 mol / L) at room temperature, 80 μL of PEG 4000 at room temperature, and 10 μL of pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8DE plasmid digested with enzymes. After mixing, place in a 37℃ water bath, shaking every 15 minutes, for one hour. Spread onto YNB solid medium. The YNB solid medium formula is: YNB (amino acid-free and ammonium sulfate-free) 1.7 g / L, ammonium sulfate 5 g / L, glucose 20 g / L, agar 30 g / L. The lithium acetate conversion method of Yeast lipolyticis was prepared according to the method described in the paper "High-efficiency yeast transformation using the LiAc / SS carrier DNA / PEG method" published in Nature Protocols, Vol. 2, 2007, pp. 31-34.
[0240] After transformants grow on YNB plates, colony PCR and Sanger sequencing are performed to verify the integration of the gene. The selected positive strain is the engineered strain Po1f-A1.
[0241] Construction of S3 Yersinia lipophila strain Po1f-A2
[0242] The selection marker URA was removed from the engineered Yersinia lipophila strain Po1f-A1, using the same method as in Example 4S1. The final strain obtained was Po1f-A1-ΔURA.
[0243] Single colonies of the Po1f-A1-ΔURA strain on YPD solid medium were picked and inoculated into 5 mL of YPD liquid medium. The cultures were then incubated at 28°C and 280 rpm for 18 h to obtain the culture medium. The linearly digested pUC-SCP2-HUH-TE-NoΔ5DE-PaΔ17DE plasmid was then transformed into the Po1f-A1-ΔURA strain using the lithium acetate yeast transformation method, yielding the Yeast lipolyticis Po1f-A2 strain. The transformation method was the same as in section S2 of Example 6.
[0244] After transformants grew on YNB plates, they were verified by colony PCR and Sanger sequencing to ensure correct gene integration. The selected positive strains were the engineered strain Po1f-A2.
[0245] The selection marker URA was removed from the engineered Yersinia lipophila strain Po1f-A2, using the same method as in Example 6S1. The final strain was Po1f-A2-ΔURA.
[0246] Example 7: Construction of an exogenous cofactor-enhanced lipophilic Yersinia strain
[0247] A single colony of the Po1f-A2-ΔURA strain on YPD solid medium was picked and inoculated into 5 mL of YPD liquid medium. The colony was then cultured at 28°C and 280 rpm for 18 h to obtain the culture medium.
[0248] Construction of S1 exogenous cofactor-enhanced lipolytic yeast engineered strain Po1f-A3
[0249] The pUC-intF3-HUH-TE-SpG6PDH plasmid, which was linearized by enzyme digestion, was transformed into the Po1f-A2-ΔURA strain using the lithium acetate yeast transformation method to obtain the Yersinia lipolyticis Po1f-A3 strain. The transformation method was the same as in section S2 of Example 6.
[0250] After transformants grew on YNB plates, they were verified by colony PCR and Sanger sequencing to ensure correct gene integration. The selected positive strains were the engineered strain Po1f-A3.
[0251] Construction of S2 exogenous cofactor-enhanced lipophilic yeast engineered strain Po1f-A4
[0252] The pUC-intF3-HUH-TE-SpME2 plasmid, which was linearized by enzyme digestion, was transformed into the Po1f-A2-ΔURA strain using the lithium acetate yeast transformation method to obtain the Yersinia lipolyticis Po1f-A4 strain. The transformation method was the same as in section S2 of Example 6.
[0253] After transformants grow on YNB plates, colony PCR and Sanger sequencing are performed to verify the correct gene integration. The selected positive strain is the engineered strain Po1f-A4.
[0254] Construction of S3 exogenous cofactor-enhanced lipolytic yeast engineered strain Po1f-A5
[0255] The pUC-intF3-HUH-TE-SpG6PDH-SpME2 plasmid, which was linearized by enzyme digestion, was transformed into the Po1f-A2-ΔURA strain using the lithium acetate yeast transformation method to obtain the Yersinia lipolyticis Po1f-A5 strain. The transformation method was the same as in section S2 of Example 6.
