Papaya CpMp gene, protein, primer pair, recombinant expression vector and application
By providing the papaya CpMp gene and a recombinant expression vector, the length of the inflorescence stalk can be regulated and the sex can be identified, solving the problem of regulating the length of the papaya inflorescence stalk and identifying the sex, thus improving plant growth and economic value.
Patent Information
- Application Number
- CN202511141387.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-15
- Publication Date
- 2025-11-14
AI Technical Summary
Existing technologies are insufficient to effectively control the length of papaya inflorescence peduncles and identify their sex, thus affecting plant growth and economic value.
The papaya CpMp gene and its encoded protein were provided. The CpMp gene was overexpressed using a recombinant expression vector. Primer pairs were designed to identify the sex of the plant by utilizing the promoter differences of the CpMp gene in hermaphroditic and male plants.
This study enabled the regulation of inflorescence stalk length, increased the development space for young fruits in female plants and hermaphroditic plants, provided molecular markers for early sex verification, and improved the accuracy and economic value of papaya sex identification.
Smart Images

Figure CN120944904A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant genetic engineering technology, and in particular to the papaya CpMp gene, protein, primer pairs, recombinant expression vector, and applications. Background Technology
[0002] Papaya (Carica papaya L.) has three sexes: female, male, and hermaphroditic, consisting of XX, XY, and XY flowers respectively. h The sex chromosomes are determined by three corresponding chromosomes. The specific region of the Y chromosome compared to the X chromosome is the Male-Specific Region of the Y chromosome (MSY). h The specific region of the Y chromosome compared to the X chromosome is HSY (Hermaphrodite-Specific Region of Y chromosome). Three types of sex differentiation are characterized by distinct flowers: female flowers have fully developed pistils and no stamens; hermaphroditic flowers have both stamens and pistils; and male flowers have severely degenerated pistils, manifested as long peduncles with branched inflorescences bearing numerous small male flowers. These characteristics are highly advantageous for studying the differentiation of sexes, such as the development of floral organs in papaya. Therefore, papaya is an advantageous plant for studying sex differentiation.
[0003] CpMp evolved from a paralogous gene of SVP on the Y chromosome through mutation and positive selection, acquiring a new function. SVP (Short Vegetative Phase) is a gene encoding a MADS-box protein, an important transcription factor that represses flowering. SVP belongs to the MADS-box protein family, and this protein plays a crucial role in floral organ regulation and plant development by binding to cis-elements (CArGbox). The inventors previously conducted in-depth research on the sex chromosome regions of papaya, discovering two paralogous genes of the CpMp gene in papaya: CpSVP-A on chromosome 5 and CpMp on sex chromosome 1. CpMp has two alleles: the dominant allele CpMp on the Y chromosome that promotes the development of male flower peduncle length, and the Y chromosome allele Y. h The recessive allele cpmp on chromosomes has lost its function. h CpMp is located in the sex-determining region of the Y chromosome and is absent on the X chromosome. Therefore, the male-specific gene CpMp was once considered a candidate gene for sex control. All three sexes of papaya have a CpSVP-A gene on their autosomes, which is a functional gene for maintaining normal plant growth and development.
[0004] Of the three sexes, male plants were the only ones to exhibit long inflorescence stalks, while female plants and hermaphroditic plants both exhibited short inflorescence stalks. The gene controlling the long inflorescence stalk is likely located in the recombination repression region (MSY region). Summary of the Invention
[0005] The purpose of this invention is to provide the papaya CpMp gene, protein, primer pairs, recombinant expression vector, transformant, and applications. The papaya CpMp gene has the function of regulating the length of the inflorescence stalk and can also be used to identify the sex of papaya.
[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0007] This invention provides a papaya CpMp gene, the nucleotide sequence of which is shown in SEQ ID No. 1.
[0008] The present invention also provides a CpMp protein encoded by the papaya CpMp gene, the amino acid sequence of which is shown in SEQ ID No. 2.
[0009] This invention also provides the application of the aforementioned papaya CpMp gene or the aforementioned CpMp protein in regulating the length of the inflorescence stalk of the plant.
