Application of acidic tripeptide in preparation of drugs for resisting viruses and virus diseases of aquatic animals

Abstract

The invention belongs to the field of biological medicine, and particularly relates to application of acidic tripeptide to preparation of drugs for resisting viruses and virus diseases of aquatic animals. The acidic tripeptide Tripeptide is a polypeptide which is composed of three amino acids, namely, Leu, Asp and Val. The application has the advantages that firstly, the key effect of the VP7 in virus infection is verified from the positive and negative aspects, the infection of grass carp reovirus (GCRV) can be promoted by transfecting VP7 plasmids to grass carp gonad cell lines (GCO), and the GCRV infection can be inhibited by blocking VP7 antibodies; and (2) in-vivo and in-vitro experiments prove that GCRV virus infection can be effectively inhibited by applying the acidic tripeptide from the VP7 to treat. And (3) the invention discloses a brand new biological function of the virus outer capsid structure protein source Tripetide, and effectively blocks the virus from invading cells, thereby reducing host infection. The tripeptide is non-toxic to grass carp cells in an effective concentration range. The research provides important theoretical and experimental basis for developing efficient and safe drugs for resisting viral diseases of aquatic animals.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and more specifically, to the use of an acidic tripeptide in the preparation of drugs for treating aquatic animal viruses and viral diseases. Background Technology

[0002] The combined effects of climate change, aquatic pollution, and human factors have created a challenging aquaculture environment, leading to increasing pressure on aquatic animal disease control. Viral diseases pose a significant threat to the healthy development of the industry. Grass carp hemorrhagic disease is a prime example, caused by grass carp reovirus (GCRV). This virus is a double-stranded RNA virus with an icosahedral structure, approximately 70 nm in diameter (with a core of about 50 nm), and no envelope. Its genome contains 11 independently encoded RNA segments.

[0003] Currently, there is a lack of highly effective and specific drugs for the prevention and treatment of grass carp hemorrhagic disease caused by GCRV. Existing control methods mainly rely on vaccination, but these have problems such as short-term immune protection and weak cross-protection between strains. Chemical antiviral drugs are prone to residual contamination and drug resistance, limiting their clinical application. Therefore, developing safe and highly targeted novel antiviral agents has become a critical technological bottleneck that the industry urgently needs to overcome.

[0004] Recent studies have revealed that key functional fragments that may block infection may exist in viral structural proteins. For example, the GCRV capsid protein VP7 has been shown to be involved in the process of viral invasion of host cells, providing new insights for designing inhibitors targeting the viral invasion process. However, there are no reports of discovering small peptides (such as tripeptides) with direct antiviral activity from viral structural proteins and applying them to the prevention and control of viral diseases in aquatic animals. Summary of the Invention

[0005] This invention first provides the use of an acidic tripeptide in the preparation of drugs for treating aquatic animal viruses and viral diseases, wherein the acidic tripeptide is a polypeptide composed of three amino acids: Leu-Asp-Val.

[0006] The present invention also provides the use of a product containing an acidic tripeptide in the preparation of drugs for treating aquatic animal viruses and viral diseases, wherein the acidic tripeptide is a polypeptide composed of three amino acids: Leu-Asp-Val; optionally, the product further comprises siRNA designed for the vp7 gene.

[0007] In some embodiments, the siRNA sequence is GCUUGUUCACGUCAACCAATT (SEQ ID NO.1) and / or UUGGUUGACGUGAACAAGCTT (SEQ ID NO.2). In some embodiments, the aquatic animal virus is grass carp reovirus (GCRV).

[0008] In some embodiments, the aquatic animal is a cyprinid fish.

[0009] In some embodiments, the aquatic animal is grass carp or rare gudgeon.

[0010] In some embodiments, the viral disease is grass carp hemorrhagic disease caused by GCRV infection.

[0011] The present invention also provides an in vitro non-therapeutic method for inhibiting viruses in aquatic animals, the method comprising administering an effective amount of an acidic tripeptide to the aquatic animal.

[0012] In some embodiments, the virus is GCRV.

[0013] In some embodiments, the aquatic animal is a carp, preferably grass carp or rare gudgeon.

[0014] In some embodiments, the administration method includes oral administration, soaking, or injection.