[0256] After transformants grew on YNB plates, colony PCR and Sanger sequencing were performed for verification. Colony PCR primer sequences were designed as TEST-L-A5-F / TEST-L-A5-R (SEQ ID No. 21 / SEQ ID No. 22) and TEST-R-A5-F / TES TR-A5-R (SEQ ID No. 23 / SEQ ID No. 24) to verify whether the target gene and the left and right homologous arms were successfully ligated. The enzyme used for colony PCR was Novizan 2xRapid Taq Master Mix, and the system and temperature were performed according to the manufacturer's instructions. After PCR amplification, the PCR products were verified by agarose gel chromatography. The band sizes were 3790 bp and 2481 bp, respectively. Figure 6 , Figure 7 The results were in line with experimental expectations. The PCR was sent to the company for sequencing to verify the sequence correctness. It was finally proven that the target gene was successfully integrated into the inF3 site, and the engineered strain Po1f-A5 was finally constructed.
[0257] The relevant gene sequences mentioned in Example 7 are as follows:
[0258] SEQ ID No. 21:
[0259] GGACTCACCGTCTCCTAGTC
[0260] SEQ ID No. 22:
[0261] CCAAGCACACTCATAGTTGG
[0262] SEQ ID No. 23:
[0263] GGTGGTCTTTTATACCCTTGGC
[0264] SEQ ID No. 24:
[0265] TGCTGCTCGTCTGCCCAAAC
[0266] Example 8: Fermentation production of EPA and lipids using engineered Yersinia lipophila strains Po1f-A2, Po1f-A3, Po1f-A4, and Po1f-A5.
[0267] Activation of S1 engineered Yersinia lipophila strains Po1f-A2, Po1f-A3, Po1f-A4, and Po1f-A5
[0268] Engineered *Yarrowia lipolyticis* strains Po1f-A2, Po1f-A3, Po1f-A4, and Po1f-A5 were streaked onto YPD solid medium and cultured at 30°C for 72 h. Single colonies were picked and inoculated into YPD liquid medium and cultured at 28°C and 280 rpm for 24 h to obtain the fermentation seed culture. YPD liquid medium had a pH of 6.5 and consisted of 10 g / L yeast extract, 20 g / L peptone, and 20 g / L glucose, with water as the solvent. It was sterilized at 115°C for 30 minutes.
[0269] Fermentation of S2 engineered Yersinia lipolyticis strains Po1f-A2, Po1f-A3, Po1f-A4, and Po1f-A5
[0270] The seed culture was inoculated into 50 mL of fermentation medium at a ratio of 5%, and cultured in a shaker at 30℃ and 220 rpm for 120 h to obtain the fermentation broth. Fermentation medium: pH 6.5, consisting of 1.7 g / L amino acid-free and ammonium sulfate-free YNB, 2.5 g / L yeast extract, 60 g / L glucose, and pure water as solvent; sterilized at 115℃ for 30 minutes.
[0271] S3 fermentation product analysis
[0272] After fermentation, 30 mL of fermentation broth was placed in a pre-weighed 50 mL centrifuge tube and centrifuged at 4000 g for 5 min. The resulting bacterial cells were then freeze-dried in a freeze dryer for 48 h. The freeze-dried sample was then placed in a drying oven and dried to constant weight. The weight was measured, and the weight of the empty centrifuge tube was subtracted to obtain the dry weight of the bacterial cells.
[0273] After fermentation, 200 μL of fermentation broth was taken and centrifuged at 4000g for 5 min. The resulting cells were then freeze-dried for 48 h. The freeze-dried sample was then removed and 500 μL of NaOH-methanol solution (1M) was added. The mixture was shaken in a shaker for 6 h. After shaking, 40 μL of concentrated sulfuric acid was added to terminate the methyl esterification. Then, 100 μL of methyl undecanoate solution (2 g / L) was added as an internal standard. Finally, 500 μL of n-hexane was added for extraction, and the mixture was shaken in a shaker for 2 h. The upper organic phase was collected for gas phase analysis.