[0010] This invention also provides the application of the aforementioned papaya CpMp gene or the aforementioned CpMp protein in identifying the sex of papaya.
[0011] This invention also provides the application of overexpression of the aforementioned papaya CpMp gene in the cultivation of white female papaya with long inflorescence stalks.
[0012] The present invention also provides a primer pair for amplifying the papaya CpMp gene, comprising an upstream primer with nucleotide sequences as shown in SEQ ID No. 3 and a downstream primer with SEQ ID No. 4.
[0013] The present invention also provides a recombinant expression vector, comprising the initial expression vector pENTR and the aforementioned papaya CpMp gene.
[0014] The present invention also provides the application of the recombinant expression vector in regulating the length of the inflorescence stalk of papaya plants.
[0015] The beneficial effects of this invention compared to the prior art are as follows:
[0016] This invention discovered the male-specific gene CpMp in papaya and, through gene overexpression technology, overexpressed the CpMp gene in female plants, confirming that the CpMp gene plays a role in regulating inflorescence peduncle length. A long inflorescence peduncle provides a reproductive advantage for male plants in natural selection, while for economically valuable female plants and hermaphroditic plants, a long inflorescence peduncle increases the space for young fruit development and the number of flowers and fruits. Therefore, the overexpressed transgenic female plants obtained in this invention have significant theoretical research significance and practical value. Furthermore, this invention utilizes the CpSVP gene in Y and Y plants... h Chromosomal differences, specifically, the Y chromosome of the CpMp gene. h recessive allele cpmp h The corresponding sex is hermaphroditic, and the promoter of this allele has a 4691bp transposon insertion. In contrast, the Y dominant allele of the CpMp gene, CpMp, corresponds to male, and the promoter of this gene does not have a transposon insertion. Using this as a molecular marker to distinguish between male and hermaphroditic plants, this difference can be applied to the early sex verification work of papaya. Attached Figure Description
[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0018] Figure 1 Phenotypic representations of Chinese white papaya plants and transgenic papaya: a) Chinese white female papaya (ZB XX), b) transgenic female plant overexpressing 35S::CpMp / ZBXX, c) comparison of the inflorescence peduncle of Chinese white female papaya and the transgenic inflorescence peduncle.
[0019] Figure 2 For CpMp and cpmp h Diagram of the sub-region transposon insertion mode;
[0020] Figure 3 Primers for gender verification in cpmp h A schematic diagram showing the location of the 6000bp promoter + 2000bp gene sequence;
[0021] Figure 4 For using TE-1-Y h -Specific-F / R primers were used to verify the amplification results of the sex of papaya plants. Among them, the plants that amplified the band were hermaphroditic plants, lanes 1-9 were DNA samples of papaya plants of different sexes, and the controls were DNA samples of male and hermaphroditic plants.
[0022] Figure 5 To verify the amplified structure of papaya plant sex using TE-2-Y-specific-F / R primers, the plants that amplified the bands were male plants, lanes 1-9 were DNA samples from papaya plants of different sexes, and the controls were DNA samples from male and hermaphroditic plants.
[0023] Figure 6 pENTR vector spectrum;
[0024] Figure 7 The pGWB505 vector spectrum. Detailed Implementation
[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0026] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0027] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0028] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0029] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0030] This invention provides a papaya CpMp gene, the nucleotide sequence of which is shown in SEQ ID No. 1.
[0031] In this invention, the CDS nucleotide sequence of the papaya CpMp gene is: (SEQ ID No. 1).
[0032] The present invention also provides a CpMp protein encoded by the papaya CpMp gene, the amino acid sequence of which is shown in SEQ ID No. 2.
