Pichia pastoris engineering bacterium for synthesizing bakuchiol from de novo by converting methanol as well as construction and application of pichia pastoris engineering bacterium

By heterologously expressing psoralen synthase and mevalonic acid pathway genes in Pichia pastoris engineered strains, and combining this with CRISPR/Cas9 gene editing technology to optimize methanol concentration, the problem of low production efficiency of psoralen using methanol as a carbon source was solved, achieving efficient and economical psoralen production.

CN120944729AActive Publication Date: 2025-11-14SOUTH CHINA UNIV OF TECH +1

Patent Information

Application Number
CN202511460241.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-14
Publication Date
2025-11-14
Estimated Expiration
2045-10-14

AI Technical Summary

Technical Problem

The lack of Pichia pastoris engineered strains with methanol as a carbon source in the current technology limits the green, rapid and economical production of psoralen.

Method used

A Pichia pastoris engineered strain was constructed by heterologously expressing the psoralen synthase PcPT07 or PcPTΔ85 gene in Pichia pastoris GS115 or S12 strains, overexpressing key genes of the mevalonate pathway and exogenous acetyl-CoA thiolase EcAtoB gene, and then using CRISPR/Cas9 gene editing technology to knock out and express the genes at neutral sites on chromosomes, and optimizing the methanol concentration to increase psoralen production.

Benefits of technology

High yield of psoralen was achieved using methanol as the sole carbon source, with a shake flask yield of 91.2 mg/L and a 15L fermenter yield of 692.8 mg/L, representing a 59.8-fold increase in yield. This method features high conversion efficiency and low production cost.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120944729A_ABST
    Figure CN120944729A_ABST
Patent Text Reader

Abstract

The invention discloses a pichia pastoris engineering bacterium for synthesizing bakuchiol from de novo by converting methanol as well as construction and application of the pichia pastoris engineering bacterium. A heterologous p-coumaric acid synthesis pathway is introduced to neutral sites of different chromosomes of pichia pastoris, a high-yield p-coumaric acid strain is obtained through gene knockout, overexpression or heterologous expression of tyrosine and phenylalanine synthesis pathway key genes of a shikimic acid pathway, a heterologous bakuchiol biosynthesis pathway is introduced on the basis, and a high-yield p-coumaric acid strain is obtained. After overexpression of bakuchiol synthetase, endogenous overexpression or heterologous expression of MVA pathway key genes and exogenous acetyl coenzyme A supply pathway genes, methanol concentration optimization and bacterial strain His4 gene supplementation, the yield of bakuchiol is effectively increased to 91.2 mg / L and is increased by 59.8 times compared with that of an initial bacterial strain, and the yield of bakuchiol in a 15L fermentation tank reaches 692.8 mg / L. The method has the characteristics of high conversion efficiency, low production cost, convenience in preparation, wide industrial application prospect and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and specifically relates to a Pichia pastoris engineered strain that synthesizes psoralen de novo from methanol, its construction, and its application. Background Technology

[0002] Bakuchiol (BAK) is a monoterpenoid phenolic compound isolated from the medicinal plant *Psoralea corylifolia*, primarily found in its seeds. It has been shown to possess anticancer, antibacterial, and antioxidant bioactivities. Its functions are similar to retinol, but it exhibits better photostability and lower irritation, making it considered a natural alternative to retinol and used in various skincare products. Currently, bakuchiol is mainly obtained through plant extraction and chemical synthesis. However, plant extraction methods suffer from low concentrations, difficulty in separation, and yields affected by the seasonality of plant growth. Chemical synthesis methods require stringent conditions, limiting the production and application of bakuchiol. The biosynthetic pathway of bakuchiol has been shown to be non-linear, primarily using p-coumaric acid (ρ-CA) from the phenylpropanoid metabolic pathway and geranylpyrophosphate (GPP) from the mevalonic acid pathway as direct precursors, which are then synthesized under the catalysis of bakuchiol synthase. With the development of synthetic biology technology, the use of techniques such as genetic engineering and metabolic engineering to use microbial cells as synthetic factories for various high-value chemicals has become an emerging direction for the green and economical production and synthesis of various high-value chemicals.

[0003] Pichia pastoris ( Komagataella phaffii As a methyl-type nutritional yeast, Pichia pastoris can utilize methanol as its sole carbon source for growth and synthesis, and is also recognized as a GRAS strain, indicating its widespread safety. As the simplest eukaryotic expression system, Pichia pastoris, besides being safe and utilizing methanol as its sole carbon source, also possesses many advantages in expressing exogenous proteins. For example, Pichia pastoris can perform complex post-translational modifications on proteins like higher eukaryotes; it also has a strong promoter. P AOX1 The methanol oxidase 1 promoter (Pichia pastoris 1 promoter) offers advantages such as increased gene expression while utilizing methanol, simple operation, rapid growth, and high-density fermentation. Driven by synthetic biology, metabolic engineering of Pichia pastoris has progressed rapidly, with the successful construction, programming, design, and modification of various engineered cells for the production of polyketides, terpenes, polysaccharides, and other compounds. Furthermore, methanol, as a cheap, readily available, renewable, and low-carbon raw material, plays a crucial role in developing high-value chemical synthesis using Pichia pastoris as a substrate and methanol as a carbon source, significantly contributing to improving methanol utilization and the green and economical production of high-value chemicals.

[0004] However, there are currently no reports on the construction and application of engineered strains for the biosynthesis of psoralen using methanol as a carbon source and Pichia pastoris as a chassis. Therefore, developing engineered strains for the biosynthesis of psoralen using methanol as a raw material is of great significance for promoting the utilization of methanol and the green, rapid and economical production of psoralen. Summary of the Invention

[0005] In order to overcome the shortcomings and deficiencies of the prior art, the purpose of this invention is to provide a Pichia pastoris engineered strain for de novo synthesis of psoralen from methanol, its construction method and application.

[0006] To obtain a simple, efficient, and cost-effective method for producing high-yield psoralen, this invention uses a Pichia pastoris strain GS115 or its engineered strain S12 (a Pichia pastoris engineered strain tolerant to 6% methanol) as the starting strain. Under the regulation of the methanol oxidase AOX1 promoter, a high-yield p-coumaric acid (PCO)-producing strain is first constructed. p The engineered Pichia pastoris strain CA05 (2.49 g / L) expressed 2-coumaricacid (ρ-CA) and simultaneously expressed a full-length isoprenyltransferase (psoralen synthase) derived from the plant Psoralea corylifolia. PcPT07 Genes or those with 85 amino acids truncated at the N-terminus PcPT Δ85 Genes were used to obtain engineered strains BAK01 and BAK02 that synthesize psoralen using methanol as the sole carbon source; further, key genes of the endogenous mevalonic acid pathway (MVA pathway) in Pichia pastoris and a triple mutant of gerany pyrophosphate synthase from Saccharomyces cerevisiae were overexpressed. ScERG20 WWG Gene-derived acetyl-CoA thiolase from E. coli EcAtoB Genes were used to obtain engineered bacteria BAK10; and based on engineered bacteria BAK10, exogenous citrate lyase was expressed. MmACL Gene and flexible linker peptide linkage ScERG20 WWG and PcPT Δ85 By fusing and expressing genes, we obtained the engineered strain BAK12, a Pichia pastoris strain that can produce high levels of psoralen (91.2 mg / L in shake flasks and 692.8 mg / L in 15L fermenters) using methanol as the sole carbon source.