[0015] Compared with the prior art, the present invention has the following outstanding advantages: 1) This invention first verifies from both positive and negative perspectives: the key role of VP7 in viral infection, transfection of VP7 plasmid into grass carp gonadal cell line (GCO) can promote grass carp reovirus (GCRV) infection, while blocking with VP7 antibody can inhibit GCRV infection. 2) This invention reveals a new biological function of the tripeptide: in vitro and in vivo experiments confirm that the tripeptide can specifically block viral invasion of host cells and significantly reduce the infection rate; it is non-toxic to grass carp kidney cell line (CIK) within the effective concentration range. (3) This invention provides a new path for the development of antiviral drugs for aquatic animals: small molecule peptide inhibitors designed based on viral structural protein targets have advantages such as clear mechanism, high safety, and environmental friendliness. Attached Figure Description

[0016] Figure 1 VP7 promotes GCRV infection. A: Grass carp gonadal cell line (GCO) was transfected with pDsRed1-N1-VP7 or pDsRed1-N1-Vector plasmids for 36 h before being infected with GCRV (MOI = 1). Viral copy number and host factor (HSP70, HSP90, NFκB) mRNA expression were detected by qPCR 1 h post-infection. B: Grass carp kidney cell line (CIK) was infected with GCRV virus solution after pretreatment with different doses of VP7 antibody / control antibody (mouse IgG) for 2 h. Viral copy number and host factor mRNA expression were detected by qPCR 1 h post-infection.

[0017] Figure 2 VP7 enhances GCRV infection efficiency. AB: GCO cells were transfected with pDsRed1-N1-VP7 or pDsRed1-N1-Vector plasmids for 36 h, and then infected with GCRV at different MOIs (10 / 1 / 0.1) for 1 h. The infection rate was calculated using plaque assays. CD: CIK cells were infected with GCRV virus solution pretreated with VP7 antibody / control antibody at different MOIs (10 / 1 / 0.1) for 2 h, and then infected with GCRV virus solution for 1 h. The infection rate was calculated using plaque assays.

[0018] Figure 3 In vitro antiviral activity of Tripeptide. A: Cytotoxicity assay of CIK cells treated with different concentrations of Tripeptide for 18 h; B: CIK cells were pre-incubated with different doses of Tripeptide for 3 h and then infected with GCRV (MOI = 1). Viral copy number and mRNA expression of host factors (HSP70, HSP90, NFκB) were detected by qPCR 10 h after infection.

[0019] Figure 4 In vivo antiviral effects of Tripeptide. Rare gudgeon were injected with GCRV-pretreated saline / Tripeptide for 2 h. On days 1, 3, and 5 post-infection, viral copy number in spleen (A), skin (B), liver (C), and intestine (D) tissues and dynamic changes in NFκB expression in spleen (E), skin (F), liver (G), and intestine (H) tissues were detected by qPCR.

[0020] Figure 5 In vivo antiviral effects of Tripeptide. Rare gudgeon were injected with GCRV-pretreated saline / Tripeptide for 2 h. The dynamic changes in HSP70 expression and HSP90 expression in spleen (E), skin (F), liver (G), and intestine (H) tissues were detected by qPCR on days 1, 3, and 5 post-infection. Detailed Implementation

[0021] To make the technical problems, technical solutions and advantages of the present invention clearer, a detailed description will be given below in conjunction with the accompanying drawings and specific embodiments.

[0022] Experimental materials: 1. Cells, viral strains Grass carp kidney cell line (CIK), grass carp gonad cell line (GCO), GCRVI and GCRVII strains are preserved in this laboratory.

[0023] 2. Reagents and Kits M199 culture medium, trypsin (Gibco), and fetal bovine serum (Gibco) were purchased from Changsha Boyi Biotechnology Co., Ltd. Acidic tripeptide (amino acid sequence: Leu-Asp-Val) was synthesized by Sangon Biotech (Shanghai) Co., Ltd. Crystal violet staining solution (Beyotime) was purchased from Changsha Boyi Biotechnology Co., Ltd.

[0024] 3. RNA extraction, reverse transcription, and quantitative fluorescence analysis RNA extraction kit was purchased from Vazyme, reverse transcription kit from Thermo Fisher Scientific, and ChamQ Universal SYBR qPCR Master Mix from Vazyme.

[0025] 4. Cytotoxicity The CCK-8 Cell Counting Kit was purchased from Vazyme.

