Method for improving yield of ergothioneine in cordyceps militaris by quorum sensing system formed by engineering pheromones

Abstract

The invention discloses a method for increasing the yield of ergothioneine in cordyceps militaris by using a quorum sensing system formed by engineering pheromones, which comprises the following steps: driving overexpression of a key gene egt2 for biosynthesis of ergothioneine in a cordyceps militaris genome by using the engineering quorum sensing system, and carrying out fermentation culture on a recombinant cordyceps militaris strain, activating an ergothioneine synthesis pathway through a density dependent type autonomous induction mechanism to obtain mycelium with increased ergothioneine content; the engineered quorum sensing system is formed by reconstructing and adapting an aromatic amino acid inducible ARO9 gene promoter, a Kluyveromyces lactis alpha-pheromone polypeptide Kmf alpha 1 gene and a pheromone response type promoter FUS1 in cordyceps militaris. Compared with wild cordyceps militaris, the strain treated by the method has the advantages that the intracellular ergothioneine yield of over-expressed strain mycelia is about two times, and the growth of the mycelia cannot be inhibited.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to a method for improving the yield of ergothionein in Cordyceps militaris using a quorum sensing system composed of engineered pheromones. Background Technology

[0002] Dynamic regulation is a strategy to maximize the yield of microbial secondary metabolites by balancing cell growth and metabolite synthesis fluxes. In microbial secondary metabolite biosynthesis pathways, the expression of key genes often competes with resources required for cell growth, inhibiting cell growth and ultimately limiting product titers. Dynamic regulation systems redirect metabolic fluxes from growth pathways to target product synthesis pathways during the mid-fermentation stage by placing key genes in secondary metabolic pathways under inducible regulatory elements, utilizing exogenous inducers or autonomous induction mechanisms based on metabolic responses. Therefore, designing effective dynamic regulation systems is crucial for optimizing microbial cell performance, with key gene regulation initiated at the appropriate time after the cell growth stage. However, the process of adding exogenous inducers is cumbersome and difficult to control precisely. In contrast, autonomous induction dynamic regulation strategies are more advantageous and can be achieved through metabolite-responsive promoters, biosensor design, or integration of cell density-based quorum sensing (QS) systems. Quorum sensing is a communication mechanism in which microorganisms monitor population density and coordinate gene expression by secreting and sensing signaling molecules (self-inducers). During growth, when the concentration of signaling molecules reaches a critical threshold, a coordinated response at the population level can be triggered, regulating gene expression and stabilizing cell density, thereby significantly improving the efficiency of metabolic engineering.

[0003] In *Saccharomyces cerevisiae*, the accumulation of factor alpha pheromone (MFα1) reaches a threshold that regulates downstream gene expression. However, the high affinity between MFα1 and its response promoter may lead to premature activation of the signaling pathway, i.e., triggering before sufficient biomass accumulation. In contrast, the pheromone (Kmfα1) of *Kluyveromyces lactis* has a lower affinity for its response promoter FUS1, effectively avoiding growth inhibition caused by premature response. Therefore, introducing Kmfα1 as an engineered pheromone can construct a superior quorum sensing signaling pathway.

[0004] Ergothioneine (EGT) is a naturally occurring sulfur-containing amino acid derivative, renowned as a "longevity vitamin" or "super antioxidant" due to its powerful antioxidant, anti-inflammatory, and anti-apoptotic biological activities. EGT is a secondary metabolite of fungi, actinomycetes, and some cyanobacteria. Cordyceps militaris is an important traditional medicinal fungus, rich in cordycepin, ergothioneine, cordyceps polysaccharides, and other bioactive substances. It exhibits significant advantages in large-scale fermentation production, including rapid growth, convenient genetic manipulation, and relatively low cost, and has accumulated a rich foundation for molecular biology and genetic engineering research. Summary of the Invention

[0005] To address the above problems, the present invention aims to provide a method for improving the yield of ergothionein from Cordyceps militaris using a quorum sensing system composed of engineered pheromones.

[0006] The method of this invention includes the construction of an engineered quorum sensing (QS) system signaling pathway. This is achieved by introducing a heterologous quorum sensing system core component derived from *Saccharomyces cerevisiae* into *Cordyceps militaris*, replacing the *Saccharomyces cerevisiae* pheromone *mfα1* with the low-affinity pheromone *Kluyveromyces lactis* pheromone, thus reducing its affinity for the responsive promoter *FUS1*. The key gene *egt2* in the ergothioneine (EGT) biosynthesis pathway in *Cordyceps militaris* is placed under the regulation of the Kmfα1-QS responsive promoter *FUS1*, forming a growth-production decoupled system. During fermentation, *Cordyceps militaris* secretes Kmfα1. As cell density increases, the signaling molecule accumulates to a critical concentration, activating the QS system and automatically initiating the expression of the ergothioneine synthesis gene, achieving metabolic flux redirection without exogenous inducers. This engineered quorum sensing system utilizes the low binding affinity of Kmfα1 to FUS1 to delay the activation of the QS system, ensuring that cells initiate EGT synthesis after sufficient growth and avoiding premature growth inhibition. For the first time, the hybrid QS pathway of "Saccharomyces cerevisiae receptor-Kluyveromyces lactis pheromone" was reconstructed in the filamentous fungus Cordyceps militaris, breaking through the species barrier. It achieves cell density-based autonomous induction through secretory Kmfα1, simplifying the process and reducing production costs.

