Pleuromutilin producing strain, fermentation product and application of pleuromutilin producing strain

Abstract

The invention provides a pleuromutilin producing strain, a fermentation product and application of the pleuromutilin producing strain, and belongs to the technical field of microorganisms. The pleuromutilin producing strain BEP200910 is a strain which is preserved in the China General Microbiological Culture Collection Center (CGMCC), and the preservation number of the strain is CGMCC No.42030. The pleuromutilin producing strain BEP200910 can be used for producing pleuromutilin. The pleuromutilin producing strain disclosed by the invention can be used for producing pleuromutilin through fermentation, the fermentation yield is obviously higher than that of a known pleuromutilin producing strain ATCC 34646, and a new way is provided for further improving the yield of pleuromutilin. Meanwhile, a fermentation product of the strain has an obvious bacteriostatic effect, can effectively inhibit growth of staphylococcus aureus and bacillus subtilis, and has a good application prospect in preparation of antibacterial drugs.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a truncated pleurotin-producing bacterium, its fermentation products, and their applications. Background Technology

[0002] Since the discovery of antibiotics in the 1920s, they have played a vital role in treating and saving lives. However, due to a lack of proper understanding of antibiotics, their misuse in society is becoming increasingly serious, creating conditions for the emergence and growth of large numbers of drug-resistant bacteria. To alleviate this health and safety problem, it is necessary to continuously develop new antibiotics. One source of new antibiotics is the development of entirely new antibiotics from microorganisms in nature. Currently, humans recognize less than 1% of all microorganisms, and the proportion of antibiotic-producing microorganisms is even smaller, with a large proportion remaining unexplored.

[0003] Pleurotus truncatedis is a tricyclic diterpenoid antibiotic produced by fermentation of the fungus *Clitopilus*, a member of the Basidiomycota genus. Studies have shown that it has high antibacterial activity against Gram-positive bacteria. Furthermore, derivatives of truncatedis, after chemical modification, exhibit even stronger antibacterial activity. Unlike other widely used clinical antibacterial drugs, truncatedis and its derivatives inhibit bacterial protein synthesis by binding to the V region of the peptidyl transferase center (PTC) of the 23S RNA subunit of the bacterial 50S ribosomal subunit.

[0004] Due to their unique antibacterial mechanism and low likelihood of cross-resistance, truncated pleurotin compounds have become a focus of novel antibiotic research. However, domestic production of truncated pleurotin currently faces numerous challenges, including a very limited number of strains capable of producing it, immature fermentation technology, and long fermentation cycles, all of which significantly restrict the rapid development of the truncated pleurotin industry. Therefore, discovering a strain capable of producing truncated pleurotin is essential. Summary of the Invention

[0005] The purpose of this invention is to provide a strain of bacteria that can produce truncated pleurotin and its application, wherein the product obtained by fermentation of the strain has good antibacterial activity.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] This invention provides a strain, which has the preservation number CGMCC No.42030.

[0008] The present invention also provides the use of the above-mentioned strain for the fermentation production of truncated pleurotin.

[0009] The present invention also provides a method for producing truncated pleurotin by fermentation, wherein the method uses the above-mentioned strain as a strain to obtain truncated pleurotin through fermentation.

[0010] Furthermore, the method includes the following steps: inoculating the bacterial strain into the fermentation medium at an inoculation rate of 5% to 15%, and fermenting for 5 to 15 days at a temperature of 20 to 30°C and a speed of 200 to 250 rpm.

[0011] Furthermore, the fermentation medium consists of: 4%–5% corn steep liquor powder, 5%–6% glucose, 0.02%–0.05% magnesium sulfate heptahydrate, and 2%–5% soybean oil.

[0012] Furthermore, before fermentation culture, the strain needs to undergo seed culture, which includes the following steps: inoculating the strain into a seed culture medium and culturing it for 4 to 8 days at a temperature of 20 to 30°C and a speed of 200 to 250 rpm.

[0013] Further, the seed culture medium comprises: 1%–2% soybean meal, 0.01%–0.1% magnesium sulfate heptahydrate, 0.05%–0.2% potassium dihydrogen phosphate, 0.005%–0.02% sodium chloride, 0.001%–0.01% ferrous sulfate heptahydrate, 5%–6% glucose, 0.05%–0.1% calcium nitrate, and 0.01%–0.03% Dow defoamer DF104.

[0014] The present invention also provides a fermentation product, which is obtained by seed culture and fermentation culture of the above-mentioned strain, followed by ultrasonic centrifugation in an alcohol solvent.