[0026] Instrument Consumables: Cell culture dishes, plates, and flasks were purchased from Corning. Centrifuges and CO2 incubators were purchased from Thermo Fisher Scientific, and cell handling tables were purchased from Thermo Fisher Scientific. The pure water system was purchased from Millipore, and the quantitative PCR system was a Bio-Rad CFX96™ Real-Time System. Example 1: VP7 promotes GCRV infection Experimental methods: 1. Cell resuscitation and passage culture 1) Cell thawing: Remove the frozen cells and place them in a 37°C digital display water bath to thaw completely within 1-2 minutes. Carefully aspirate the cells in a sterile environment and add them to a 15mL centrifuge tube containing M199. Centrifuge at 800 r / min at room temperature for 5 min, carefully aspirate the supernatant, add 5 mL of culture medium, gently pipette to resuspend the cell pellet, and transfer it to a T25 culture flask. Incubate at 28°C for 24 h, then change the medium and observe the growth.

[0027] 2) Cell passage: Aspirate the culture medium and rinse once with PBS. Add 1 mL of trypsin (0.25% Trypsin-EDTA) to the culture flask and place it in an incubator for 2 min of digestion. Observe the cell digestion status in real time. Once the cells become round, quickly return them to the sterile operating table, gently tap the culture flask, and add 5 mL of M199 medium to stop digestion. Mix well with a pipette. The growth of adherent cells must be carefully monitored to ensure that the cells remain healthy. Depending on the cell type, many adherent cells need to be passaged when they reach 70-90% confluence.

[0028] 2. Plasmid transfection and antibody blocking 1) Plasmid transfection: Transfect different concentrations of VP7 plasmid (1 ug, 2 ug) into GCO cell lines that are in good growth condition and have been passaged more than 3 times. The ratio of 1 mg / mL PEI transfection reagent to plasmid concentration is 4:1. After mixing, let the mixture stand at room temperature for 15-30 min, then add the transfection complex to the culture medium. Challenge the virus 36 h after transfection.

[0029] 2) Antibody blocking: GCRV virus solution:VP7 antibody at a ratio of 25:1 was pre-incubated in a 28°C incubator for 2 h before infecting CIK cell lines.

[0030] 3. Cellular attack The cultured cells were replaced with serum-free basal medium M199, and GCRV was added at a dose of approximately 10 MOI. Cells were collected at the corresponding time points. Cell samples at 1 h were used to measure the virus entry efficiency, and cell samples at 10 h were used to measure the virus proliferation efficiency within the cells.

[0031] 4. Extract RNA This experiment followed the instructions for extracting total RNA using the RNA isolater Reagent (Vazyme) reagent: Tissue RNA extraction: 1) Tissue homogenization: Place 1 ml of lysis buffer, two grinding beads and an appropriate amount of tissue block into a 2 ml round-bottom centrifuge tube and homogenize under low temperature conditions until the tissue is completely pulverized (no visible particles).

[0032] 2) Centrifuge at 11,200 rpm for 5 min at 4℃, aspirate the supernatant and transfer it to a new 1.5 ml enzyme-free centrifuge tube, add 200 µL chloroform, shake vigorously for 15 s until a milky white color is formed, and let stand for 10 min.

[0033] 3) Centrifuge at 11,200 rpm for 15 min at 4℃, and transfer the upper aqueous phase to a new centrifuge tube.

[0034] 4) Add an equal volume of pre-cooled isopropanol, mix by inverting the container, and let stand at 4°C for 10 min.

[0035] 5) Centrifuge at 11,200 rpm for 10 min at 4℃. At this time, white RNA precipitate should appear.

[0036] 6) Pour off the supernatant, add 1 ml of 75% ethanol prepared with DEPC water to wash the precipitate, gently tap to suspend it, and let it stand at room temperature for 4 min.

[0037] 7) Centrifuge at 11,200 rpm for 5 min at 4℃ and remove the supernatant.

[0038] 8) Dry the precipitate in the open for 5 minutes at room temperature, avoiding over-drying to ensure that the RNA is soluble.

[0039] 9) Dissolve the RNA in an appropriate amount of DEPC water, gently blowing it if necessary. After complete dissolution, take a sample for testing. Store the remaining RNA at -80℃ for later use in reverse transcription.

[0040] Cellular RNA extraction: 1) Remove the culture medium from the culture plate.

[0041] 2) Wash with sterile PBS 1 to 2 times.

[0042] 3) Add 1 ml of Trizol lysis buffer to each well, let stand for 5 min, and repeatedly pipette until the cells are completely lysed. Transfer the lysis buffer to a 1.5 ml enzyme-free centrifuge tube.

[0043] 4) Subsequent operations are the same as those for tissue RNA extraction.