[0007] The specific technical solution is as follows:

[0008] A method for improving ergothioneine production in Cordyceps militaris using an engineered quorum sensing system comprising the engineered quorum sensing system involves driving the overexpression of the key ergothioneine biosynthesis gene egt2 in the Cordyceps militaris genome, fermenting a recombinant Cordyceps militaris strain, and activating the ergothioneine synthesis pathway through a density-dependent autonomous induction mechanism to obtain mycelia with increased ergothioneine content. The engineered quorum sensing system is constructed by reconstructing and adapting the aromatic amino acid-inducible ARO9 gene promoter, the Kluyveromyces lactis α-pheromone polypeptide Kmfα1 gene, and the pheromone-responsive promoter FUS1 within Cordyceps militaris.

[0009] Furthermore, the nucleotide sequence of the aromatic amino acid-inducible ARO9 gene promoter is shown in SEQ ID NO: 1; the nucleotide sequence of the low-affinity pheromone Kmfα1 from *Kluyveromyces lactis* is shown in SEQ ID NO: 2; and the nucleotide sequence of the pheromone-responsive promoter FUS1 is shown in SEQ ID NO: 3. The interaction mechanism between the pheromone Kmfα1 and the pheromone-responsive promoter receptor FUS1 in *Kluyveromyces lactis* is the core of the quorum sensing system. Kmfα1 has a high binding constant to its receptor FUS1, requiring high concentrations to trigger the signaling pathway. By using the ARO9 promoter to drive Kmfα1 expression, the synthesis of signaling molecules is linked to the concentration of aromatic amino acids in the culture medium; only when Kmfα1 accumulates to a higher concentration can the pheromone-responsive promoter FUS1 be triggered. This places key genes in the ergothioneine synthesis pathway under the regulation of the FUS1 promoter, constructing a metabolic pathway switch.

[0010] Furthermore, the nucleotide sequence of the engineered Kmfα1 quorum sensing system is shown in SEQ ID NO: 4.

[0011] Furthermore, the nucleotide sequence of the key gene in the ergothioneine synthesis pathway, pyridoxal phosphate-dependent cysteine ​​desulfurase egt2, is shown in SEQ ID NO: 5.

[0012] Furthermore, the overexpression of key genes in the ergothioneine synthesis pathway was performed using a binary expression vector to construct a recombinant expression plasmid, the nucleotide sequence of which is composed of SEQ ID NO: 6 + SEQ ID NO: 7 linked end to end.

[0013] Furthermore, the recombinant expression plasmid was constructed using the following method:

[0014] S1: The engineered Kmfα1 quorum sensing system (*ARO9-Kmfα1-FUS1 gene fragment) shown in SEQ ID NO: 4 was inserted into the PvuII site (located upstream of the EGFP coding sequence) of the vector pCAMBIA-Tcbh1-hph-PtrpC to construct the recombinant plasmid pCAMBIA-ARO9-Kmfα1-FUS1-Tcbh1-hph-PtrpC;

[0015] S2: Amplify the plasmid pCAMBIA-ARO9-Kmfα1-FUS1-Tcbh1-hph-PtrpC obtained in step S1 using primers Vector-F / Vector-R to obtain a linearized vector fragment;

[0016] S3: Amplify the genomic DNA of Cordyceps militaris strain CM01 using primers Egt2-F / Egt2-R to obtain the target gene fragment of pyridoxal phosphate-dependent cysteine ​​desulfurase Egt2.

[0017] S4: The linearized vector from step S2 and the Egt2 gene fragment from step S3 were ligated using a seamless cloning kit to construct an Egt2 gene overexpression recombinant plasmid.

[0018] In step S1, the ARO9-Kmfα1-FUS1 gene fragment is digested with enzymes and ligated into the insertion vector pCAMBIA-Tcbh1-hph-PtrpC. The selected insertion sites are PvuII and KpnI. During the digestion of the vector, EGFP and cbh1 terminator are removed. This invention restores the fragment by synthesizing the removed EGFP and cbh1 terminator nucleotide sequences at the ends of the quorum sensing ARO9-Kmfα1-FUS1 gene fragment and then ligating them.