[0274] The chromatographic column used in the experiment was DB-23 (60.0m × 0.25mm × 0.25μm); the detection conditions were: injection port temperature 250℃, injection volume 1.0μL, split ratio 69.8:1; the chromatographic conditions were: initial temperature 100℃, increased to 196℃ at 25℃ / min, followed by an increase to 220℃ at 2℃ / min and holding for 21 min.
[0275] After the gas chromatography analysis was completed, different fatty acids were identified by comparison with relevant external standards (Sigma, USA). In this gas chromatography analysis, non-endogenous fatty acids (C11:0) were used as internal standards, and the content of individual fatty acids was estimated from the peak area on the chromatogram.
[0276] The dry weight and oil yield of engineered Yersinia lipophila strains Po1f-A2, Po1f-A3, Po1f-A4, and Po1f-A5 are as follows: Figure 8 As shown;
[0277] The fatty acid compositions of engineered Yersinia lipolyticis strains Po1f-A2, Po1f-A3, Po1f-A4, and Po1f-A5 are as follows: Figure 9 As shown;
[0278] The EPA production of engineered Yersinia lipophila strains Po1f-A2, Po1f-A3, Po1f-A4, and Po1f-A5 is as follows: Figure 10 As shown;
[0279] Depend on Figure 8 It was found that, in terms of cell dry weight, compared with the engineered strain Po1f-A2, the dry weight of the Po1f-A3, Po1f-A4, and Po1f-A5 engineered strains increased from 7.67 g / L to 9.83 g / L, 10.33 g / L, and 11.67 g / L, respectively. This indicates that the expression of exogenous cofactor genes does not inhibit the growth of the strains; on the contrary, it increases the dry weight of the strains by 28.22%, 34.78%, and 52.17%, respectively. In terms of lipid content, compared with the Po1f-A2 engineered strain, the lipid yield of the Po1f-A3, Po1f-A4, and Po1f-A5 engineered strains increased from 0.78 g / L to 1.35 g / L, 1.90 g / L, and 2.76 g / L, respectively. This indicates that the introduction of exogenous cofactors can significantly increase the lipid yield of the *Yersinia lipolytica* strains. Compared with the Po1f-A2 engineered strain, the oil yields of the Po1f-A3, Po1f-A4, and Po1f-A5 engineered strains increased by 71.18%, 141.49%, and 251.22%, respectively.
[0280] Depend on Figure 9It can be seen that, regarding the fatty acid profile, compared with the engineered strain Po1f-A2, the engineered strains Po1f-A3, Po1f-A4, and Po1f-A5 showed significant changes in some fatty acids. For example, the C16:0 and C18:1 ratios were significantly increased in the Po1f-A5 strain, and the C18:1, C18:2, and C20:2 ratios were significantly increased in the Po1f-A3 strain. However, compared with the Po1f-A2 strain, the EPA ratios in the Po1f-A3, Po1f-A4, and Po1f-A5 strains did not change significantly, and may have decreased slightly, possibly due to the increased lipid content.
[0281] Depend on Figure 10 It can be seen that, regarding EPA production, compared with the Po1f-A2 engineered strain, the EPA production of the Po1f-A3, Po1f-A4, and Po1f-A5 engineered strains increased from 0.22 g / L to 0.39 g / L, 0.54 g / L, and 0.79 g / L, respectively. This indicates that although overexpression of exogenous cofactor genes does not lead to an increase in the proportion of EPA fatty acids, it can lead to a significant increase in lipid content, thereby further increasing EPA production. Compared with the Po1f-A2 engineered strain, the EPA production of the Po1f-A3, Po1f-A4, and Po1f-A5 engineered strains increased by 73.03%, 137.25%, and 252.40%, respectively.