[0007] The objective of this invention is achieved through the following technical solution: A Pichia pastoris engineered strain for de novo synthesis of psoralen from methanol, wherein the engineered Pichia pastoris strain is a host strain of Pichia pastoris that produces high levels of p-coumaric acid from methanol, and the host strain heterologously expresses at least one copy of the PcPT07 gene or PcPT gene. Δ85 Gene.

[0008] Furthermore, the engineered Pichia pastoris strain also overexpresses any one or more of the following genes: HMGR gene, IDI gene, ERG12 gene, HMGS gene, ERG19 gene, ERG8 gene, and ScERG20 gene. WWG Gene (or ScERG20 gene), EcAtoB gene, MmACL gene, ScERG20 linked by flexible linker peptide WWG Genes and PcPT Δ85 Gene fusion expression of genes.

[0009] Furthermore, the Pichia pastoris engineered strain also had the endogenous His4 gene reintroduced.

[0010] Preferably, the flexible linker peptide includes GGGGS, GSG, or GGGS, etc.; more specifically, it is GGGGS.

[0011] Specifically, a Pichia pastoris engineered strain that de novo synthesizes psoralen from methanol is obtained by performing any of the following operations on a Pichia pastoris engineered strain that produces high levels of p-coumaric acid from methanol: (a) Heterologous expression of the PcPT07 gene or PcPT Δ85 Gene; or, (b) Heterologous expression of the PcPT07 gene or PcPT Δ85 Genes that simultaneously overexpress both the HMGR and IDI genes; or, (c) Heterologous expression of the PcPT07 gene or PcPT Δ85 Genes that simultaneously overexpress HMGR, IDI, and ERG12 genes; or, (d) Heterologous expression of two copies of the PcPT07 gene or PcPT Δ85 Genes that simultaneously overexpress HMGR, IDI, and ERG12 genes; or, (e) Heterologous expression of two copies of the PcPT07 gene or PcPT Δ85 Gene, heterologous expression of ScERG20 WWG Gene or ScERG20 gene, simultaneously overexpressing HMGR gene, IDI gene, and ERG12 gene, and supplementing the strain with His4 gene; or, (f) Heterologous expression of two copies of the PcPT07 gene or PcPT Δ85 Gene, heterologous expression of ScERG20 WWG Genes or ScERG20 gene, simultaneously overexpressing HMGR gene, IDI gene, ERG12 gene, HMGS gene, and supplementing strain with His4 gene; or, (g) Heterologous expression of two copies of the PcPT07 gene or PcPT Δ85Gene, heterologous expression of ScERG20 WWG Gene or ScERG20 gene, heterologous expression of EcAtoB gene, and simultaneous overexpression of HMGR gene, IDI gene, ERG12 gene, HMGS gene, and supplementary strain His4 gene; or, (h) Heterologous expression of two copies of the PcPT07 gene or PcPT Δ85 Gene, heterologous expression of ScERG20 WWG Gene or ScERG20 gene, heterologous expression of EcAtoB gene, and simultaneous overexpression of HMGR gene, IDI gene, ERG12 gene, HMGS gene, and ERG19 gene, with supplementary strain His4 gene; or, (i) Heterologous expression of two copies of the PcPT07 gene or PcPT Δ85 Gene, heterologous expression of ScERG20 WWG Gene or ScERG20 gene, heterologous expression of EcAtoB gene, and simultaneous overexpression of HMGR gene, IDI gene, ERG12 gene, HMGS gene, ERG19 gene, and ERG8 gene, with supplementary strain His4 gene; or, (j) Heterologous expression of two copies of the PcPT07 gene or PcPT Δ85 Gene, heterologous expression of ScERG20 WWG Gene or ScERG20 gene, heterologous expression of EcAtoB gene, simultaneous overexpression of HMGR gene, IDI gene, ERG12 gene, HMGS gene, ERG19 gene, ERG8 gene, heterologous expression of MmACL gene, and replacement of His4 gene in the strain; or, (k) Heterologous expression of two copies of the PcPT07 gene or PcPT Δ85 Gene, heterologous expression of ScERG20 WWG Gene or ScERG20 gene, heterologous expression of EcAtoB gene, simultaneous overexpression of HMGR gene, IDI gene, ERG12 gene, HMGS gene, ERG19 gene, ERG8 gene, heterologous expression of MmACL gene, heterologous expression of ScERG20 linked by flexible linker peptide GGGGS WWG Genes and PcPT Δ85 Gene fusion expression of the gene, and the His4 gene of the complement strain.

[0012] Among them, the Pichia pastoris engineered strain that produces high levels of p-coumaric acid in methanol conversion is obtained by performing any of the following operations on the starting strain of Pichia pastoris: (i) Heterologous expression of the FjTAL gene; or, (ii) Heterologous expression of the AtPAL2, AtC4H, and AtATR2 genes; or, (iii) Heterologous expression of the FjTAL gene, AtPAL2 gene, AtC4H gene, and AtATR2 gene; or, (iv) Heterologous expression of FjTAL gene, AtPAL2 gene, AtC4H gene, AtATR2 gene, ScAro7 G141S Gene; or, (v) Heterologous expression of FjTAL gene, AtPAL2 gene, AtC4H gene, AtATR2 gene, ScAro7 G141S Gene, ScPHA2 gene; or, (vi) Heterologous expression of FjTAL gene, AtPAL2 gene, AtC4H gene, AtATR2 gene, ScAro7 G141S Gene, ScPHA2 gene, and knockout of endogenous Aro10-1 gene.

[0013] Among them, FjTAL is derived from Flavobacterium johnsonii ( Flavobacterium johnsoniae The tyrosine ammonia-lysine hydrolase FjTAL; AtPAL2 is derived from Arabidopsis thaliana ( Arabidopsis thaliana AtPAL2, an phenylalanine ammonia-lyase; AtC4H, a cinnamic acid hydroxylase derived from Arabidopsis thaliana; AtATR2, a cytochrome P450 reductase derived from Arabidopsis thaliana; ScAro7 G141S Derived from brewer's yeast ( Saccharomyces cerevisiae The branching acid mutase ScAro7 is obtained by G141S mutation; ScERG20 WWG (ScERG20) F96W / N127W / K197G ) is derived from Saccharomyces cerevisiae ScERG20 through mutations of F96W, N127W, and K197G; PcPT07 is derived from the plant psoralen ( Cullen corylifolium PcPT07 was obtained by truncating 85 amino acids from its N-terminus. Δ85 ScPHA2 is a prephenylacetic acid dehydratase derived from Saccharomyces cerevisiae; EcAtoB is derived from Escherichia coli (…). Escherichia coli ) acetyl-CoA thiolysis enzyme EcAtoB; MmACL is derived from mice ( Mus musculus ) is an ATP-dependent citrate lyase MmACL.

[0014] The HMGR gene, IDI gene, ERG12 gene, HMGS gene, ERG19 gene, ERG8 gene, Aro10-1 gene, and His4 gene are all endogenous genes of Pichia pastoris.

[0015] Furthermore, the nucleotide sequences of the FjTAL gene, AtPAL2 gene, AtC4H gene, AtATR2 gene, PcPT07 gene, and MmACL gene are nucleotide sequences optimized by Pichia pastoris codons, respectively.

[0016] Furthermore, the nucleotide and amino acid sequences of the above genes are shown in Table 4.

[0017] Furthermore, the starting strain of Pichia pastoris includes Pichia pastoris GS115 or engineered strain S12, etc.

[0018] Furthermore, the above-mentioned gene is used to construct a gene expression cassette using the inducible promoter AOX1; the inducible promoter AOX1 is an inducible promoter AOX1 derived from Pichia pastoris.

