Small heat shock protein gene RcHsp20-5 of Chinese rose and application of small heat shock protein gene RcHsp20-5 in regulation and control of number of floral organs

By cloning the rose RcHsp20-5 gene and constructing a recombinant expression vector to transform Arabidopsis thaliana, the number of floral organs was regulated, revealing the potential role of heat shock proteins in floral diversity.

CN120944914APending Publication Date: 2025-11-14NORTHEAST FORESTRY UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511445896.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-11
Publication Date
2025-11-14

AI Technical Summary

Technical Problem

Current research on the molecular mechanisms of rose flower shape lacks a deep understanding of the regulation of floral organ numbers by heat shock proteins, and there is insufficient research on gene regulation that affects flower shape diversity.

Method used

The RcHsp20-5 gene of rose was cloned, a recombinant expression vector was constructed and transformed into the model plant Arabidopsis thaliana. Transgenic plants with high expression were obtained through stable genetic transformation, and the changes in the number of floral organs were observed.

Benefits of technology

The discovery of an increase or decrease in the number of petals and a change or decrease in the number of stamens in Arabidopsis thaliana demonstrates that the RcHsp20-5 gene has the function of regulating the number of floral organs and may affect the number of floral organs in roses.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120944914A_ABST
    Figure CN120944914A_ABST
Patent Text Reader

Abstract

The invention discloses a Chinese rose small heat shock protein family gene RcHsp20-5 and application thereof in regulation and control of the number of floral organs, and belongs to the field of plant genetic engineering breeding. The RcHsp20-5 gene is separated and cloned from a Chinese rose variety YuLinglong on the basis of a plant gene cloning technology, the nucleotide sequence of the RcHsp20-5 gene is as shown in SEQ ID NO.1, and the coded amino acid sequence is as shown in SEQ ID NO.2. The expression protein of the RcHsp20-5 gene belongs to a CI subfamily. An overexpression vector is constructed, the gene is introduced into arabidopsis thaliana by using a floral immersion method, a high-expression transgenic plant is obtained, and a result shows that the RcHsp20-5 can influence petal symmetry and the number of floral organs of the transgenic arabidopsis thaliana. The Chinese rose RcHsp20-5 provided by the invention may be a potential gene influencing the number of Chinese rose organs, and provides a reference for researching the molecular regulation mechanism of the diversity of ornamental plant flower types.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the application of the rose RcHsp20-5 gene in regulating the number of floral organs. Background Technology

[0002] The rose (Rosa chinensis) is a perennial evergreen or deciduous shrub belonging to the genus Rosa in the family Rosaceae. Flower shape is an important ornamental trait in ornamental plants. Therefore, flower shape diversity is an important goal in rose breeding. The core of flower shape development lies in the regulation of the number and morphology of floral organs. Currently, research on the molecular mechanisms of rose flower shape mainly focuses on genes in the ABCDE model of flower development, while research on the molecular mechanisms by which heat shock proteins regulate the number of floral organs is rarely reported. Therefore, this study provides a rose RcHsp20-5 gene that influences the number of floral organs, providing theoretical guidance and gene reserves for future exploration of the role of heat shock proteins in molecular breeding experiments related to flower shape, with the aim of multivariate analysis of the molecular mechanisms of flower shape diversity.

[0003] The heat shock protein Hsp20, with a molecular weight between 15 and 42 kDa, is also known as a small heat shock protein. As an important molecular chaperone, Hsp20 is ubiquitous in all organisms. Hsp20 plays a crucial role in plant growth and development, as well as in responses to various environmental stresses, including high temperatures. Currently, research on Hsp20 mainly focuses on its responses to biotic and abiotic stresses; its role in regulating the number of floral organs has not been thoroughly investigated. Summary of the Invention

[0004] The purpose of this invention is to provide a method for cloning the RcHsp20-5 gene, vector construction, and its application in regulating the number of floral organs.

[0005] One objective of this invention is to provide an RcHsp20-5 gene and the protein it encodes. The ORF region of this gene is 465 bp and encodes 154 amino acids.

[0006] The second objective of this invention is to provide the expression protein of the RcHsp20-5 gene, which belongs to the CⅠ subfamily.

[0007] The third objective of this invention is to obtain Arabidopsis thaliana transformants containing the RcHsp20-5 gene.

[0008] The fourth objective of this invention is to provide the application of the above-mentioned RcHsp20-5 gene in regulating the number of floral organs.

[0009] The objective of this invention will be achieved through the following technical solutions:

[0010] The nucleotide sequence of the RcHsp20-5 gene described in this invention is shown in SEQ ID NO.1 of the sequence listing.

[0011] The amino acid sequence encoded by the RcHsp20-5 gene described in this invention is shown in SEQ ID NO.2.

[0012] The present invention relates to a recombinant expression vector or recombinant bacteria containing the RcHsp20-5 gene described above.