[0019] Furthermore, the Cordyceps militaris genetically engineered bacteria are constructed according to the following steps: a recombinant expression plasmid containing the Egt2 gene is transferred into Agrobacterium to obtain recombinant Agrobacterium; the recombinant Agrobacterium is used to infect the Cordyceps militaris host bacteria to obtain the Cordyceps militaris genetically engineered bacteria.

[0020] Furthermore, the Agrobacterium is Agrobacterium tumefaciens AGL1; the host bacterium is Cordyceps militaris CM01.

[0021] Further, the fermentation culture method of Cordyceps militaris genetically engineered bacteria is as follows: Cordyceps militaris genetically engineered bacteria containing the Egt2 gene are inoculated into Sabouraud dextrose agar containing 200 μg / mL hygromycin B, and cultured at 25℃ in the dark for 7 days. Then, colonies are picked and inoculated into a fermentation medium containing tryptophan, and cultured on a shaker at 22–25℃ and 120–180 rpm (preferably 25℃, 180 rpm) to obtain mycelia containing ergothioneine. The amount of tryptophan added to the fermentation medium is 40–80 μg / mL. Sabouraud dextrose agar consists of 10 g / L peptone, 5 g / L glucose, and distilled water as the solvent, with a natural pH. If a solid medium is to be prepared, 20 g / L agar powder is added. The fermentation medium consists of 20 g / L glucose, 10 g / L peptone, 0.5 g / L K₂HPO₄·3H₂O, and KH₂PO₄. 0.5 g / L, MgSO4·7H2O 0.5 g / L, L-glycine 1 g / L, solvent is distilled water, pH is natural.

[0022] The beneficial effects of this invention are as follows:

[0023] This invention utilizes the aromatic amino acid tryptophan in the basal culture medium to induce the ARO9 promoter to drive Kmfα1 expression. The self-secreted Kmfα1 autonomously activates the FUS1 promoter through quorum sensing, achieving zero exogenous addition. The low-affinity pheromone Kmfα1 is used to delay the pathway activation threshold to the high cell density phase, ensuring sufficient biomass accumulation. During the growth phase, the product synthesis pathway is shut down, and 100% of resources are used for biomass accumulation. During the stationary phase, the Egt2 gene expression is activated, directing the flux to the target product. Compared with wild-type Cordyceps militaris, the overexpression strain has approximately twice the intracellular ergothioneine yield in the mycelium, and does not inhibit mycelial growth. Attached Figure Description

[0024] Figure 1 This is a plasmid map after the recombinant plasmid construction in Example 1 was completed.

[0025] Figure 2 This is the Agrobacterium colony PCR result for the target gene Egt2 in Example 1.

[0026] Figure 3 This is the PCR identification result of the hygromycin B resistance gene in the recombinant engineered bacteria of Example 2.

[0027] Figure 4 The standard curve was prepared for the ergothioneine standard in Example 2.

[0028] Figure 5 The results of PCR for Agrobacterium colonies containing only the target gene Egt2 are shown in Comparative Example 1.

[0029] Figure 6 The results of PCR identification of the hygromycin B resistance gene in the recombinant engineered bacteria of Comparative Example 1 are shown.

[0030] Figure 7 Bar graph showing the intracellular ergothionein content of wild-type Cordyceps militaris strain, ARO9-Kmfα1-FUS1-Egt2 recombinant strain, and Egt2-only recombinant strain. Detailed Implementation

[0031] The present invention will be further described below with reference to specific embodiments and accompanying drawings, but the scope of protection of the present invention is not limited thereto.

[0032] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0033] (1) Culture medium used for Cordyceps militaris strain

[0034] Sabouraud medley medium: 10 g / L peptone, 5 g / L glucose, distilled water as solvent, natural pH; if you want to prepare a solid medium, add 20 g / L agar powder.

[0035] Fermentation medium: glucose 20 g / L, peptone 10 g / L, K2HPO4·3H2O 0.5 g / L, KH2PO4 0.5 g / L, MgSO4·7H2O 0.5 g / L, L-glycine 1 g / L, solvent: distilled water, pH: natural.

[0036] (2) LB medium used for bacterial strains: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, distilled water as solvent, pH 7.0; if a solid medium is to be prepared, add 20 g / L agar powder.