[0019] Furthermore, the above-mentioned genes are integrated using Pichia pastoris neutral sites; the Pichia pastoris neutral sites include, but are not limited to, PNSI-2, PNSI-4, PNSI-6, PNSI-8, PNSI-9, PNSI-10, PNSI-12, PNSI-14, PNSI-16, PNSII-1, PNSII-4, PNSII-5, PNSII-6, etc.; specifically, the FjTAL gene is integrated into the PNSII-5 site; the AtPAL2 gene is integrated into the PNSI-2 site; the AtC4H gene and the AtATR2 gene are integrated into the PNSII-4 site; ScAro7 G141S Gene integration into PNSI-8 site; ScPHA2 gene integration into PNSI-6 site; PcPT07 gene or PcPT Δ85 Genes integrated into PNSI-10 and / or PNSI-12 sites; HMGR and IDI genes integrated into PNSI-14 sites; ERG12 gene integrated into PNSII-6 sites; HMGS gene integrated into PNSI-9 sites; HMGS and EcAtoB genes; ERG19 gene integrated into PNSII-1 sites; ERG19 and ERG8 genes integrated into PNSII-1 sites; ScERG20 WWG Alternatively, the ScERG20 gene can be integrated into the PNSI-12 site, the MmACL gene into the PNSI-16 site, and the ScERG20 gene can be linked by the flexible linker peptide GGGGS. WWG Genes and PcPT Δ85 The gene fusion expression gene is integrated into the PNSI-4 site.

[0020] Furthermore, when integrating or knocking out the aforementioned genes, CRISPR / Cas9 genome editing technology is used for seamless gene knock-in or knock-out. CRISPR / Cas9 gene editing technology is a technique for specifically modifying the DNA of a target gene. By designing specific guide RNAs (gRNAs) that bind to the target DNA sequence, the Cas9 protein, guided by the gRNA, precisely cuts the target DNA. During the DNA repair process, mutations may be introduced or new gene fragments may be inserted, thus achieving gene editing.

[0021] The method for constructing the Pichia pastoris engineered strain that synthesizes psoralen de novo from methanol includes the following steps: (A) Construction of Pichia pastoris engineered strain for high methanol-to-coumaric acid conversion: (A1) Based on Pichia pastoris GS115 or engineered strain S12, heterologous expression of the FjTAL gene yields engineered strains GF or SF; or, (A2) Based on Pichia pastoris GS115 or S12, heterologous expression of the AtPAL2, AtC4H, and AtATR2 genes yields engineered strains; or, (A3) Based on the engineered bacteria from step (A2), heterologous expression of the FjTAL gene is performed to obtain engineered bacteria; or, (A4) Based on the engineered bacteria in step (A3), heterologous expression of ScAro7 is performed. G141S Genes are used to obtain engineered bacteria; or, (A5) Based on the engineered bacteria from step (A4), heterologous expression of the ScPHA2 gene is performed to obtain engineered bacteria; or, (A6) Based on the engineered bacteria in step (A5), the endogenous Aro10-1 gene is knocked out to obtain engineered bacteria; 1) Based on the Pichia pastoris engineered strain that produces high levels of p-coumaric acid through methanol conversion in step (A), heterologously express at least one copy of the PcPT07 gene or PcPT gene. Δ85 Genes were used to obtain the engineered Pichia pastoris strain; or, 2) Based on the Pichia pastoris engineered strain from step 1), overexpress any one or more of the following genes: HMGR gene, IDI gene, ERG12 gene, HMGS gene, ERG19 gene, ERG8 gene, ScERG20 gene. WWG ScERG20 linked by genes (or ScERG20 gene), EcAtoB gene, MmACL gene, or flexible linker peptides (such as GGGGS). WWG Genes and PcPT Δ85 The Pichia pastoris engineered strain is obtained by fusing and expressing the gene; or, 3) Based on the Pichia pastoris engineered strain obtained in step 2), the endogenous His4 gene is reintroduced to obtain the Pichia pastoris engineered strain.

[0022] Specifically, the steps include the following: (B) Construction of Pichia pastoris engineered strain for de novo synthesis of psoralen from methanol: (B1) Based on the Pichia pastoris engineered strain that produces high levels of p-coumaric acid through methanol conversion in step (A), heterologous expression of the PcPT07 gene or PcPT gene is performed. Δ85 Genes are used to obtain engineered bacteria; or, (B2) Based on the engineered bacteria from step (B1), overexpress the HMGR gene and the IDI gene to obtain engineered bacteria; or, (B3) Based on the engineered bacteria from step (B2), overexpress the ERG12 gene to obtain engineered bacteria; or, (B4) Based on the engineered bacteria in step (B3), heterologously express the PcPT07 gene or PcPT. Δ85 Genes are used to obtain engineered bacteria; or, (B5) Based on the engineered bacteria in step (B4), heterologous expression of ScERG20 was performed. WWG By combining the gene or the ScERG20 gene with the endogenous His4 gene, engineered bacteria can be obtained; or, (B6) Based on the engineered bacteria from step (B5), overexpress the HMGS gene to obtain engineered bacteria; or, (B7) Based on the engineered bacteria from step (B6), heterologous expression of the EcAtoB gene is performed to obtain engineered bacteria; or, (B8) Based on the engineered bacteria from step (B7), overexpress the ERG19 gene to obtain engineered bacteria; or, (B9) Based on the engineered bacteria from step (B8), overexpress the ERG8 gene to obtain engineered bacteria; or, (B10) Based on the engineered bacteria from step (B9), heterologous expression of the MmACL gene is performed to obtain engineered bacteria; or, (B11) Based on the engineered bacteria in step (B10), heterologous expression of a flexible linker peptide (e.g., GGGGS) linked to ScERG20 is performed. WWG Genes and PcPT Δ85 Gene fusion and expression yields engineered bacteria.

[0023] The application of the Pichia pastoris engineered strain that converts methanol to synthesize psoralen de novo in high-yield psoralen production.

[0024] A method for preparing psoralen includes the following steps: The Pichia pastoris engineered strain that synthesizes psoralen from methanol was inoculated into a fermentation medium for fermentation culture and induced with methanol to realize the fermentation production of psoralen from methanol by Pichia pastoris.

[0025] Furthermore, the inoculation amount is the initial OD. 600 =0.9~1.1; the fermentation conditions are 30±1 ℃, 250±10 rpm, and fermentation for 120~144h; the amount of methanol is 1.0~3.0%, preferably 1.0~2.0%, and even more preferably 1.0~1.5%.

[0026] The present invention has the following advantages and effects compared with the prior art: This invention provides a Pichia pastoris engineered strain that uses methanol as a carbon source to synthesize psoralen, specifically by selecting the generally recognized safe (GRAS) Pichia pastoris GS115 or engineered strain S12 to convert methanol for fermentation to produce psoralen. By introducing heterologous p-coumaric acid synthesis pathways at different chromosomal neutral sites in Pichia pastoris using CRISPR / Cas9 gene editing technology, and through gene knockout, overexpression, or heterologous expression of key genes in the tyrosine and phenylalanine synthesis pathways of the shikimic acid pathway, a high-yielding p-coumaric acid strain (CA05, 2.49 g / L) was obtained. Furthermore, a heterologous psoralen biosynthesis pathway was introduced, psoralen synthase was overexpressed, and key genes in the MVA pathway and exogenous acetyl-CoA supply pathway genes were endogenously overexpressed or heterologously expressed. After methanol concentration optimization and strain His4 gene reinjection, the psoralen yield was effectively increased to 91.2 mg / L, a 59.8-fold increase compared to the initial strain (1.5 mg / L). The yield in a 15L fermenter was 692.8 mg / L, making it the only publicly disclosed engineered strain with the highest psoralen biosynthesis yield using Pichia pastoris as the chassis and methanol as the sole carbon source. The preparation method of the present invention has the characteristics of high conversion efficiency, low production cost, convenient preparation, and broad prospects for industrial application. Attached Figure Description

[0027] Figure 1 This is a pathway diagram of the de novo synthesis of psoralen from engineered Pichia pastoris using methanol as a carbon source.