[0033] In this invention, the amino acid sequence of the CpMp protein is: MFQSRLIFNNFLLLLLFEIYRYIYTYTQTTKGKRRREERMAREKIQIKKIDNTSARQVTFSKRRRGLFKKAEELSVLCDADVALIVFSSTGKLFEYSSSSMKEILERHMLHEKNLEKLEQPSLELKLVENGDRSRLCNEIAQRSHHLKQMRGEELQGLSIEQLQQLEKFLEVGLRRVIERKGQNIINEISDLQRKGIQLMEENEKLRQQLLQISNKGKQGGAESENVASEEGQSSESVTNLCNSNGPPHDYESSDTSLKLGLPYSG (SEQ ID No. 2).
[0034] This invention also provides the application of the aforementioned papaya CpMp gene or the aforementioned CpMp protein in regulating the length of the inflorescence stalk of the plant.
[0035] This invention also provides the application of the aforementioned papaya CpMp gene or the aforementioned CpMp protein in identifying the sex of papaya.
[0036] In this invention, the papaya is either hermaphroditic or male; the cpmp of the hermaphroditic papaya... h The promoter sequence of the gene is shown in SEQ ID No. 5.
[0037]
[0038]
[0039]
[0040]
[0041] The nucleotide sequence of the bolded underlined portion is cpmp. h The nucleotide sequence of the 4691 bp transposon on the gene promoter; the hermaphroditic papaya cpmp h The gene promoter contains a transposon insertion, and the transposon is preceded and followed by a CTCAG recognition sequence;
[0042]
[0043] This invention also provides the application of overexpression of the aforementioned papaya CpMp gene in the cultivation of white female papaya with long inflorescence stalks.
[0044] The present invention also provides a primer pair for amplifying the papaya CpMp gene, comprising an upstream primer with nucleotide sequences as shown in SEQ ID No. 3 and a downstream primer with SEQ ID No. 4.
[0045] In this invention, the nucleotide sequence of the upstream primer is CACCATGTTTCAGTCCAGACTTATTTTTAATAAC (SEQ ID No. 3), and the nucleotide sequence of the downstream primer is AGCCGGAATAGGGTAACCCA (SEQ ID No. 4).
[0046] The present invention also provides a recombinant expression vector, comprising the initial expression vector pENTR and the aforementioned papaya CpMp gene.
[0047] The present invention also provides the application of the recombinant expression vector in regulating the length of the inflorescence stalk of papaya plants.
[0048] Example 1: Construction of Recombinant Expression Vector
[0049] The experimental materials were Zhongbai (ZB), a dioecious variety of papaya with female flowers, and Zhonghuang (ZH), a dioecious variety with male flowers.
[0050] Using the upstream primer (as shown in SEQ ID No. 3) and the downstream primer (as shown in SEQ ID No. 4) as the PCR amplification primer set, and using cDNA from the leaves of *Papaya spp.* as a template, PCR amplification was performed to obtain the target fragment, which was ligated into the pENTR initial expression vector, transformed into competent *E. coli* cells, and 500 ml of LB liquid medium (the antibiotics and LB medium used in this invention were purchased from Coolaber) were added. The cells were cultured at 37°C with shaking for 1 h, centrifuged to collect the cells, and spread on LB solid medium containing 50 μg / ml kanamycin to screen for positive clones.
[0051] Positive clones were selected and cultured in test tubes containing kanamycin-containing LB liquid medium with shaking for 4 hours. A portion of the bacterial culture was then sent to Qingke Sequencing Company for plasmid extraction and sequencing verification. The nucleotide sequence of CpMp is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2. The recombinant expression vector was verified as obtained.
[0052] Example 2 Transformation of recombinant bacteria
[0053] The recombinant expression vector verified in Example 1 was subjected to an LR reaction (Gateway cloning) with the overexpression vector PGWB505. The reaction product was transformed into Escherichia coli DH5α (Video), and then cultured in LB liquid medium with shaking for 1 h. The cells were collected by centrifugation and spread on LB solid medium containing 50 μg / ml spectinomycin to screen for positive clones.
[0054] After positive clones were verified to be correct by PCR and sequencing, plasmids were extracted and transformed into Agrobacterium GV3101 competent cells (Weidi). Positive clones were then screened on LB solid medium plates containing spectinomycin and rifampin.