[0037] IM medium: KH₂PO₄ 1.45 g / L, K₂HPO₄ 2.05 g / L, MgSO₄·7H₂O 0.6 g / L, NaCl 0.1 g / L, CaCl₂ 0.01 g / L, FeSO₄ 0.001 g / L, NH₄NO₃ 0.5 g / L, glycerol 5 mL / L, MES buffer (1 mol / L, pH 5.5) 40 mL / L, trace element stock solution 5 mL / L, glucose 2 g / L, solvent is distilled water. The trace element stock solution composition is: ZnSO₄·7H₂O 0.1 g / L, CuSO₄·5H₂O 0.1 g / L, H₃BO₃ 0.1 g / L, Na₂MoO₄·7H₂O 0.1 g / L, with distilled water as the solvent; if preparing a solid culture medium, reduce the final glucose concentration to 1 g / L and add 20 g / L of agar powder.

[0038] AIM medium: IM medium containing a final concentration of 200 μmol / L acetosyringone.

[0039] Selective medium: IM solid medium containing 200 μg / mL hygromycin B, 100 μg / mL ceftriaxone sodium and 50 μg / mL kanamycin.

[0040] The construction of the binary vector pCAMBIA-PgpdA-Tcbh1-hph-PtrpC was based on: Cai Linian. Study on the directed expression of cellulase in marine Aspergillus niger and its salt and heat resistance mechanism [D]. Zhejiang University, 2021.

[0041] Example 1

[0042] Constructing a recombinant vector containing an engineered quorum sensing system and pyridoxal phosphate-dependent cysteine ​​desulfurase EGT2.

[0043] 1. Construction of recombinant expression vectors

[0044] (1) Cordyceps militaris fermentation culture

[0045] Wild Cordyceps militaris CM01 was inoculated onto Sabouraud dextrose agar and cultured at 25°C in the dark for 7 days to achieve effective activation. Next, small pieces containing mycelium were cut from the culture medium and inoculated into fermentation medium containing 100 μg / mL ceftriaxone sodium. The culture was carried out at 25°C and 180 rpm for 7 days. The mycelium was then collected by filtration, dried, and set aside. Genomic DNA was extracted from the mycelium using a rapid fungal genomic DNA extraction kit (purchased from Sangon Biotech (Shanghai) Co., Ltd., product number: B518229). The extracted DNA was dissolved in 35 μL of deionized water. The extracted DNA could be used immediately for subsequent experiments or stored at -20°C.

[0046] (2) Amplification of the target gene pyridoxal phosphate-dependent cysteine ​​desulfurase egt2

[0047] The DNA of wild-type Cordyceps militaris was amplified by PCR using the primers egt2-F / egt2-R in Table 1 and the PCR reaction system in Table 2 to obtain the target gene fragment, namely the pyridoxal phosphate-dependent cysteine ​​desulfurase Egt2 (nucleotide shown in SEQ ID NO.5) on the genomic DNA of Cordyceps militaris.

[0048] Table 1 Primers for amplification of the pyridoxal phosphate-dependent cysteine ​​desulfurase egt2 gene

[0049] Primers Primer sequence 5'to3' egt2-F ATGACCGTTACCAATCAGACAGATCTTCCC egt2-R TTAAATCTTATACTCCCCATTGGCAACGCG

[0050] Table 2 PCR amplification system

[0051] name Volume (μL) 2xHieff PCR Master Mix 25 egt2-F 2 egt2-R 2 Cordyceps militaris DNA solution 3 <![CDATA[ddH2O]]> 18 total 50

[0052] (3) Construction of an engineered Kmfα1 swarm sensing system

[0053] The ARO9 gene sequence (SEQ ID NO. 1), which is an aromatic amino acid-inducible gene promoter of Saccharomyces cerevisiae, the low-affinity pheromone Kmfα1 of Kluyveromyces lactis (SEQ ID NO. 2), and the pheromone-responsive promoter FUS1 (SEQ ID NO. 3) were sequentially linked to construct a positive feedback loop ARO9-Kmfα1-FUS1 gene sequence (SEQ ID NO. 4), which is the engineered Kmfα1 quorum sensing system.

[0054] (4) Construct a dual-element carrier containing an engineered swarm induction system and linearize it.

[0055] The PgpdA gene fragment of plasmid pCAMBIA-PgpdA-Tcbh1-hph-PtrpC (nucleotides SEQ ID NO. 6 + SEQ ID NO. 7 are sequentially linked as shown) was removed. The plasmid was cloned by gene synthesis PCR. The ARO9-Kmfα1-FUS1 gene sequence from step (3) was combined with the original pCAMBIA gene EGFP and Tcbh1-hph-PtrpC to synthesize a continuous gene sequence, thereby constructing the new plasmid pCAMBIA-ARO9-Kmfα1-FUS1-Tcbh1-hph-PtrpC. This service was provided by Beijing Qingke Biotechnology Co., Ltd. The newly constructed plasmid was amplified by PCR using primers Vector-F and Vector-R (Table 3) according to the PCR reaction system in Table 4.