[0282] Compared to previously published patents, this invention first introduces exogenous partial elongation and desaturase genes (Δ9 elongase, Δ8 desaturase, Δ5 desaturase, and Δ17 desaturase genes) into *Yersinia lipolytica* Po1f, obtaining the engineered strain Po1f-A2 capable of producing EPA. The Po1f-A2 engineered strain achieved an oil content of 0.78 g / L and an EPA yield of 0.22 g / L. Based on this, glucose-6-phosphate dehydrogenase (G6PDH) and malate enzyme (ME) from *Schizochytrium HX-308* were simultaneously overexpressed to construct the *Yersinia lipolytica* engineered strain Po1f-A5. The Po1f-A5 engineered strain achieved a cell dry weight of 11.67 g / L, an oil yield of 2.76 g / L, and an EPA yield of 0.79 g / L, representing increases of 52.17%, 251.22%, and 252.40%, respectively, compared to the Po1f-A2 engineered strain.
[0283] Compared to the patent with publication number CN119432633A, this invention, through overexpression of the glucose-6-phosphate dehydrogenase gene (SpG6PDH) and malic acid enzyme gene (SpME2) from Schizochytrium in *Yarrowia lipolytica* Po1f, constructs an engineered strain Po1f-A5, achieving an oil yield of 2.76 g / L, with the oil rich in 0.79 g / L EPA. In contrast, overexpression of endogenous malic acid enzyme (ME) and glucose-6-phosphate dehydrogenase (G6PDH) in *Yarrowia lipolytica* only yields an oil yield of 1.772 g / L.
[0284] Therefore, by combining the overexpression of exogenous cofactors glucose-6-phosphate dehydrogenase (G6PDH) and malate enzyme (ME), this invention obtained a cofactor-enhanced lipophilic yeast strain Po1f-A5. This strain can produce more oil during fermentation and has a significantly increased EPA content, which has higher industrial application value and provides new ideas and research strategies for the subsequent industrial production of EPA by Schizochytrium.
[0285] Although embodiments of the invention have been disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, variations, and modifications are possible without departing from the spirit and scope of the invention and the appended claims. Therefore, the scope of the invention is not limited to the contents disclosed in the embodiments.
Claims
1. A Yersinia lipolyticis strain with exogenous cofactor enhancement, characterized in that: The chassis strain of the Yersinia lipolytica strain is Yersinia lipolytica Po1f, and this strain overexpresses some elongation desaturases in the fatty acid synthesis pathway, mainly including the genes for Δ9 elongase, Δ8 desaturase, Δ5 desaturase and Δ17 desaturase. On this basis, glucose-6-phosphate dehydrogenase (G6PDH) and malate (ME) are also overexpressed.
2. The exogenous cofactor-enhanced lipophilic Yersinia strain according to claim 1, characterized in that: The Δ9 elongase is derived from Saprolegnia diclina (SdΔ9EL), and its gene sequence is shown in SEQ ID No. 1; The Δ8 desaturase is derived from Rhodotorula toruloides NP11 (RtΔ8DE), and its gene sequence is shown in SEQ ID No. 2; The Δ5 desaturase is derived from Nannochloropsis oceanica (NoΔ5DE), and its gene sequence is shown in SEQ ID No. 3; The Δ17 desaturase is derived from Parietichytrium sp (PaΔ17DE), and its gene sequence is shown in SEQ ID No. 4; The glucose-6-phosphate dehydrogenase is derived from Schizochytrium sp. HX-308 (SpG6PDH), and its gene sequence is shown in SEQ ID No. 5; The malicase is derived from Schizochytrium sp. HX-308 (SpME2), and its gene sequence is shown in SEQ ID No.
6.
3. The application of the exogenous cofactor-enhanced lipophilic yeast strain as described in claim 1 or 2 in the production of EPA and oils.