[0055] Select Agrobacterium colonies that have been verified by PCR, and add them to test tubes containing 10 ml of LB liquid medium containing spectinomycin and rifampin. Incubate at 28°C in the dark until the bacterial culture reaches OD. 600 When the value reaches 1.0, recombinant bacteria are obtained. Agrobacterium-mediated bacterial culture is mixed with sterile glycerol containing 1 / 3 volume and stored at -80°C for use in papaya callus transformation.
[0056] Example 3 Construction of papaya transformant
[0057] Papaya ZB seeds were sterilized and embryo-exposed, then placed on callus induction medium for induction. Once embryogenic callus developed, it was used for infection and transformation. 2 mL of Agrobacterium-mediated transformation of the target vector was transferred to 100 mL of resistant LB medium (Coolaber purchased) and cultured for 20 h. OD was then calculated. 600When the pH value approaches 1.0, transfer 40 ml of bacterial suspension to a 50 ml test tube, centrifuge at 5000 rpm for 4 min, remove the supernatant in a clean bench, and add 40 ml of 1 / 2 MS liquid medium to suspend the collected bacterial cells. Add approximately 10 ml of embryogenic callus to the above suspension, shake vigorously for 5 min, and then let stand vertically for 10 min until the callus settles at the bottom of the tube. Remove the supernatant, absorb excess water from the infected callus with sterile test paper, and co-culture on subculture medium for 5 h. After a brief co-culture of the callus with Agrobacterium, immediately transfer it to antibiotic-resistant medium containing 300 mg / L cefluprenam to inhibit Agrobacterium. Change the antibiotic-resistant medium once a day for the first 4 days, and change the medium every 2 days for the 5th and 6th times. After culturing on an antibacterial medium for 8 days, the callus tissue was transferred to a resistance medium containing 50 mg / L hygromycin and 200 mg / L timentin to screen for positive embryogenic callus. After 2 weeks of culture at 28°C under light, single yellow-green positive somatic embryos were selected and transferred to MS solid medium for continued light culture. The single embryogenic callus continuously multiplied into new cotyledon-type somatic embryos. After 2 weeks, 5 seedlings with developed green leaves were selected and transferred to new MS culture flasks for further culture for one month to obtain healthy seedlings. After removing the medium, the seedlings were planted in moist peat moss containing nutrient solution and rooting solution, and covered with a plastic lid to maintain humidity. After 3 weeks of culture at 28°C under 16 hours of light and 8 hours of darkness, the lid was removed, and robust transgenic plants were obtained.
[0058] Example 4: Molecular verification of transgenic plants
[0059] DNA was extracted from the transgenic seedlings obtained through tissue culture screening for identification. A small piece of fresh papaya leaf (about the size of a fingernail) was placed in a 2.0 ml centrifuge tube, a 5 mm steel ball was added, and the tube was clearly labeled. The tube was then flash-frozen in liquid nitrogen and homogenized at 20 rpm for 1 min. 700 μL of CTAB extraction buffer was added to each tube, vortexed, and heated at 65°C for 1 h. An equal volume of chloroform was added, and the tube was centrifuged at 13000 rpm for 10 min. 450 μL of the supernatant was transferred to a new 1 ml centrifuge tube, and an equal volume of pre-chilled isopropanol was added. The tube was inverted several times until the solution was clear, and the solution was precipitated at -20°C for 60 min. The tube was centrifuged at 13000 rpm for 10 min, the supernatant was discarded, and the tube was washed twice with 70% ethanol. The tube was then centrifuged at 13000 rpm for 5 min, the supernatant was discarded, and the tube was centrifuged empty for 2 min. Excess liquid, excluding the precipitate, was removed. Open the lid, place it in a 65℃ oven and dry for 5 minutes to allow the alcohol to evaporate completely. Add 50 μL ddH2O to each precipitate tube and store at -20℃ for later use.
[0060] The DNA to be verified was amplified using primer pairs SEQ ID No. 3 and SEQ ID No. 4. The PCR products were sent to Qingke Sequencing Company for sequencing. The correctly identified transgenic plants were planted in the ground to observe the phenotype.