[0015] Further, the alcohol solvent is methanol; the ultrasonic time is 30-70 min; the centrifugation speed is 10000-15000 rpm and the time is 1-10 min.

[0016] Furthermore, the seed culture includes the following steps: inoculating the bacterial strain into a seed culture medium and culturing it for 4 to 8 days at a temperature of 20–30°C and an rpm of 200–250.

[0017] Further, the seed culture medium comprises: 1%–2% soybean meal, 0.01%–0.1% magnesium sulfate heptahydrate, 0.05%–0.2% potassium dihydrogen phosphate, 0.005%–0.02% sodium chloride, 0.001%–0.01% ferrous sulfate heptahydrate, 5%–6% glucose, 0.05%–0.1% calcium nitrate, and 0.01%–0.03% Dow defoamer DF104.

[0018] Furthermore, the fermentation culture includes the following steps: inoculating the strain into the fermentation medium at an inoculum of 5% to 15%, and fermenting for 5 to 15 days at a temperature of 20 to 30°C and a speed of 200 to 250 rpm.

[0019] Furthermore, the fermentation medium consists of: 4%–5% corn steep liquor powder, 5%–6% glucose, 0.02%–0.05% magnesium sulfate heptahydrate, and 2%–5% soybean oil.

[0020] The present invention also provides the use of the above-mentioned fermentation products in the preparation of antibacterial drugs.

[0021] Furthermore, the bacteria are Staphylococcus aureus or Bacillus subtilis. This invention achieves the following beneficial effects:

[0022] The strain of this invention belongs to *Clitopilus scyphoides* and can produce truncated pleurotin through fermentation. The fermentation yield of truncated pleurotin is significantly higher than that of the known truncated pleurotin-producing strain ATCC 34646 (*Clitopilus passeckerianus*). Furthermore, the fermentation product of this strain exhibits significant antibacterial activity, effectively inhibiting the growth of *Staphylococcus aureus* and *Bacillus subtilis*.

[0023] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.

[0024] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following embodiments. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description

[0025] Figure 1 The images show the colony morphology of different bacteria during the isolation process.

[0026] Figure 2 Colony morphology and microscopic images of the strain after 8-10 days of culture for purification.

[0027] Figure 3 The results are from the PCR identification of the strain.

[0028] Figure 4 The results of the sequence alignment of the strain on BLAST are shown.

[0029] Figure 5 The antibacterial effect of the fermentation products of the strain. Detailed Implementation

[0030] The present invention will be further described below with reference to specific embodiments, but the present invention is not limited to the following embodiments. Unless otherwise specified, the experimental methods used in the embodiments are conventional methods, and the materials and reagents used are commercially available unless otherwise specified.

[0031] Example 1: Isolation and purification of bacterial strains

[0032] The strain BEP200910 (Clitopilus scyphoides) of this invention was deposited on June 11, 2025, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 42030, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences. This strain BEP200910 was isolated from soil using the following method:

[0033] 1. Soil samples were collected from the topsoil (5-20cm) of Yushan Town, Enyang District, Bazhong City, at longitude 31.6307788 and latitude 106.7474678. Soil samples were collected from areas 5-20cm below the ground surface. The collected soil samples were sealed in sampling bags and brought back to the laboratory.

[0034] 2. Mix 10g of soil sample with 90mL of sterile water, then transfer to a 250mL Erlenmeyer flask (containing 25-30 glass beads), shake at 220rpm for 30min to obtain a soil suspension.

[0035] 3. The collected soil suspension was serially diluted with sterile water. Soil suspensions of different dilution gradients were spread on potato dextrose agar (PDA) containing 100 U / mL penicillin and 0.1 mg / mL streptomycin and incubated at 26°C for 8-10 days until colonies appeared on the plates.

[0036] 4. Select colonies with different morphologies from the plate and inoculate them onto fresh potato dextrose agar medium containing 100 U / mL penicillin and 0.1 mg / mL streptomycin. Incubate at 26°C for 8-10 days. Repeat this process until purified colonies are formed.

[0037] 5. Inoculate the obtained purified single colonies onto fresh potato dextrose agar medium and incubate at 26°C for 8-10 days, observing the morphology of the cells. Simultaneously, scrape off a small piece of mycelial growth to prepare a slide and observe the microscopic morphology of the cells.