[0056] The amplified product was treated with 1 μL of DpnI enzyme, and the mixture was digested at 37°C for 2 h to remove the remaining template DNA. The DpnI enzyme was then inactivated by heating at 80°C for 15 min to obtain the linearized plasmid. The product was identified by 1% agarose gel electrophoresis, and the length of the bands was used to preliminarily determine whether the sequence amplification was successful. The PCR amplification product was extracted using a SanPrep column DNA gel extraction kit (purchased from Sangon Biotech (Shanghai) Co., Ltd., product number: B518131). The linearized vector DNA solution was obtained by following the specific operating procedures of the gel extraction kit and stored at -20°C.

[0057] Table 3 Primers for vector linearization

[0058] Primers Primer sequence 5'to3' Vector-F TTCGAGCTTTCCCACTTCATGGTGA Vector-R AAGGAATAAGGGATGGGAAGTTTGA

[0059] Table 4 Linearized PCR Reaction System

[0060] name Volume (μL) 2xHieff PCR Master Mix 25 Vector-F 2 Vector-R 2 pCAMBIA 3 <![CDATA[ddH2O]]> 18 total 50

[0061] (5) Constructing recombinant expression plasmids

[0062] Using the ClonExpress Ultra One Step Cloning Kit (Nanjing Novizan Biotechnology Co., Ltd., product catalog number: C115), according to Table 5, the Egt2 gene from step (2), the linearized vector from step (4), and 2xClonExpress Mix were gently mixed and reacted at 50℃ for 5 minutes. After the reaction, the centrifuge tubes were immediately placed on ice to cool, yielding the recombinant expression vector pCAMBIA-ARO9-Kmfα1-FUS1-Egt2-EGFP, as shown in Table 5. Figure 1 As shown.

[0063] Table 5 Seamless Cloning Reaction System

[0064] name Volume (μL) 2xAssembly Mix 5 Linearized vector 2 Egt2 gene fragment 2 <![CDATA[ddH2O]]> 1 total 10

[0065] 2. Transformation of Escherichia coli DH5α

[0066] Add 5 μL of the recombinant expression vector constructed in step 1 (5) to 100 μL of *E. coli* DH5α competent cells, gently tap the tube wall to mix, and place on ice for 30 min; heat shock in a 42℃ water bath for 45 s, then cool on ice for 2 min; add 900 μL of LB liquid medium to the competent cells, and shake at 37℃ and 220 rpm for 1 h; centrifuge at 5000 rpm for 5 min, discard 900 μL of supernatant on a clean bench, and retain 100 μL of bacterial suspension; resuspend the bacterial suspension and spread it on LB solid medium plates (kanamycin concentration of 100 μg / mL), and incubate at 37℃ for 24 h. Pick single colonies and perform PCR verification using primers Ide-F / Ide-R (Table 6), and check the transformation success according to the reaction system in Table 7.

[0067] Table 6. Colony PCR Primers

[0068] Primers Primer sequence 5'to3' Ide-F CTCTCCCCACCAGCTGCTCTTTTCT Ide-R GCTCCTCGCCCTTGCTCACCATTAA

[0069] Table 7 Colony PCR Reaction System

[0070] name Volume (μL) 2xHieff PCR Master Mix 5 Ide-F 0.5 Ide-R 0.5 bacterial solution 1 <![CDATA[ddH2O]]> 3 total 10

[0071] The PCR amplification program was as follows: 94℃ pre-denaturation for 3 min, 98℃ denaturation for 5 s, 60℃ annealing for 20 s, 65℃ extension for 1.5 min, for a total of 30 cycles; and a final extension at 68℃ for 5 min. The results of 1% agarose gel electrophoresis can be used to preliminarily determine whether the clone is positive and to verify the success of the transformation.

[0072] Positive E. coli clones were inoculated into LB medium, and plasmid DNA was extracted using the SanPrep column-based plasmid DNA extraction kit (purchased from Sangon Biotech (Shanghai) Co., Ltd., product number: B518131). The obtained DNA was dissolved in 35 μL ddH2O. The extracted DNA can be used immediately for the next experiment or stored at -20℃.

[0073] 3. Transformation of Agrobacterium tumefaciens

[0074] Add 5 μL of the plasmid DNA solution extracted in step 2 to 100 μL of Agrobacterium tumefaciens AGL-1 (purchased from Shanghai Maokang Biotechnology Co., Ltd.) competent cells, freeze in liquid nitrogen for 8 seconds, and incubate at 37℃ for 5 minutes; add 800 μL of LB liquid medium to the competent cells, and incubate at 28℃ and 180 rpm with shaking for 1 hour; centrifuge at 3500 rpm for 10 minutes, discard the supernatant on a clean bench, and retain 100 μL of bacterial suspension; resuspend the bacterial suspension and spread it on IM medium containing 25 μg / mL rifampicin and 50 μg / mL kanamycin, incubate at 28℃ for 36 hours, pick single colonies, and screen for Agrobacterium tumefaciens containing the Egt2 gene.