4. The method for constructing the exogenous cofactor-enhanced lipophilic Yersinia strain as described in claim 1 or 2, characterized in that: Includes the following steps: Construction of S1 recombinant plasmid pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8DE Using plasmid pUC-IntC-HUH-TE as a backbone, the SdΔ9EL and RtΔ8DE genes were inserted into the backbone to obtain the recombinant plasmid pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8DE. Construction of S2 recombinant plasmid pUC-SCP2-HUH-TE-NoΔ5DE-PaΔ17DE Using plasmid pUC-SCP2-HUH-TE as a backbone, the NoΔ5DE and PaΔ17DE genes were inserted into the backbone to obtain the recombinant plasmid pUC-SCP2-HUH-TE-NoΔ5DE-PaΔ17DE. Construction of S3 recombinant plasmid pUC-intF3-HUH-TE-SpG6PDH Using plasmid pUC-intF3-HUH-TE as a backbone, the SpG6PDH gene was inserted into the backbone to obtain the recombinant plasmid pUC-intF3-HUH-TE-SpG6PDH; Construction of S4 recombinant plasmid pUC-intF3-HUH-TE-SpME2 Using plasmid pUC-intF3-HUH-TE as a backbone, the SpME2 gene was inserted into the backbone to obtain the recombinant plasmid pUC-intF3-HUH-TE-SpME2; Construction of S5 recombinant plasmid pUC-intF3-HUH-TE-SpG6PDH-SpME2 Using plasmid pUC-intF3-HUH-TE-SpG6PDH as a backbone, the SpME2 gene was inserted into the backbone to obtain the recombinant plasmid pUC-intF3-HUH-TE-SpG6PDH-SpME2; Construction of S6 engineered Yersinia lipophila strain for EPA production The plasmid pUC-IntC-HUH-TE-SdΔ9EL-RtΔ8DE was transformed into the uracil-auxotrophic *Yersinia lipolytica* strain Po1f (Po1f-ΔURA) to obtain recombinant *Yersinia lipolytica* strain 1, Po1f-A1. Po1f-A1 was inoculated into YPD solid medium containing 1 g / L 5-FOA. After single-cell growth, it was streaked again in YPD solid medium for activation, yielding *Yersinia lipolytica* Po1f-A1-ΔURA. Particle pUC-SCP2-HUH-TE-NoΔ5DE-PaΔ17DE was transferred into the recombinant strain Po1f-A1-ΔURA of *Yersinia lipolytica* to obtain recombinant strain 2, namely Po1f-A2, which is the *Yersinia lipolytica* engineered strain capable of producing EPA. Po1f-A2 was inoculated into YPD-5FOA solid medium. After single cells grew, it was streaked again in YPD solid medium to activate it, thus obtaining *Yersinia lipolytica* Po1f-A2-ΔURA. Construction of S7 exogenous cofactor-enhanced lipophilic yeast strain Po1f-A3 The plasmid pUC-intF3-HUH-TE-SpG6PDH was transformed into the recombinant Yersinia lipolytica strain Po1f-A2-ΔURA to obtain recombinant Yersinia lipolytica strain 3, namely Po1f-A3, which is the exogenous cofactor-enhanced Yersinia lipolytica engineered strain Po1f-A3. Construction of S8 exogenous cofactor-enhanced lipophilic yeast strain Po1f-A4 The plasmid pUC-intF3-HUH-TE-SpME2 was transformed into the recombinant Yersinia lipolytica strain Po1f-A2-ΔURA to obtain the recombinant Yersinia lipolytica strain 4, namely Po1f-A4, which is the exogenous cofactor-enhanced Yersinia lipolytica engineered strain Po1f-A4. Construction of S9 exogenous cofactor-enhanced lipophilic yeast strain Po1f-A5 The plasmid pUC-intF3-HUH-TE-SpG6PDH-SpME2 was transformed into the recombinant Yersinia lipolytica strain Po1f-A2-ΔURA to obtain recombinant Yersinia lipolytica strain 5, namely Po1f-A5, which is the exogenous cofactor-enhanced Yersinia lipolytica engineered strain Po1f-A5.