[0061] The results showed that the sex of the transgenic female plants overexpressing CpMP remained unchanged, still exhibiting female characteristics. However, compared to the short inflorescence stalk trait of normal CpMP female plants, the transgenic female plants showed an inflorescence stalk elongation phenotype, proving that the CpMP gene plays a role in regulating inflorescence stalk length.
[0062] Example 5: Sex determination of papaya
[0063] 5.1Y h cpmp on chromosome h A 4691bp transposon insertion occurred in the gene promoter as shown in SEQ ID NO.3, while no transposon insertion occurred in CpMp on the Y chromosome as shown in SEQ ID NO.4.
[0064] 5.2 Based on the differences of CpMp on sex chromosomes, two pairs of primers were designed for sex verification of papaya plants. Primer TE-1-Y was designed at the transposon site. h -specific-F: CGAGAGCAAGTGGCACGCAAGG (SEQ ID No. 7), TE-1-Y designed on the CpMp gene. h -specific-R: GTCACCTGTCTCGCCGACGTG (SEQ ID No.8), TE-1-Y h The TE-2-Y-specific-F / R primer pair can amplify a 690bp sequence in hermaphroditic plants, but cannot amplify it in male plants without transposons. Since the transposon is too long to be amplified by PCR, primers were designed around 500bp before and after the transposon based on this characteristic: TE-2-Y-specific-F: GATGATTAAATCAATTATTAGTCGCT (SEQ ID No. 9), TE-2-Y-specific-R: AATAGAGCAACATCGGCATCG (SEQ ID No. 10). The TE-2-Y-specific-F / R primer pair can amplify a 1085bp band in male plants without transposons, but cannot amplify it in hermaphroditic plants with transposon insertion.
[0065] Leaves from nine plants at the base were selected for sex verification. DNA was extracted using the CTAB method, following the same procedure as above. TE-1-Y h -specific-F / R amplification results are as follows Figure 4As shown, samples 4 / 6 / 7 / 8 / 9 amplified bands, indicating hermaphroditic plants; TE-2-Y-specific-F / R amplification results are as follows. Figure 5 As shown in Table 5, sample 5 amplified a band, indicating a male plant; samples 1, 2, and 3 did not amplify bands, therefore they were female plants. The PCR system is shown in Table 5.
[0066] Table 5 PCR reaction system
[0067] Components volume 2×RapidlyMasterMix 10μL Primer-F / R 0.5μL <![CDATA[ddH2O]]> 8μL DNA 1μL
[0068] The PCR amplification program was as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, 34 cycles, followed by 72℃ extension for 5 min after each cycle.
[0069] As can be seen from the above embodiments, the present invention provides the papaya CpMp gene, protein, primer pair, recombinant expression vector and application. The papaya CpMp gene has the function of regulating the length of the inflorescence stalk and can also be used to identify the sex of papaya.
[0070] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A papaya CpMp gene, characterized in that, The nucleotide sequence of the papaya CpMp gene is shown in SEQ ID No.
1.
2. A CpMp protein encoded by the papaya CpMp gene according to claim 1, characterized in that, The amino acid sequence of the CpMp protein is shown in SEQ ID No.
2.
3. The application of the papaya CpMp gene of claim 1 or the CpMp protein of claim 2 in regulating the length of the inflorescence stalk of the plant.
4. The application of the papaya CpMp gene of claim 1 or the CpMp protein of claim 2 in identifying the sex of papaya.
5. The application of overexpression of the papaya CpMp gene as described in claim 1 in the cultivation of white female papaya with long inflorescence stalks.
6. A primer pair for amplifying the papaya CpMp gene as described in claim 1, characterized in that, This includes an upstream primer with a nucleotide sequence as shown in SEQ ID No. 3 and a downstream primer as shown in SEQ ID No.
4.
7. A recombinant expression vector, characterized in that, It includes the initial expression vector pENTR and the papaya CpMp gene as described in claim 1.
8. The application of the recombinant expression vector according to claim 7 in regulating the length of the inflorescence stalk of papaya plants.