[0075] Single colonies were selected and identified by colony PCR using primers Ide-F / Ide-R (Table 6). The PCR reaction system is shown in Table 7. The PCR amplification program was as follows: 94℃ pre-denaturation for 5 min, cycle 1; 98℃ denaturation for 10 s, 60℃ annealing for 30 s, 65℃ extension for 3 min, cycle 25; 65℃ final extension for 5 min, cycle 1. The success of the recombinant engineered bacteria transformation was determined by the results of 1% agarose gel electrophoresis. (See Table 7 for the results.) Figure 2 As shown, lanes 1-10 contain Agrobacterium colony PCR products containing the target gene Egt2 and an engineered quorum sensing system.

[0076] Example 2

[0077] Introduction of a quorum sensing system containing engineered pheromone Kmfα1 into Cordyceps militaris

[0078] 1. Agrobacterium tumefaciens-mediated genetic transformation of filamentous fungi

[0079] Single colonies of *Agrobacterium* containing the Egt2 gene and engineered quorum sensing system were selected from step 3 of Example 1 and inoculated into 3 mL of LB broth containing 50 μg / mL kanamycin (Kan). The culture was incubated at 28°C with shaking at 180 rpm for 36 h. The culture was then transferred to AIM broth at a volume concentration of 1% and incubated at 28°C with constant temperature at 180 rpm for 8 h until the bacterial concentration reached OD500. 600 =0.80, yielding Agrobacterium bacterial suspension.

[0080] 2. Cordyceps militaris spore suspension

[0081] Wild-type Cordyceps militaris CM01 was inoculated into solid Sabouraud dextrose agar and cultured at 25°C in the dark for 7 days. The surface of the solid agar was then repeatedly rinsed with sterile water on a clean bench to obtain a Cordyceps militaris mycelial suspension. The mycelium was removed by filtering the suspension through four layers of sterile gauze, yielding a Cordyceps militaris spore suspension. A trace amount of the spore suspension was used to determine the concentration of Cordyceps militaris spores in the suspension using a hemocytometer.

[0082] 3. Transformation

[0083] The concentration of the 200 μL prepared in step 2 is 1×10 6The Cordyceps militaris spore suspension at a concentration of 1 spores / mL was mixed with an equal volume of Agrobacterium tumefaciens bacterial solution prepared in step 1 to obtain a mixed bacterial solution. Sterile cellophane was tightly adhered to the surface of Sabouraud dextrose agar, and the mixed bacterial solution was then evenly spread onto the surface of the sterile cellophane. After co-culturing at 25°C in the dark for 48 hours, the cellophane was transferred to a new selective medium surface (with the bacterial culture side facing up, and the medium thickness approximately 2 mm). Then, another layer of selective medium was poured on the cellophane to completely cover it (the medium thickness approximately 2 mm). After culturing at 25°C in the dark for 5 days, hyphae that penetrated the upper selective medium were selected as potential positive clones and inoculated into Sabouraud dextrose agar containing 200 μg / mL hygromycin B. After culturing at 25°C in the dark for 5 days, the hyphae were transferred to culture the next generation. After five generations, a recombinant Cordyceps militaris hygromycin-resistant strain containing the pyridoxal phosphate-dependent cysteine ​​desulfurase Egt2 gene (nucleotide shown in SEQ ID NO. 5) and the engineered Kmfα1 quorum sensing system (nucleotide shown in SEQ ID NO. 4) was obtained.

[0084] 4. Identification of genes in Cordyceps militaris hygromycin-resistant strains

[0085] Genomic DNA was extracted from the recombinant Cordyceps militaris hygromycin-resistant strain, and the obtained DNA was dissolved in 50–100 μL of ddH2O. The extracted DNA can be used immediately for the next experiment or stored at -20°C. The extracted genomic DNA of the Cordyceps militaris hygromycin-resistant strain was used for PCR verification using hph-F / hph-R primers to check the success of the transformation. Primers for PCR positive identification are shown in Table 8, and the reaction system is shown in Table 9. The results of 1% agarose gel electrophoresis can be used to determine whether a clone is positive. The results are shown below. Figure 3 As shown, the PCR identification results are consistent with positive conversion results.