[0028] Figure 2 This represents the ability of engineered bacteria to produce p-coumaric acid after the introduction of heterologous p-coumaric acid synthase; where A: high performance liquid chromatography (HPLC) detection graph of p-coumaric acid; B: graph of p-coumaric acid production by shake-flask fermentation.

[0029] Figure 3This represents the ability of engineered bacteria to synthesize psoralen after the introduction of heterologous psoralen synthase; where A: high performance liquid chromatography (HPLC) detection graph of psoralen; B: yield graph of psoralen and p-coumaric acid synthesized by shake-flask fermentation.

[0030] Figure 4 This figure shows the ability of different engineered strains producing p-coumaric acid to synthesize psoralen and p-coumaric acid after introducing heterologous psoralen synthase and some key genes and optimizing with methanol. Among them, A: psoralen synthesis ability of different engineered strains producing p-coumaric acid after introducing heterologous psoralen synthase; B: psoralen yield of some key genes overexpressed and optimized with methanol in shake flask fermentation.

[0031] Figure 5 The effect of psoralen synthesis after overexpression or heterologous expression of mevalonic acid pathway genes, heterologous expression of acetyl-CoA synthesis pathway genes, and fusion expression genes.

[0032] Figure 6 This is a graph showing the yield of a high-yield strain of psoralen in a 15L fermenter. Detailed Implementation

[0033] The present invention will be further described in detail below with reference to embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto. Test methods in the following embodiments that do not specify specific experimental conditions are generally performed under conventional experimental conditions or according to the manufacturer's recommended experimental conditions. Unless otherwise specified, the materials and reagents used are commercially available.

[0034] Information on strains and plasmids involved in the specific implementation method: Table 1. Strain Information

[0035] Table 2 Plasmid Information

[0036] Table 3 Integration or knockout sites

[0037] The pPICZA plasmid used in this invention is disclosed in the Pichia pastoris expression manual "EasySelect PichiaExpression Kit" (manual number 25-0172, June 2010 edition); The Addgene_83946 plasmid used was named pCfB2312 (TEF1p-Cas9-CYC1t_kanMX), a commercial yeast CRISPR / Cas9 plasmid purchased from the Addgene plasmid sharing library (https: / / www.addgene.org / 83946 / ).

[0038] The neutral integration sites used above are disclosed in the paper “Cai P, Duan X, Wu X, Gao L, Ye M, ZhouYJ. Recombination machinery engineering facilitates metabolic engineering of the industrial yeast Pichia pastoris. Nucleic Acids Res. 2021 Jul 21;49(13):7791-7805. doi: 10.1093 / nar / gkab535. PMID: 34197615; PMCID:PMC8287956.”.

[0039] Table 4 Gene Information

[0040] Note: The tyrosine ammonia-lyase FjTAL from Flavobacterium johnsonii, the phenylalanine ammonia-lyase AtPAL2, cinnamic acid hydroxylase AtC4H, and cytochrome P450 reductase AtATR2 from Arabidopsis thaliana, the PcPT07 from Psoralea corylifolia, and the ATP-dependent citrate lyase MmACL from mice, after codon optimization by Pichia pastoris, are shown in SEQ ID NO: 1-6, respectively.

[0041] The pathway diagram for the de novo synthesis of psoralen from methanol in engineered Pichia pastoris is shown below. Figure 1 As shown.

[0042] Example 1: Construction of engineered bacteria 1. PNSI-10-PcPT07 or PNSI-10-PcPT Δ85 Construction of expression carrier Using pPICZA as the starting plasmid, 800 bp each of the upstream and downstream homologous arms of the target sequence (Table 3) of the Pichia pastoris neutral site PNSI-10 were constructed into the pPICZA plasmid to obtain the plasmid pPICZA-PNSI-10. up -PNSI-10 down(Named plasmid PNSI-10-HA; in which, the upstream homologous arm 800bp is inserted between the ori element and the AOX1 promoter, and the downstream homologous arm 800bp is inserted between the AOX1 terminator and the TEF1 promoter).

[0043] Using homologous recombination, a method commonly used in molecular cloning, psoralen synthase PcPT07 or PcPT was introduced. Δ85 The gene (nucleotide sequence shown in SEQ ID NO: 5) was inserted into plasmid PNSI-10-HA. Pml I and Not Between I and II, plasmids PNSI-10-PcPT07 or PNSI-10-PcPT were obtained. Δ85 .

[0044] 2. Construction of Cas9-gPNSI-10 Using the commercial yeast CRISPR / Cas9 plasmid Addgene_83946 as a template, PCR was performed using primers F1 and R-10 to obtain circular PCR products. These products were then digested with template and transformed using a 42℃ heat shock method. E. coli The TOP10 samples were plated onto LB resistant plates containing 100 μg / mL of Ampicillin. After single colonies grew, the samples were sent to the company for whole plasmid sequencing. The plasmid that was correctly sequenced was named Cas9-gPNSI-10 plasmid.

[0045] F1: GTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCT; (Applicable to all sites) R-10: GCTATTTCTAGCTCTAAAAC ctggtactatgtcacagaac GCGTCACAGACAGGATTCG; where the lowercase letters represent the gRNA of the neutral site PNSI-10.

[0046] 3. Yeast electroporation conversion method (1) Use enzymes BamHI and AvrII to process the successfully constructed PNSI-10-PcPT07 or PNSI-10-PcPT Δ85 The plasmid was linearized and incubated at 37 °C for 2-3 h. The product was then recovered using a kit to obtain the donor fragment PNSI-10 for electroporation. up -P AOX1 -PcPT07-T AOX1 -PNSI-10 down Or, PNSI-10 up -PAOX1 -PcPT Δ85 -T AOX1 -PNSI-10 down Specifically, the linearization system consisted of (50 μL): 5 μL of 10×FastDigest Buffer, 2.5 μL of each enzyme, 2.0–3.0 μg of plasmid, and ddH2O to 50 μL. After the reaction, the linearization system was recovered using a PCR product recovery kit.

[0047] (2) Take the linearized fragment (donor) and mix it with 1.5-2.0 μg of Cas9-gPNSI-10 plasmid. Add it to Pichia pastoris CA05 competent cells, mix gently, transfer the mixture to an electric shock cup in an ice bath, and place it on ice for 5 min.

[0048] (3) Set the parameters of the electric shock device to Fungi mode, wipe the water off the outside of the electric shock cup, perform electric shock, and then add 1 mL of 1 M sorbitol in an ice bath.

[0049] (4) Aspirate all the mixture from the electroporation cup and transfer it to a 1.5 mL centrifuge tube. Place it in a 30 ℃ incubator and incubate for 1.0–1.5 h. Then centrifuge at 4000 rpm for 5 min.

[0050] (5) After removing the supernatant, resuspend the bacterial cells in 800-1000 μL of YPD medium. Place it on a constant temperature shaker and set the conditions to 30 ℃, 250 rpm, for 1.5-2 h, then centrifuge at 4000 rpm for 5 min.