[0038] Figure 1 The morphology of different colonies after 8-10 days of culture on potato dextrose agar during the isolation process. Figure 2The morphology of the strain was determined by culturing it on potato dextrose agar for 8-10 days to purify it. Specific morphological characteristics included: wavy edges on the mycelial growth, white color, dry texture, and a very thin layer of hairs on the surface. It had a starchy odor but a mild taste.

[0039] Example 2: Molecular identification of the bacterial strain

[0040] 1. Pick a single colony N25 of the purified colony from step 4 of Example 1, inoculate it into 25 mL of ATCC200 liquid medium, and incubate at 26°C and 220 rpm for 3-5 days.

[0041] 2. Take 5 mL of the well-grown bacterial culture, centrifuge at 12000 rpm for 3 min, discard the supernatant, and collect the bacterial precipitate. Dry the collected bacterial precipitate at 50℃, then flash-freeze it with liquid nitrogen and grind it into powder.

[0042] 3. Perform DNA extraction according to the steps of Sangon Biotech's fungal genome extraction kit, and store the extracted genomic DNA at -20°C.

[0043] 4. The PCR reaction system is as follows: 12.5 μL Super Kfx Master Mix, 1 μL each of primers ITS1 (10 μM) (TCCGTAGGTGAACCTGCGG, SEQ ID No.1) and ITS4 (10 μM) (TCCTCCGCTTATTGATATGC, SEQ ID No.2), 1 μL genomic DNA (400 ng), and 9.5 μL purified water.

[0044] 5. The PCR program is as follows: 98℃ for 3 min; 98℃ for 20 s; 52℃ for 30 s; 72℃ for 30 s; 30 cycles; 72℃ for 30 s; 12℃ for indefinite duration.

[0045] 6. The PCR products were subjected to 1% agarose gel electrophoresis to confirm that the target band was at the expected molecular weight. Then, the PCR products were sent to Sangon Biotech for sequencing. The sequencing results were compared with BLAST on NCBI to confirm that the strain was Clitopilus scyphoides.

[0046] Figure 3 This is an ITS PCR electrophoresis image. M is the DL5000 DNA marker, 1 and 2 are the ITS sequences of the bacterial species to be identified, and NC is the negative control. Figure 4 This is a phylogenetic tree diagram obtained after BLAST alignment of the bacterial strain. The tree was constructed using the neighbor-joining method, and the maximum sequence difference was 0.75.

[0047] Example 3: Shake-flask fermentation

[0048] 1. Select single colonies N9, N16, and N25 of the purified colonies from step 4 of Example 1, and inoculate them into 25 mL of seed culture medium (1.5% soybean meal, 0.05% magnesium sulfate heptahydrate, 0.1% potassium dihydrogen phosphate, 0.01% sodium chloride, 0.005% ferrous sulfate heptahydrate, 5.2% glucose, 0.072% calcium nitrate, and 0.02% Dow defoamer DF104), and incubate at 25°C and 220 rpm for 6 days.

[0049] 2. Transfer the matured seeds to 50 mL of fermentation medium (4.5% corn steep liquor powder, 5.5% glucose, 0.038% magnesium sulfate heptahydrate, and 3.0% soybean oil) at an inoculation rate of 10%, and incubate at 25℃ and 220 rpm for 10 days.

[0050] 3. Take the fermentation broth, add methanol and mix well (the volume ratio of fermentation broth to methanol is 1:3), sonicate for 50 min, then centrifuge at 12000 rpm for 5 min, and take the supernatant for HPLC detection.

[0051] Under the same conditions, the yield of truncated pleurotin produced by the known truncated pleurotin-producing strain ATCC 34646 and the single colonies N9, N16, and N25 screened from the purified colonies in step 4 of Example 1 of this invention was tested after shake-flask fermentation (Table 1).

[0052] Table 1. Yield of shake-flask fermentation (g / L)

[0053] strain number Fermentation yield (g / L) ATCC 34646 0.64 N9 3.50 N16 5.33 N25 5.64

[0054] The results in Table 1 show that, under the same conditions, the truncated pleurotin production of strains N9, N16, and N25 of this invention is significantly higher than that of the known truncated pleurotin-producing strain ATCC 34646. Strain N25 of this invention is named BEP200910 and was deposited on June 11, 2025, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 42030.

[0055] The following experimental examples demonstrate the beneficial effects of the present invention.

[0056] Experiment Example 1: Testing the antibacterial effect

[0057] 1. Experimental Methods

[0058] (1) Incubate the test bacteria Escherichia coli, Bacillus subtilis and Staphylococcus aureus in an incubator at 35-37℃ for 1-2 days.