[0086] Table 8 Primers for Hygromycin Identification

[0087] Primers Primer sequence 5'to3' hph-F CTATTCCTTTGCCCTCGGACGA hph-R ATGCCTGAACTCACCGCGACGT

[0088] Table 9. PCR reaction system for hygromycin identification

[0089] name Volume (μL) 2x Hieff PCR Master Mix 5 hph-F 0.5 hph-R 0.5 Recombinant Cordyceps militaris DNA solution 1 <![CDATA[ddH2O]]> 3 total 10

[0090] PCR amplification program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles; 72℃ final extension for 10 min.

[0091] 5. Detection of intracellular ergothionein content in hygromycin-resistant strains of Cordyceps militaris

[0092] (1) Straw culture

[0093] Following step 2, 3 mL of the wild-type Cordyceps militaris CM01 spore suspension was inoculated into the fermentation medium and cultured at 25°C and 180 rpm for 4 days to obtain the seed culture. Then, 3 mL of the seed culture was transferred to a new fermentation medium and cultured at 25°C and 180 rpm for 7 days. The recombinant Cordyceps militaris hygromycin-resistant strain prepared in step 3 was inoculated into Sabouraud dextrose agar containing 200 μg / mL hygromycin B and cultured at 25°C in the dark for 7 days. Following step 2, 3 mL of the recombinant Cordyceps militaris spore suspension was inoculated into the fermentation medium and cultured at 25°C and 180 rpm for 4 days to obtain the seed culture. Then, 3 mL of the seed culture was transferred to fermentation media containing tryptophan (Trp) concentrations of 0 μg / mL, 40 μg / mL, and 80 μg / mL and cultured at 25°C and 180 rpm for 7 days. The fermentation broth was centrifuged at 8000 rpm for 10 min, and the supernatant and precipitate were collected.

[0094] (2) Ergothioneine standard curve

[0095] Take 20 mg of ergothioneine standard and dilute to 20 mL with 1% methanol to obtain a stock solution with a concentration of 1 mg / mL. Prepare standard solutions of 1 mg / L, 5 mg / L, 25 mg / L, 50 mg / L, and 100 mg / L by adding 1% methanol to 1 μL, 5 mg / L, 25 mg / L, 50 mg / L, and 100 mg / L, respectively. Determine the ergothioneine content by HPLC, injecting 5 μL of each concentration, repeating three times, and plotting the standard curve as shown below. Figure 4 As shown. The high performance liquid chromatography conditions were: Welch AQ-C18 column (250 mm × 4.6 mm), UV detection wavelength 254 nm, mobile phase methanol (1): water (99), column temperature 30 °C, flow rate 1.0 mL / min, injection volume 5 μL, repeated three times.

[0096] (3) Intracellular ergothionein content

[0097] Centrifuge at 8000 rpm for 10 min to separate the fermentation broth from the mycelium in step (1). Take the mycelium, add an appropriate amount of purified water, shake, and centrifuge again at 8000 rpm for 10 min to remove residual culture medium. Place the washed mycelium in a -80℃ freezer for 24 hours and freeze-dry in a freeze dryer until constant weight. Grind the freeze-dried mycelium with liquid nitrogen, accurately weigh 4g of mycelium powder, add 40mL of pre-cooled purified water at a material-to-liquid ratio of 1g:10mL, and break the cells using an ultrasonic cell disruptor. Working conditions: power 70%, 30min (3s start, 3s pause); centrifuge at 12000 rpm for 5 min at 4℃, take the supernatant, add an equal volume of methanol, let stand in a 4℃ freezer for 3h, centrifuge at 1200 rpm for 5 min at 4℃, take the supernatant, filter through a 0.22μm aqueous filter membrane, and use the HPLC method in step (2) to detect the ergothionein content. The intracellular ergothionein content is shown in Table 10 and Figure 7 As shown.

[0098] Comparative Example 1

[0099] Constructing Cordyceps militaris engineered strains containing only pyridoxal phosphate-dependent cysteine ​​desulfurase Egt2

[0100] The pyridoxal phosphate-dependent cysteine ​​desulfurase gene (SEQ ID NO.5) on the Cordyceps militaris genomic DNA was amplified using primers Egt2-F / Egt2-R (Table 1). The binary vector pCAMBIA-PgpdA-Tcbh1-hph-PtrpC was linearized using primers Vector-F / Vector-R (Table 3). The target gene fragment was then ligated to the linearized vector using the ClonExpress Ultra One Step Cloning Kit (Nanjing Novizan Biotechnology Co., Ltd., product catalog number: C115) to obtain the recombinant vector pCAMBIA-Egt2-Tcbh1-hph-PtrpC.