[0051] (6) Remove 800-900 μL of supernatant, resuspend the bacterial cells in the remaining supernatant, and spread them all onto YPD (YPDG) plates containing 200-250 μg / mL G418 antibiotic. Incubate at 30 ℃ in an inverted incubator for 2-3 days.

[0052] 4. Recombinant strain resistance knockout (1) Identify the transformants from step 2. For correctly identified strains, inoculate them into 10 mL of YPD liquid medium, place them on a shaker, and incubate overnight at 30 ℃ and 250 rpm. (2) On a clean bench, use a sterile inoculation loop or pipette tip to dip a small amount of bacterial solution into an antibiotic-free YPD plate and streak it on the plate. Then place the plate in a 30 ℃ incubator and invert it for 1 to 2 days.

[0053] (3) On the clean bench, pick up a small amount of Pichia pastoris single colony with a sterile pipette tip and mix it with 5 μL of sterile water by blowing and aspiration. Then, take 2.5 μL of the mixture and spot it on YPD and YPDG plates respectively. Place the plates in a 30 ℃ constant temperature incubator and invert them for 1-2 days.

[0054] (4) Observe the YPD and YPDG plates after spot culture. If there are no colonies on the YPDG plate, but the colonies on the corresponding positions on the YPD plate grow normally, it proves that the G418 resistance of the recombinant strain has been successfully removed. At this time, the corresponding colonies on the YPD plate are the engineered bacteria BAK01 or BAK02.

[0055] 5. Construction process of engineered bacteria GF, SF, GFB, SF, CA01~CA05, BAK01~BAK12: 1) Referring to steps 1-4 above in this embodiment, construct plasmid PNSII-5-FjTAL, and introduce the FjTAL gene into GS115 and engineered strain S12 respectively to obtain engineered strains GF and SF; construct plasmids PNSI-2-AtPAL2 and PNSII-4-AtC4H-AtATR2, and introduce the AtPAL2, AtC4H, and AtATR2 genes into engineered strain S12 to obtain engineered strain CA01; based on engineered strain CA01, heterologously express the FjTAL gene to obtain strain CA02; construct plasmid PNSI-8-ScAro7 G141S Based on the engineered strain CA02, ScAro7 was heterologously expressed. G141S Genes were extracted to obtain engineered bacteria CA03; plasmid PNSI-6-ScPHA2 was constructed, and the ScPHA2 gene was heterologously expressed in engineered bacteria CA03 to obtain engineered bacteria CA04; the upstream and downstream homologous arms of the target sequence of the Aro10-1 gene (Table 3) were ligated to Aro10... up- Aro10 down The gene fragment was used as the donor for Aro10-1 gene knockout. Based on the engineered strain CA04, the endogenous Aro10-1 gene was knocked out to obtain the engineered strain CA05. The strain information is shown in Table 1, the plasmid information is shown in Table 2, the integration or knockout site is shown in Table 3, and the gene information is shown in Table 4.

[0056] In addition, referring to step 1 above in this embodiment, plasmids PNSII-4-AtC4H and PNSII-4-AtATR2 were constructed; then the AtATR2 expression cassette (P AOX1 -AtATR2-T AOX1 The AOX1 terminator inserted into plasmid PNSII-4-AtC4H and PNSII-4 downPlasmid PNSII-4-AtC4H-AtATR2 was obtained by cutting the ScaI restriction site between the two enzymes.

[0057] 2) Referring to steps 1 to 4 above in this embodiment, place the PcPT Δ85 The PcPT07 and PcPT were introduced into the PNSI-10 sites of engineered bacteria GF and SF, respectively, to obtain engineered bacteria GFB and SFB, respectively; PcPT07 and PcPT were then used to obtain engineered bacteria GFB and SFB. Δ85 The genes HMGR and IDI were introduced into the PNSI-10 site of the engineered strain CA05 to obtain engineered strains BAK01 and BAK02, respectively. The plasmid PNSI-14-HMGR-IDI was constructed, and the genes HMGR and IDI were introduced into engineered strain BAK02 to obtain engineered strain BAK03. The plasmid PNSII-6-ERG12 was constructed, and the gene ERG12 was introduced into engineered strain BAK03 to obtain engineered strain BAK04. The plasmid PNSI-12-PcPT was constructed. Δ85 , to use gene PcPT Δ85 The engineered bacteria BAK04 was introduced to obtain engineered bacteria BAK05; plasmid PNSI-12-PcPT was constructed. Δ85 -ScERG20 WWG , to use the gene PcPT Δ85 and ScERG20 WWG The His4 gene was introduced into engineered bacteria BAK04, and then inserted back into the culture to obtain engineered bacteria BAK06. Plasmid PNSI-9-HMGS was constructed, and the HMGS gene was introduced into engineered bacteria BAK06 to obtain engineered bacteria BAK07. Plasmid PNSI-9-HMGS-EcAtoB was constructed, and the HMGS and EcAtoB genes were introduced into engineered bacteria BAK06 to obtain engineered bacteria BAK08. Plasmid PNSII-1-ERG19 was constructed, and the ERG19 gene was introduced into engineered bacteria BAK08 to obtain engineered bacteria BAK09. Plasmid PNSII-1-ERG19-ERG8 was constructed, and the ERG19 and ERG8 genes were introduced into engineered bacteria BAK08 to obtain engineered bacteria BAK10. Plasmid PNSI-16-MmACL was constructed, and the MmACL gene was introduced into engineered bacteria BAK10 to obtain engineered bacteria BAK11. Plasmid PNSI-4-ScERG20 was constructed. WWG -GGGGS-PcPT Δ85 The fused expression gene ScERG20 WWG -GGGGS-PcPT Δ85 The engineered strain BAK11 was introduced to obtain engineered strain BAK12. The strain information is shown in Table 1, the plasmid information in Table 2, the integration or knockout sites in Table 3, and the gene information in Table 4.

[0058] In addition, following the construction process of plasmid PNSII-4-AtC4H-AtATR2, the expression cassette of the IDI gene (P... AOX1 -IDI-T AOX1 The expression cassette of the ERG8 gene was inserted into the PacI restriction site of plasmid PNSI-14-HMGR to obtain plasmid PNSI-14-HMGR-IDI; AOX1 -ERG8-T AOX1 Insert the ScERG20 enzyme into the AvrII restriction site of plasmid PNSII-1-ERG19 to obtain plasmid PNSII-1-ERG19-ERG8; WWG Gene expression cassette (P AOX1 -ScERG20 WWG -T AOX1 Inserted into plasmid PNSI-12-PcPT Δ85 Plasmid PNSI-12-PcPT was obtained by cutting the enzyme at the AvrII restriction site. Δ85 -ScERG20 WWG The expression cassette of the EcAtoB gene (P) AOX1 -EcAtoB-T AOX1 The enzyme was inserted into the HpaI restriction site of plasmid PNSI-9-HMGS to obtain plasmid PNSI-9-HMGS-EcAtoB.