[0059] (2) When preparing the culture medium containing bacteria, scrape a portion of the cultured Escherichia coli, Bacillus subtilis and Staphylococcus aureus cells with a sterile inoculation loop, resuspend them in an appropriate amount of sterile water, and then mix the resuspended bacterial solution evenly on a vortex mixer. After mixing evenly, place the bacterial solution in a 40℃ water bath for later use.

[0060] (3) Add 0.5 mL of the prepared Escherichia coli, Bacillus subtilis or Staphylococcus aureus test bacterial suspension to 15 mL of tryptic soy agar (TSA) medium, mix thoroughly, pour into plates, cool and set aside.

[0061] (4) Use a sterile 200 μL pipette tip to make evenly puncture holes in the plate and remove the agar blocks from the holes. Then, use a pipette to draw 15 μL of the extract from the fermentation sample (i.e., the supernatant from step 3 of Example 3) and add it to the holes.

[0062] (5) First, place the plate in a 4℃ environment overnight, then transfer it to a 35-37℃ incubator for 1-2 days. After a clear inhibition zone appears, measure the diameter of the inhibition zone with a ruler and observe the antibacterial effect of the fermentation sample.

[0063] 2. Experimental Results

[0064] Table 2 shows the diameters of the inhibition zones of the fermentation products of ATCC 34646, N9, N16, and N25 against Escherichia coli, Bacillus subtilis, and Staphylococcus aureus. Figure 5 This is a diagram showing the antibacterial effect.

[0065] Table 2. Diameter of inhibition zone (cm)

[0066] strain number Staphylococcus aureus Bacillus subtilis E. coli ATCC 34646 none none none N9 3.03±0.06 3.00±0.26 none N16 3.60±0.17 3.40±0.10 none N25 3.60±0.17 3.60±0.00 none

[0067] The results in Table 2 show that the fermentation products of strains N9, N16 and N25 of this invention have significant inhibitory effects on Bacillus subtilis and Staphylococcus aureus.

[0068] In summary, this invention provides a truncated pleurotin-producing bacterium, its fermentation product, and its applications. The truncated pleurotin-producing bacterium, BEP200910, is a strain deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 42030. This invention's truncated pleurotin-producing bacterium can produce truncated pleurotin through fermentation, with a fermentation yield significantly higher than that of the known truncated pleurotin-producing strain ATCC 34646, providing a new approach to further increase truncated pleurotin production. Simultaneously, the fermentation product of this strain exhibits significant antibacterial activity, effectively inhibiting the growth of Staphylococcus aureus and Bacillus subtilis, showing promising application prospects in the preparation of antibacterial drugs.

Claims

1. A strain, characterized in that, Its accession number is CGMCC No.42030.

2. Use of the strain according to claim 1 for fermentation production of truncated pleurotin.

3. A method for fermenting and producing shortened pleurotin, characterized in that, The method uses the strain described in claim 1 as the inoculum and ferments it to obtain truncated pleurotin.

4. The method according to claim 3, characterized in that, The method includes the following steps: inoculating the bacterial strain into the fermentation medium at an inoculation rate of 5% to 15%, and fermenting for 5 to 15 days at a temperature of 20 to 30°C and a speed of 200 to 250 rpm.

5. The method according to claim 4, characterized in that, The fermentation medium consists of: 4%–5% corn steep liquor powder, 5%–6% glucose, 0.02%–0.05% magnesium sulfate heptahydrate, and 2%–5% soybean oil.

6. The method according to claim 4, characterized in that, Before fermentation, the strain must undergo seed culture. The process includes the following steps: inoculating the bacterial strain into a seed culture medium and culturing it for 4 to 8 days at a temperature of 20–30°C and a speed of 200–250 rpm.

7. The method according to claim 6, characterized in that, The seed culture medium consists of: 1%–2% soybean meal, 0.01%–0.1% magnesium sulfate heptahydrate, 0.05%–0.2% potassium dihydrogen phosphate, 0.005%–0.02% sodium chloride, 0.001%–0.01% ferrous sulfate heptahydrate, 5%–6% glucose, 0.05%–0.1% calcium nitrate, and 0.01%–0.03% Dow defoamer DF104.

8. A fermentation product, characterized in that, It is obtained by seed culture, fermentation culture and ultrasonic centrifugation in alcohol solvent of the strain described in claim 1.

9. Use of the fermentation product according to claim 8 in the preparation of antibacterial drugs.

10. The use according to claim 9, characterized in that, The bacteria are Staphylococcus aureus or Bacillus subtilis.

Images