[0101] Other procedures were the same as in Examples 1 and 2, to obtain recombinant Cordyceps militaris strains containing only the target gene Egt2 and lacking the engineered pheromone quorum sensing system. PCR verification was performed using primers Ide-F / Ide-R (Table 6) to check the success of the transformation. The results are as follows: Figure 5 As shown, lanes 1-5 are parallel samples. Genomic DNA from the extracted Cordyceps militaris hygromycin-resistant strain was used for PCR verification with primers hph-F / hph-R (Table 8) to check the success of the transformation. The results are shown below. Figure 6 As shown, lanes 1-2 are parallel samples, preserving transformants with positive identification results; fermented simultaneously and under the same conditions with wild-type Cordyceps militaris and engineered Cordyceps militaris strains containing engineered pheromone quorum sensing systems from Example 2, the intracellular ergothionein content of the transgenic strains was determined, and the intracellular ergothionein content is shown in Table 10. Figure 7 As shown.

[0102] Table 10 Intracellular ergothionein content of wild-type Cordyceps militaris strains, ARO9-Kmfα1-FUS1-Egt2 recombinant strains, and Egt2-only recombinant strains.

[0103] Bacterial name Yield (mg / L) wild type 2.68±0.100 ARO9-Kmfα1-FUS1-Egt2 (Trp=0μg / mL) 2.836±0.071 ARO9-Kmfα1-FUS1-Egt2 (Trp=40μg / mL) 4.593±0.122 ARO9-Kmfα1-FUS1-Egt2 (Trp=80g / mL) 4.864±0.489 Engineered bacteria containing only Egt2 2.795±0.011

[0104] Table 10 and Figure 7 The results showed that the intracellular ergothioneine production of the ARO9-Kmfα1-FUS1-Egt2 recombinant strain increased with increasing tryptophan signaling factor concentration, reaching a maximum yield of 5.47 mg / mL, which was approximately two times higher than that of the wild-type strain and the Egt2-only recombinant strain. This indicates that under the dynamic regulation of the engineered quorum sensing system, the growth and production pathways in Cordyceps militaris can achieve a better balance, resulting in the production of more ergothioneine.

Claims

1. A method for increasing ergothionein production in Cordyceps militaris using a quorum sensing system composed of engineered pheromones, characterized in that, An engineered quorum sensing system was used to drive the overexpression of the pyridoxal phosphate-dependent cysteine ​​desulfurase Egt2 gene in the Cordyceps militaris genome to promote ergothioneine biosynthesis. The recombinant Cordyceps militaris strain was fermented and cultured, and the ergothioneine synthesis pathway was activated through a density-dependent autonomous induction mechanism to obtain mycelia with increased ergothioneine content. The engineered quorum sensing system was constructed by sequentially linking the aromatic amino acid inducible promoter ARO9, the Kluyveromyces lactis pheromone gene Kmfα1, and the pheromone-responsive promoter FUS1. The nucleotide sequence of the engineered quorum sensing system is shown in SEQ ID NO:

4.

2. The method for improving ergothionein yield in Cordyceps militaris using a quorum sensing system composed of engineered pheromones as described in claim 1, characterized in that, The nucleotide sequence of the aromatic amino acid inducible promoter ARO9 is shown in SEQ ID NO: 1, the nucleotide sequence of the Kluyveromyces lactis pheromone gene Kmfα1 is shown in SEQ ID NO: 2, and the nucleotide sequence of the pheromone-responsive promoter FUS1 is shown in SEQ ID NO:

3.

3. The method for improving ergothionein yield in Cordyceps militaris using a quorum sensing system composed of engineered pheromones as described in claim 1, characterized in that, The nucleotide sequence of the pyridoxal phosphate-dependent cysteine ​​desulfurase Egt2 gene is shown in SEQ ID NO:

5.

4. The method for improving ergot production in Cordyceps militaris using a quorum sensing system composed of engineered pheromones as described in claim 1, characterized in that, Overexpression of the pyridoxal phosphate-dependent cysteine ​​desulfurase Egt2 gene was performed using a binary expression vector to construct a recombinant expression plasmid. The binary expression vector was pCAMBIA-Tcbh1-hph-PtrpC, and its nucleotide sequence was as follows: SEQ ID NO: 6 + SEQ ID NO: 7 linked together.

5. The method for improving ergot production in Cordyceps militaris using a quorum sensing system composed of engineered pheromones as described in claim 1, characterized in that, The fermentation culture method of Cordyceps militaris genetically engineered bacteria is as follows: Cordyceps militaris genetically engineered bacteria containing the Egt2 gene are inoculated into Sabouraud solid medium containing 200 μg / mL hygromycin B and cultured at 25℃ in the dark for 7 days. Then, colonies are picked and inoculated into fermentation medium containing tryptophan and cultured on a shaker at 22-25℃ and 120-180 rpm to obtain mycelia containing ergothionein. The amount of tryptophan added to the fermentation medium is 40-80 μg / mL.

Images