[0044] 5. cDNA Synthesis The concentration of total RNA was determined using a Beijing Kai'ao ultra-micro spectrophotometer. Subsequently, the first strand of cDNA was synthesized using the Thermo Fisher RevertAid First Strand cDNA Synthesis Kit, strictly following its instructions. The synthesis steps are as follows: Premixed I: Reagent Volume <![CDATA[oligdT 18 First]]> 0.5 μL / sample Random Primer 0.5 μL / sample Template RNA 2 ug / RNA concentration DEPC water 11 μL - Template RNA 12μL system: 65℃ for 5min; Premixed II: Reagent Volume 5×Reaction Buffer 4 μL / sample 10 mM dNTP Mix 2 μL / sample RT 1 μL / sample RI 1 μL / sample 20 μL system: 25℃ 5 min; 42℃ 70 min; 70℃ 5 min; 4℃ +∞; The reverse-transcribed cDNA was diluted 25 times with sterile water and stored at -20°C for later use.

[0045] 6. Quantitative Real-Time PCR (qPCR) 1) Primer design: According to the requirements of qPCR experiments, the length of the amplified fragment should be controlled below 300 bp, with an optimal range of 80-150 bp, to ensure efficient amplification and accurate detection. Primers were designed using Primer 5.0 software in this study, and their sequence information is detailed in Table 2. These primers include specific sequences of the internal reference gene (β-actin) and the target gene, used for the analysis of gene expression differences in subsequent qPCR experiments. Table 2 Gene primer sequences used for qPCR Genes Sequence(5’-3’) Ci-β-actin-qF CTATGTTGGTGACGAGGCTCA Ci-β-actin-qR CCCAGTTGGTGACAATACCG Gr-β-actin-qF CTATGTTGGTGACGAGGCTCA Gr-β-actin-qR CCCAGTTGGTGACAATACCG HSP70-qF AAAGACGCCGGAGTAATCGC HSP70-qR TGGTCAGGATGGACACGTCA HSP90-qF TGAAATCAACCCAGTCCATCC HSP90-qR AGCCTTGTCGTTCTTGTCGG NF-κB-qF CGGTGCGTCTGTGTTTCCAG NF-κB-qR ATCTTGAGCTCGGCGGTGTT VP7-qF CCATGACACTCACGCACACG VP7-qR GGCAAGCGAAGGTCAGGTTG VP2-qF ATCAAGGATCCCATTCCGCCTTCA VP2-qR TTAGAGGATCGTGCCATTGAGGGT GCRV-Ⅱ-qF GTACAGCATTTGGCACGTCT GCRV-Ⅱ-qR TCCGCTGAATCGACATACCAC The 10 μL fluorescence quantitative quantification system (Vazyme, Cat#: Q711-02) is shown in Table 3; Table 3 Reaction System Reagent Volume 2 × ChamQ Universal SYBR qPCR Master Mix 5 μL / sample Primer1(10 μM) 0.4 μL / sample Primer2(10 μM) 0.4 μL / sample Template DNA / cDNA X μL <![CDATA[ddH2O]]> To 10.0 μL 2) The PCR amplification procedure is as follows: Pre-denaturation: 95℃ for 5 min 40 cycles: 95℃ for 15 seconds, 55℃ for 30 seconds, 72℃ for 30 seconds Melting curve analysis: 95℃ 30 s, 57℃ 30 s, 72℃ 60 s Melting curve analysis was used to verify the specificity and purity of qPCR products to ensure accurate experimental results. To guarantee data reliability, each sample was performed in three independent replicates. In gene expression analysis, β-actin was selected as an internal reference gene to correct for differences between samples. The relative expression levels of the target gene were calculated using a 23... –ΔΔCt The method calculates relative changes in gene expression to enable effective comparisons between samples.

[0046] Experimental results: like Figure 1 As shown, GCO cell lines were transfected with different doses of pDsRed1-N1-VP7 or pDsRed1-N1-Vector plasmids for 36 h, and then GCRV virus solution (MOI = 10) was added to the culture system (2 ml). CIK cell lines were then infected with GCRV virus solution after pretreatment with different doses of VP7 and mouse IgG antibody for 2 h. Cells were collected at 1 h, and RNA was extracted to detect viral load and the expression levels of HSP70, HSP90, and NFκB. The results showed that VP7 significantly promoted GCRV proliferation. Example 2: VP7 enhances GCRV infection efficiency Experimental methods: 1. The cell resuscitation, passage culture, challenge, RNA extraction, reverse transcription, and quantitative fluorescence methods are the same as in Example 1.