[0059] Example 2: Production of p-coumaric acid by shake-flask fermentation of engineered bacteria GF, SF, CA01-CA05 Engineered bacteria GF, SF, and CA01–CA05 were inoculated into 10 mL of BMGY medium and cultured on a constant-temperature shaker for 24 h at 30 ℃ and 250 rpm. The initial OD values ​​were then used as the starting point. 600 =1 was transferred to 25 mL BMMY medium, and 1% (v / v) methanol was added for induced fermentation. After 144 h of culture, p-coumaric acid was determined. The p-coumaric acid detection method was as follows: 1 mL of fermentation broth was centrifuged, and the supernatant was filtered through an organic filter membrane for sterilization before p-coumaric acid production was determined by liquid chromatography. The liquid chromatography detection conditions were: C18 column (Synergi™ 4μm Hydo-RP80, Aphenomenex), Shimadzu SPD-16 high-performance liquid chromatograph. The mobile phase ratio was 0.1% formic acid water:methanol = 15:85, the flow rate was 0.5 mL / min, the temperature was room temperature, the detection wavelength was 308 nm, and the injection volume was 2 μL. Figure 2The results showed that after 144 h of fermentation, the p-coumaric acid production of engineered strain SF was superior to that of engineered strain GF. Engineered strain S12 was selected for subsequent engineered strain construction. The p-coumaric acid production of engineered strains CA01 to CA05 gradually increased, and the p-coumaric acid production of engineered strain CA05 was 2.49 g / L, which can provide sufficient precursors for psoralen synthesis.

[0060] Example 3: Production of psoralen by shake-flask fermentation of BAK01 and BAK02 strains BAK01 and BAK02 strains were inoculated into 10 mL of BMGY medium and cultured on a constant-temperature shaker for 24 h at 30 ℃ and 250 rpm. The initial OD was then used as the starting point. 600 =1 was transferred to 25 mL BMMY medium, and 1% methanol was added for induced fermentation. After 144 h of culture, the yields of p-coumaric acid and psoralen and the growth status of the strain were measured, i.e., OD. 600 (Bacterial density). The extraction and detection method for psoralen was as follows: 1 mL of fermentation broth was centrifuged at 12000 rpm for 1–2 min. The supernatant was filtered through an organic filter membrane for sterilization, and the yield of p-coumaric acid was determined by liquid chromatography (HPLC) according to Example 2. Since psoralen is present within cells, the cell pellet after centrifugation was collected, resuspended in 1 mL of methanol, and 600–700 mg of grinding beads (silica beads) were added. The pellet was then ground in a low-temperature grinder for 30 min at 50 Hz and 4°C. The resulting mixture was then centrifuged at 12000 rpm for 1–2 min. The supernatant was collected, filtered through a 0.22 μm organic filter membrane for sterilization, and then placed in an HPLC sample vial. The HPLC detection conditions were: C18 column (Synergi™ 4 μm Hydo-RP80, Aphenomenex), and detection was performed using a Shimadzu SPD-16 high-performance liquid chromatograph. The mobile phase ratio was 0.1% formic acid water: methanol = 15:85, the flow rate was 1 mL / min, the temperature was room temperature, the detection wavelength was 246 nm, and the injection volume was set to 10 μL. Figure 3 The results showed that after 144 h of fermentation, the BAK01 and BAK02 groups accumulated 1.5 mg / L and 2.7 mg / L of psoralen, respectively, and the coumaric acid yield was approximately 2.5 g / L. In contrast, no psoralen was detected in the engineered strain CA05, and the coumaric acid yield was approximately 2.49 g / L. This indicates that the psoralen synthase with 85 amino acids truncated at the N-terminus has higher catalytic activity. Therefore, the engineered strain BAK02 was selected for subsequent engineered strain construction.

[0061] Example 4: Production of psoralen by shake-flask fermentation of engineered bacteria BAK02, GFB and SFB Since the biosynthetic pathway of psoralen is non-linear, in order to investigate whether the p-coumaric acid synthesis pathway of high-yielding p-coumaric acid strains constitutes carbon competition for psoralen production, thus causing a decrease in psoralen synthesis, PcPT was used. Δ85 The gene was introduced into the GF and SF strains, which produce low levels of p-coumaric acid, respectively. Following the method described in Example 2, the engineered strains BAK02, GFB, and SFB were inoculated into 25 mL of BMMY medium, and 1% methanol was added to induce fermentation. After 144 h of culture, the yields of psoralen and p-coumaric acid, as well as the growth status of the strains (OD), were measured. 600 (Bacterial density). The determination method is the same as in Examples 2 and 3. From... Figure 4 Results A show that the low-producing paracoumaric acid engineered strains GF and SF, and the high-producing paracoumaric acid engineered strain CA05, did not significantly increase the synthesis of psoralen. This indicates that the carbon competition between the paracoumaric acid synthesis pathway and the GPP synthesis pathway in engineered strain CA05 did not affect the synthesis of psoralen. This may be because paracoumaric acid is mainly transported outside the cell after synthesis, while the synthesis and storage of psoralen are mainly intracellular. The high concentration of paracoumaric acid synthesis provides sufficient precursors for the intracellular synthesis of psoralen, thereby increasing the synthesis of psoralen. At the same time, it also indicates that the intracellular synthesis of psoralen is mainly limited by the supply of another precursor, GPP. Therefore, in order to ensure a sufficient supply of paracoumaric acid, the high-producing paracoumaric acid engineered strain CA05 was used as the starting strain for subsequent gene manipulation.

[0062] Example 5: MAV pathway and methanol optimization to enhance psoralen synthesis To further enhance psoralen biosynthesis, key genes involved in the synthesis of gerany pyrophosphate (GPP) via the mevalonate pathway were overexpressed. Following the method in Example 3, engineered strain BAK03, overexpressing the endogenous HMGR and IDI genes, was inoculated into 25 mL of BMMY medium. Fermentation was induced by adding 1%, 1.5%, 2%, and 3% methanol, respectively. After 144 h of culture, the psoralen yield and the growth status of the strain (OD) were measured. 600 (Bacterial density). The determination method is as described in Example 3. From Figure 4 Results B show that overexpression of the key MVA pathway genes HMGRS and IDI increased the psoralen accumulation in the strain to 4.2 mg / L. When induced with 1.5% methanol, the psoralen accumulation further increased to 5.6 mg / L. This indicates that overexpression of the key MVA pathway genes and optimization of methanol addition can significantly increase the psoralen accumulation in the engineered strain.

[0063] Furthermore, based on strain BAK03, key genes for endogenous or exogenous GPP synthesis in Pichia pastoris were overexpressed, and the His4 gene was reintroduced to restore the strain's growth, thus constructing engineered strains BAK04–BAK10. After fermentation for 144 h under 1.5% methanol induction, the accumulation of psoralen, the yield of coumaric acid, and the growth status of the strains (OD) were measured. 600 (Bacterial density). The determination method is the same as in Examples 2 and 3. From... Figure 5 The results showed that the engineered bacterium BAK05 integrated two copies of the exogenous gene PcPT. Δ85 The psoralen production of strain BAK04 increased to 9.1 mg / L, which is 1.5 times that of engineered strain BAK04 (6.2 mg / L); engineered strain BAK06 (integrated the exogenous triple mutant gene ScERG20) WWG (And the His4 gene of the strain was reintroduced). At this time, the production of p-coumaric acid in the strain decreased to 2.0 g / L, while the production of psoralen increased to 26.0 mg / L, which is 2.86 times that of the engineered strain BAK05, indicating that PcPT... Δ85 Two copies and exogenous triple mutant gene ScERG20 WWG The reintroduction of the His4 gene had a positive effect on increasing psoralen synthesis. The engineered strain BAK08 (overexpressing the key MVA pathway gene HMGS and integrating the exogenous EcAtoB gene) showed the highest psoralen accumulation at 44.5 mg / L, which was 28.7 times higher than that of engineered strain BAK01 (1.5 mg / L) and 7.9 times higher than that of engineered strain BAK03 (5.6 mg / L). Subsequently, further overexpression of the MVA pathway genes ERG19 and ERG8 in engineered strain BAK08 did not significantly increase psoralen accumulation.