5. The construction method according to claim 4, characterized in that: During strain construction, the promoters of each extended desaturase gene expression cassette were P. TEF promoter, P EXP promoter, P FBA promoter or P YAT One type of promoter, with T as the terminator. CYC1t Termination, T xpr2t One of the terminators; Alternatively, in step S6, the strain transformation method is achieved through lithium acetate transformation.
6. A method for producing EPA and lipids by fermentation using the engineered strain of *Yarrowia lipolyticis* as described in claim 1 or 2, characterized in that: Includes the following steps: In the process of fermenting and producing EPA and lipids using the engineered strain of Yersinia lipophila, a shaker culture is used at a temperature of 28-30℃, a fermentation time of 96-120h, and a shaker speed of 180-220rpm.
7. The method according to claim 6, characterized in that: The specific steps are as follows: Activation of S1 Yersinia lipophila engineered strain The engineered Yersinia lipolyticis was streaked onto YPD solid medium and cultured in an incubator at 30°C for 72 h; a single colony was picked and inoculated into YPD liquid medium and cultured in a shaker at 28°C and 280 r / min for 24 h to obtain the fermentation seed liquid; Fermentation of S2 lipophilic yeast engineered strain The fermentation seed liquid was inoculated into the fermentation medium at a ratio of 5%, and cultured in a shaker at 30℃ and 220r / min for 120h to obtain the fermentation broth.
8. The method according to claim 6, characterized in that: The YPD liquid culture medium has a pH of 6.5 and consists of 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, and water as the solvent. It is sterilized at 115°C for 30 minutes. Among them, YPD plate medium is YPD liquid medium with 2% agar added to the final concentration; The fermentation medium is: pH 6.5, consisting of 1.7 g / L of amino acid-free and ammonium sulfate-free YNB, 2.5 g / L of yeast extract, 60 g / L of glucose, and pure water as solvent, sterilized at 115°C for 30 minutes.
9. The method according to any one of claims 6 to 8, characterized in that: The method further includes the following steps: S3 fermentation product analysis After fermentation, 30 mL of fermentation broth was placed into a pre-weighed 50 mL centrifuge tube and centrifuged at 4000 g for 5 min. The resulting bacterial cells were then freeze-dried in a freeze dryer for 48 h. The freeze-dried samples were then placed in a drying oven and dried to constant weight. The weight was measured and the weight of the empty centrifuge tube was subtracted to obtain the dry weight of the bacterial cells. After fermentation, 200 μL of fermentation broth was centrifuged at 4000g for 5 min, and the resulting cells were freeze-dried for 48 h. The freeze-dried sample was then removed and 500 μL of 1M NaOH-methanol solution was added, followed by shaking in a shaker for 6 h. After shaking, 40 μL of concentrated sulfuric acid was added to terminate methyl esterification, followed by 100 μL of 2 g / L methyl undecanoate solution as an internal standard. Then, 500 μL of n-hexane was added for extraction, followed by shaking in a shaker for 2 h. The upper organic phase was collected for gas phase analysis.
Citation Information
Patent Citations
Microbial engineering for the production of fatty acids and fatty acid derivatives
CN102869768A
Yarrowia lipolytica engineering strain for efficiently producing eicosapentaenoic acid through cofactor strategy, construction method and application
CN119432633A
Pentose phosphate pathway upregulation to increase production of non-native products of interest in transgenic microorganisms
WO2011123407A2
Cited By
Yarrowia lipolytica engineering strain for efficiently producing eicosapentaenoic acid based on citric acid metabolism regulation, method and application
CN120924417A
A yarrowia lipolytica engineering strain based on citric acid metabolism regulation for efficient production of eicosapentaenoic acid, method and application
CN120924417B