[0047] 2. Methylcellulose-crystal violet spot method: CIK cells were seeded in 6-well cell culture plates and cultured overnight at 28°C. Viral supernatant, after three freeze-thaw cycles, was serially diluted 10-fold and added to CIK cells, incubated at 28°C for 2 h. Subsequently, the supernatant was removed, and M199 medium containing 10% fetal bovine serum and 0.5% methylcellulose was added. After culturing at 28°C for 1-2 days, the cells were observed under a microscope until plaques were fully formed. The medium was then discarded, and the cells were carefully washed twice with sterile PBS, followed by fixation with 4% paraformaldehyde for 15 min. The fixative was removed, and the cells were stained with 0.5% crystal violet solution for 1 h. After removing the staining solution and air-drying, plaques were counted, and the viral load per mL of viral solution was calculated as PFU / mL. The viral titer was calculated using the following formula: PFU / mL = Average number of plaques per well / Virus inoculum per well (mL) × Virus dilution factor.

[0048] Experimental Results and Discussion: like Figure 2 As shown, after transfecting GCO cell lines with pDsRed1-N1-VP7 or pDsRed1-N1-Vector plasmids for 36 h, GCRV virus solution (MOI = 10 / 1 / 0.1) was added to the culture system (2 ml). CIK cell lines were infected with GCRV virus solution after pretreatment with VP7 and mouse IgG antibody for 2 h. Cells were collected 1 h later for plaque assays. The results showed that VP7 exacerbated the GCRV infection-induced cytopathic effect (CPE). Conversely, blocking VP7 with specific antibodies effectively inhibited viral invasion.

[0049] The siRNA was designed with the following sequence: ncRNA: F: UUCUCCGAACGUGUCACGUTT; R: ACGUGACACGUUCGGAGAATT; VP7-siRNA-236 F: GCUUGUUCACGUCAACCAATT (SEQ ID NO.1); R: UUGGUUGACGUGAACAAGCTT (SEQ ID NO.2); Transfection experiments revealed that silencing VP7 effectively inhibited viral invasion. Example 3: Inhibitory effect of Tripeptide on GCRV proliferation in CIK cells and cytotoxicity assessment Experimental methods: 1. Cell Culture and Viral Infection The cell resuscitation, passage culture, challenge, RNA extraction, cDNA reverse transcription, and qPCR methods are the same as in Example 1.

[0050] 2. Cytotoxicity detection CIK cells in the logarithmic growth phase were seeded into 96-well cell culture plates. After cell attachment, the cells were treated with culture medium containing a series of tripeptide concentration gradients for 18 h. Subsequently, the absorbance (OD450) at 450 nm was measured using a microplate reader according to the instructions of the CCK-8 cell counting kit (Vazyme, Cat# A311-01), and cell viability was calculated.

[0051] Experimental Results and Discussion: In Example 3, the inhibitory effect of Tripeptide on grass carp hemorrhagic disease was verified. To rule out that this inhibitory effect was caused by the drug killing cells due to cytotoxicity, we treated CIK cells with different concentrations of Tripeptide for 18 h and then calculated the cell viability using the CCK-8 Cell Counting Kit. Figure 3 As shown in Figure A, within the concentration range used, Tripeptide peptide had virtually no effect on cell viability, indicating that the preparation of antiviral drugs against aquatic animal viruses using Tripeptide peptide is safe and feasible. Based on the viral proliferation inhibition rate, the half-maximal inhibitory concentration (IC50) of Tripeptide for inhibiting GCRV proliferation in CIK cells was calculated to be 2.20 μM (…). Figure 3 B). For example... Figure 3 As shown in Figure C, qPCR results indicated that GCRV proliferation was inhibited. Simultaneously, the expression levels of host factor (HSP70, HSP90, NFκB) mRNA were also inhibited. Both the viral proliferation inhibition and the host factor mRNA expression inhibition effects exhibited a tripeptide concentration-dependent relationship. Figure 3 C). Example 4: Evaluation of the efficacy of Tripeptide against GCRV infection in rare gudgeon Experimental methods: 1. Preparation of laboratory animals Rare gudgeon (approximately 0.8 ± 0.12 g) that are healthy and of uniform weight were selected. Gobiocypris rarus Fish fry were placed in a temperature-controlled recirculating aquaculture system for at least 7 days for acclimatization and rearing. Rearing conditions: water temperature maintained at (25 ± 1)℃, dissolved oxygen >5 mg / L, pH 7.0-7.5. Antibiotic-free commercial feed was provided daily at regular intervals. Before the experiment, a random sample of fry was selected, and PCR testing was used to confirm the absence of GCRV infection.