[0064] Example 6: Precursor and substrate channels enhance psoralen synthesis To further investigate the limiting factors in psoralen synthesis, the efficacy of the heterologous acetyl-CoA synthesis pathway, namely the ATP-dependent citrate lyase (MmACL) pathway, was tested based on the engineered strain BAK10 from Example 5, resulting in engineered strain BAK11. After fermentation for 72 h under 1.5% methanol induction, the psoralen accumulation, coumaric acid production, and growth status of the strain were measured, i.e., OD. 600 (Bacterial density). The determination method is the same as in Examples 2 and 3. From... Figure 5 The results showed that the ATP-dependent citrate lyase (MmACL) pathway can cleave citrate into acetyl-CoA, increasing the supply of acetyl-CoA through the MVA pathway, which in turn increased the amount of psoralen synthesized by the strain to 81.4 mg / L, which is 53.3 times higher than that of strain BAK01 (1.5 mg / L).

[0065] To further increase the synthesis of psoralen, GGGGS(GGAGGAGGAGGATCT) linked to SCERG20 was heterologously overexpressed on the engineered strain BAK11. WWG and PcPT Δ85 Gene fusion expression was used to reduce the loss of the key intermediate GPP and increase the copy number of the key gene for psoralen synthesis, resulting in the engineered strain BAK12. After fermentation for 72 h under 1.5% methanol induction, the psoralen accumulation, coumaric acid production, and growth status of the strain were measured, i.e., OD. 600 (Bacterial density). The determination method is as described in Examples 2 and 3. The results are as follows: Figure 5 As shown, heterologous overexpression of GGGGS-linked ScERG20 WWG and PcPT Δ85 After gene fusion expression, the psoralen synthesis of the strain increased to 91.2 mg / L, which is 59.8 times higher than that of strain BAK01 (1.5 mg / L).

[0066] Example 7: High-density fermentation of engineered strain BAK12 in a 15L fermenter To test the high-density fermentation capacity of the engineered bacteria, a fed-batch fermentation experiment was conducted in a 15L fermenter. The engineered bacteria BAK12 obtained above was used as an example strain for fed-batch fermentation in a 15L fermenter.

[0067] The fed-batch fermentation process precisely controlled the carbon source for cell growth and product accumulation. The initial phase occurred in BSM medium at 30 °C, with the pH stabilized at 5.5 by continuous ammonia addition. After approximately 20 h of culture, the glycerol in the BSM medium was depleted, and dissolved oxygen in the fermenter rapidly increased. At this point, while maintaining constant temperature and pH, glycerol was added at a flow rate of 5-10 g / h (12 mL of PTM1 was added for every 1 L of glycerol). At 32.6 h of culture, the OD of the strain... 600 When the concentration reaches 200, feeding is paused for 1 hour. After the glycerol from the starvation period is depleted, the methanol induction phase begins. The temperature is adjusted to 25 °C, the pH is set to 6.0, and the flow rate is gradually increased to 700-900 rpm. In the initial stage of the methanol induction phase, methanol is added at a flow rate of 17 g / h, while simultaneously observing dissolved oxygen changes over 10 minutes to assess the methanol concentration in the fermenter and the strain's methanol utilization capacity. Specifically, dissolved oxygen is monitored; if it fluctuates regularly between 10% and 40% within 10 minutes, it indicates no methanol accumulation, thus helping to prevent excessive methanol accumulation from causing toxic effects on the cells. Once the strain adapts to this methanol flow rate, the flow rate can be gradually increased. Figure 6As shown, with the continuous feeding of methanol, the accumulation of psoralen increased significantly, while the rate of biomass increase slowed down. Fermentation was terminated after 72 h of induction, at which point the maximum OD was observed. 600 The peak yield of bakuchiol reached 438.9 mg / L during the entire fermentation cycle of 68.6 h. It is suspected that bakuchiol was degraded or consumed by other processes during subsequent fermentation and could not accumulate.

[0068] PTM1 is disclosed in the literature “CN118389310A, A Pichia pastoris engineered strain with high β-arbutin production and its construction method and application”.

[0069] The metabolic engineering strategy employed in this invention has a significant effect on enhancing the de novo synthesis of psoralen from methanol by Pichia pastoris. It verifies the influence of the exogenous acetyl-CoA synthesis pathway on psoralen synthesis. Finally, a Pichia pastoris engineered strain that can utilize methanol as the sole carbon source was obtained, which produced a maximum of 91.2 mg / L of psoralen at the shake flask level and a maximum of 692.8 mg / L of psoralen at the 15L fermenter level. This is the highest psoralen biosynthesis Pichia pastoris engineered strain disclosed to date.

[0070] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A Pichia pastoris engineered strain that de novo synthesizes bakuchiol from methanol, characterized in that, The Pichia pastoris engineered strain uses a Pichia pastoris engineered strain that produces high levels of p-coumaric acid from methanol as the host strain, and heterologously expresses at least one copy of the PcPT07 gene or PcPT in the host strain. Δ85 Gene; Among them, PcPT07 is derived from the plant psoralen (… Cullen corylifolium The amino acid sequence encoded by the PcPT07 gene is shown in XKH16004.1; PcPT07 is truncated by 85 amino acids from its N-terminus to obtain PcPT. Δ85 ; The Pichia pastoris engineered strain that produces high levels of p-coumaric acid for methanol conversion is obtained by performing any of the following operations on the Pichia pastoris starting strain: (i) Heterologous expression of the FjTAL gene; or, (ii) Heterologous expression of the AtPAL2, AtC4H, and AtATR2 genes; or, (iii) Heterologous expression of the FjTAL gene, AtPAL2 gene, AtC4H gene, and AtATR2 gene; or, (iv) Heterologous expression of FjTAL gene, AtPAL2 gene, AtC4H gene, AtATR2 gene, ScAro7 G141S Gene; or, (v) Heterologous expression of FjTAL gene, AtPAL2 gene, AtC4H gene, AtATR2 gene, ScAro7 G141S Gene, ScPHA2 gene; or, (vi) Heterologous expression of FjTAL gene, AtPAL2 gene, AtC4H gene, AtATR2 gene, ScAro7 G141S Gene, ScPHA2 gene, and knockout of endogenous Aro10-1 gene.

2. The Pichia pastoris engineered strain for de novo synthesis of bakuchiol from methanol according to claim 1, characterized in that: The Pichia pastoris engineered strain that synthesizes psoralen de novo from methanol also overexpresses any one or more of the following genes: HMGR gene, IDI gene, ERG12 gene, HMGS gene, ERG19 gene, ERG8 gene, and ScERG20 gene. WWG Genes or ScERG20 gene, EcAtoB gene, MmACL gene, ScERG20 linked by flexible linker peptides WWG Genes and PcPT Δ85 Gene fusion expression genes; among them, ScERG20 WWG It is ScERG20 F96W / N127W / K197G .

3. The Pichia pastoris engineered strain for de novo synthesis of bakuchiol from methanol according to claim 2, characterized in that: The Pichia pastoris engineered strain that synthesizes psoralen de novo from methanol also had its endogenous His4 gene reintroduced.

4. The Pichia pastoris engineered strain for de novo synthesis of bakuchiol from methanol according to claim 3, characterized in that: FjTAL is derived from Flavobacterium johnsonii ( Flavobacterium johnsoniae AtPAL2, AtC4H, and AtATR2 are all derived from Arabidopsis thaliana. Arabidopsis thaliana );ScAro7 G141S Derived from brewer's yeast ( Saccharomyces cerevisiae The branching acid mutase ScAro7 is obtained by G141S mutation; ScERG20 WWG ScERG20, derived from *Saccharomyces cerevisiae*, was obtained through mutations of F96W, N127W, and K197G; ScPHA2 was derived from *Saccharomyces cerevisiae*; EcAtoB was derived from *Escherichia coli*. Escherichia coli MmACL is derived from mice ( Mus musculus ); The HMGR gene, IDI gene, ERG12 gene, HMGS gene, ERG19 gene, ERG8 gene, Aro10-1 gene, and His4 gene are all endogenous genes of Pichia pastoris.

5. The Pichia pastoris engineered strain for de novo synthesis of bakuchiol from methanol according to claim 4, characterized in that: The amino acid sequence encoded by the FjTAL gene is shown in WP_012023194.1; The amino acid sequence encoded by the AtPAL2 gene is shown in NP_190894.1; The amino acid sequence encoded by the AtC4H gene is shown in NP_180607.1; The amino acid sequence encoded by the AtATR2 gene is shown in NP_194750.1; The ScAro7 G141S The amino acid sequence encoded by the gene is NP_015385.1 obtained through the G141S mutation; The amino acid sequence encoded by the ScPHA2 gene is shown in NP_014083.2; The amino acid sequence encoded by the Aro10-1 gene is shown in XP_002492304.1; The amino acid sequence encoded by the HMGR gene is shown in XP_002491966.1; The amino acid sequence encoded by the IDI gene is shown in XP_002490560.1; The amino acid sequence encoded by the ERG12 gene is shown in XP_002489531.1; The amino acid sequence encoded by the ScERG20 gene is shown in NP_012368.1; The ScERG20 WWG The amino acid sequence encoded by the gene is NP_012368.1 obtained through the F96W / N127W / K197G mutation; The amino acid sequence encoded by the His4 gene is shown in XP_002490271.1; The amino acid sequence encoded by the HMGS gene is shown in XP_002491079.1; The amino acid sequence encoded by the EcAtoB gene is shown in NP_416728.1; The amino acid sequence encoded by the ERG19 gene is shown in XP_002490117.1; The amino acid sequence encoded by the ERG8 gene is shown in XP_002491868.1; The amino acid sequence encoded by the MmACL gene is shown in NP_001186225.

1.

6. The Pichia pastoris engineered strain for de novo synthesis of psoralen from methanol according to claim 4 or 5, characterized in that: Gene expression cassettes were constructed using the inducible promoter AOX1; the inducible promoter AOX1 was derived from Pichia pastoris. The gene was integrated using Pichia pastoris neutral sites; the Pichia pastoris neutral sites include PNSI-2, PNSI-4, PNSI-6, PNSI-8, PNSI-9, PNSI-10, PNSI-12, PNSI-14, PNSI-16, PNSII-1, PNSII-4, PNSII-5, and PNSII-6.

7. The Pichia pastoris engineered strain for de novo synthesis of bakuchiol from methanol according to claim 6, characterized in that: The FjTAL gene integrates into the PNSII-5 site; the AtPAL2 gene integrates into the PNSI-2 site; the AtC4H and AtATR2 genes integrate into the PNSII-4 site; ScAro7 G141S Gene integration into PNSI-8 site; ScPHA2 gene integration into PNSI-6 site; PcPT07 gene or PcPT Δ85 Genes integrated into PNSI-10 and / or PNSI-12 sites; HMGR and IDI genes integrated into PNSI-14 sites; ERG12 gene integrated into PNSII-6 sites; HMGS gene integrated into PNSI-9 sites; HMGS and EcAtoB genes; ERG19 gene integrated into PNSII-1 sites; ERG19 and ERG8 genes integrated into PNSII-1 sites; ScERG20 WWG Alternatively, the ScERG20 gene can be integrated into the PNSI-12 site, the MmACL gene into the PNSI-16 site, and the ScERG20 gene can be linked by a flexible linker peptide. WWG Genes and PcPT Δ85 The gene fusion expression gene is integrated into the PNSI-4 site.

8. The method for constructing the Pichia pastoris engineered strain for de novo synthesis of psoralen from methanol according to any one of claims 1 to 7, characterized in that: Includes the following steps: (A) Construction of Pichia pastoris engineered strain for high methanol-to-coumaric acid conversion: (A1) Based on Pichia pastoris GS115 or engineered strain S12, heterologous expression of the FjTAL gene yields engineered strains GF or SF; or, (A2) Based on Pichia pastoris GS115 or S12, heterologous expression of the AtPAL2, AtC4H, and AtATR2 genes yields engineered strains; or, (A3) Based on the engineered bacteria in step (A2), the FjTAL gene is heterologously expressed to obtain engineered bacteria; or, (A4) Based on the engineered bacteria in step (A3), heterologous expression of ScAro7 is performed. G141S Genes were used to obtain engineered bacteria; or, (A5) Based on the engineered bacteria in step (A4), the ScPHA2 gene is heterologously expressed to obtain engineered bacteria; or, (A6) Based on the engineered bacteria in step (A5), the endogenous Aro10-1 gene is knocked out to obtain engineered bacteria; 1) Based on the Pichia pastoris engineered strain that produces high levels of p-coumaric acid through methanol conversion in step (A), heterologously express at least one copy of the PcPT07 gene or PcPT gene. Δ85 Genes were used to obtain the engineered Pichia pastoris strain; or, 2) Based on the Pichia pastoris engineered strain from step 1), overexpress any one or more of the following genes: HMGR gene, IDI gene, ERG12 gene, HMGS gene, ERG19 gene, ERG8 gene, ScERG20 gene. WWG Genes or ScERG20 gene, EcAtoB gene, MmACL gene, ScERG20 linked by flexible linker peptides WWG Genes and PcPT Δ85 The Pichia pastoris engineered strain is obtained by fusing and expressing the gene; or, 3) Based on the Pichia pastoris engineered strain obtained in step 2), the endogenous His4 gene is reintroduced to obtain the Pichia pastoris engineered strain.

9. The application of the Pichia pastoris engineered strain for de novo synthesis of psoralen from methanol as described in any one of claims 1 to 7 in high-yield psoralen production.

10. A method for preparing psoralen, characterized in that, Includes the following steps: The engineered Pichia pastoris strain that synthesizes psoralen de novo from methanol according to any one of claims 1 to 7 is inoculated into a fermentation medium for fermentation culture and induced with methanol to realize the fermentation production of psoralen from methanol by Pichia pastoris.

Citation Information

Patent Citations

  • Pichia pastoris engineering bacterium capable of producing beta-arbutin at high yield as well as construction method and application of pichia pastoris engineering bacterium

    CN118389310A

  • Saccharomyces cerevisiae engineering strain for producing bakuchiol as well as construction method and application thereof

    CN118909814A

  • Recombinant yeast for producing bakuchiol as well as construction method and application of recombinant yeast

    CN119842510A

  • Recombinant pichia pastoris strain as well as construction method and application thereof

    CN120624508A

Cited By

  • Saccharomyces cerevisiae engineering bacteria for producing psoralen as well as construction method and application of saccharomyces cerevisiae engineering bacteria

    CN121227551A

  • A saccharomyces cerevisiae engineering bacterium for producing psoralin and a construction method and application thereof

    CN121227551B