[0052] 2. Experimental grouping and treatment The domesticated rare gudgeon were randomly divided into two groups: the Tripeptide treatment group (injected with a mixture of GCRV and Tripeptide) and the control group (injected with a mixture of physiological saline and GCRV). Each group had three replicates, with 50 fish per replicate (n = 150).

[0053] 3. Virus incubation and challenge with Tripeptide GCRV virus solution was co-incubated with an equal volume of Tripeptide solution (treatment group) or physiological saline (control group) at 4°C for 2 h. Subsequently, using a sterile syringe, GCRV-Tripeptide mixture (treatment group) or GCRV-physiological saline mixture (control group) was injected intraperitoneally into the corresponding rare gudgeon groups at a dose of 25 μL / tail.

[0054] 4. Sample Collection On days 1, 3, and 5 after the challenge, three rare gudgeon were randomly selected from each group, and spleen, skin, liver, and intestinal tissue samples were collected under aseptic conditions.

[0055] 5. Indicator Testing The GCRV load (viral proliferation level) and the mRNA expression levels of host factors (HSP70, HSP90, NFκB) in each tissue sample were determined by qPCR (specific steps are described in Example 1).

[0056] Experimental Results and Discussion: On days 1, 3, and 5 post-challenge, the GCRV load in the spleen, skin, liver, and intestinal tissues of rare gudgeon in the Tripeptide-treated group was lower than that in the virus control group at the same time points. Figure 4 AD). On days 1, 3, and 5 post-challenge, the relative transcriptional levels of NFκB mRNA in the spleen, skin, liver, and intestinal tissues of rare gudgeon in the Tripeptide-treated group were lower than those in the virus control group at the same time points. Figure 4 EH). On days 3 and 5 post-challenge, the relative transcription levels of HSP70 and HSP90 mRNA in the spleen, skin, liver, and intestinal tissues of rare gudgeon in the Tripeptide-treated group were lower than those in the virus control group at the same time points. Figure 5 AH). On day 1 post-challenge, no significant difference was observed in the relative transcriptional levels of HSP70 and HSP90 mRNA in the skin tissue of rare gudgeon in the Tripeptide-treated group compared to the virus control group. In the remaining tissues (spleen, liver, intestine), the relative transcriptional levels of HSP70 and HSP90 mRNA were lower than those in the virus control group at the same time point.Figure 5 AH).

[0057] Based on the above four examples, it can be concluded that VP7 significantly promotes GCRV proliferation, and Tripeptide peptide can significantly inhibit the proliferation of grass carp hemorrhagic disease, providing a theoretical basis for the application of Tripeptide peptide in the preparation of drugs against aquatic animal viral diseases.

[0058] The above description represents the preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The use of an acidic tripeptide in the preparation of drugs against aquatic animal viruses and viral diseases, characterized in that, The acidic tripeptide is a polypeptide composed of three amino acids: Leu, Asp, and Val.

2. The use of a product containing an acidic tripeptide in the preparation of drugs for treating aquatic animal viruses and viral diseases, characterized in that, The acidic tripeptide is a polypeptide composed of three amino acids: Leu-Asp-Val; optionally, the product further comprises siRNA designed for the VP7 gene, preferably, the siRNA sequence is shown in SEQ ID NO.1 and / or SEQ ID NO.

2.

3. The application as described in claim 1 or 2, characterized in that, The aquatic animal virus in question is grass carp reovirus (GCRV).

4. The application as described in claim 1 or 2, characterized in that, The aquatic animal in question is a carp.

5. The application as described in claim 1 or 2, characterized in that, The aquatic animals mentioned are grass carp or rare gudgeon.

6. The application as described in claim 1 or 2, characterized in that, The viral disease mentioned is hemorrhagic disease in grass carp caused by GCRV infection.

7. An in vitro non-therapeutic method for inhibiting viruses in aquatic animals, characterized in that: The method involves administering an effective amount of acidic tripeptide to aquatic animals.

8. The method as described in claim 7, characterized in that, The virus in question is GCRV.

9. The method as described in claim 7, characterized in that, The aquatic animals are carp, preferably grass carp or rare gudgeon.

10. The method as described in claim 7, characterized in that, The methods of administration include oral administration, soaking, or injection.

Images