[0013] The overexpression vector used was pCAMBIA1300-GFP. The above gene sequence was inserted between the multiple cloning sites BamHⅠ and SalⅠ of the pCAMBIA1300-GFP vector to obtain the corresponding recombinant expression vector.

[0014] An overexpression vector for the RcHsp20-5 gene was constructed and transformed into the model plant Arabidopsis thaliana through stable genetic transformation. This vector was then applied to regulate the number of floral organs, and plants with altered petal and stamen numbers were screened.

[0015] The model plant is Arabidopsis thaliana.

[0016] This invention uses the flower-dip method to infect Arabidopsis thaliana and obtain transgenic plants.

[0017] This invention compares the number of floral organs in Arabidopsis thaliana transgenic with the RcHsp20-5 gene with that in wild-type Arabidopsis thaliana.

[0018] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0019] This invention, based on plant gene cloning technology, isolated and cloned the RcHsp20-5 gene from the rose variety 'Yu Linglong'. An overexpression vector was then constructed and transformed into the model plant Arabidopsis thaliana, resulting in highly expressed transgenic plants. After screening to the T3 generation, the number of different floral organs in Arabidopsis thaliana was observed using a stereomicroscope. The results showed that the number of petals and stamens changed in some flowers of plants transgenic with the RcHsp20-5 gene, exhibiting the following phenotypes: increased number of petals, unchanged or decreased number of stamens; and unchanged number of petals but decreased number of stamens. This indicates that the RcHsp20-5 gene has the function of regulating the number of floral organs and may be a potential gene affecting the number of floral organs in roses. Attached Figure Description

[0020] Figure 1 Phylogenetic evolutionary tree of the RcHsp20-5 gene-encoded protein provided by this invention and HSP20 family proteins of other species.

[0021] Figure 2This is an agarose gel electrophoresis image of the RcHsp20-5 gene clone; lane M is the DL 2000plus marker, and lanes 1 and 2 are the PCR results of the RcHsp20-5 gene clone.

[0022] Figure 3 This is a screening diagram of positive seedlings of transgenic Arabidopsis thaliana using soil culture.

[0023] Figure 4 This is an electrophoresis image of PCR identification of transgenic Arabidopsis thaliana, where M is the DL 2000plus marker, lane 1 is the empty vector control, and lanes 2-6 are 5 transgenic Arabidopsis thaliana lines.

[0024] Figure 5 This is a diagram showing the phenotypic changes of floral organs in wild-type and transgenic Arabidopsis thaliana with the RcHsp20-5 gene. EV represents the empty vector pCAMBIA1300-GFP, while OE1, OE2, and OE3 represent transgenes. Detailed Implementation

[0025] The present invention will be further described in the following detailed description. The provided embodiments are only for explaining the present invention and do not limit the rest of the content disclosed herein in any way. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods. Unless otherwise specified, the materials, reagents, etc. used in the following embodiments are commercially available.

[0026] Example 1: Cloning of the Rose RcHsp20-5 Gene

[0027] Total RNA was extracted from the rose variety 'Yu Linglong' using the FastPure Universal Plant Total RNA Isolation Kit (Vazyme, Nanjing, China). The extracted total RNA was used as a template and reverse transcribed into cDNA using the HiScript III 1stStrand cDNA Synthesis Kit (+gDNA wiper) (Vazyme, Nanjing, China).

[0028] RcHsp20-5 gene cloning-specific primers were designed using Primer 5. Using the cDNA obtained above diluted 10-fold as a template, the ORF region of the RcHsp20-5 gene was amplified according to the following reaction. The specific primer sequences are as follows:

[0029] RcHsp20-5-F1:5'-ATTGTCGCTTATCCCAAATTTCCG-3'

[0030] RcHsp20-5-R1:5'-TTACGCAGAAATTTCAATGGCTTTG-3'

[0031] The target gene fragment was cloned by PCR using the following 50 μL reaction system:

[0032] 1 μL template cDNA, 5 μL dNTP (2 mM), 5 μL 10×PCR Buffer for KOD, 3 μL MgCl2 (25 mM), 2 μL each of forward and reverse primers, 1 μL KOD-Plus-Neo (1 U / μl) and 31 μL ddH2O.

[0033] The sample loading was performed on ice. After loading, the mixture was thoroughly mixed and centrifuged at 2500 rpm. The sample was then placed in a PCR instrument for amplification according to the following procedure:

[0034] 95 ℃ for 5 min; 95 ℃ for 30 s, 56 ℃ for 45 s, 72 ℃ for 90 s, repeat 35 times; 72 ℃ for 10 min.

[0035] The amplification product was obtained by PCR reaction. Figure 1 The bands were detected by 1% agarose gel electrophoresis (140 V, 12 min) and observed in a gel imaging system.

[0036] Place the gel block after gel running under a UV transilluminator, cut out a band of the desired gene sequence length, and use the gel extraction kit (OMEGA) to recover and purify the target band according to the instructions.

[0037] 4 μL of the gel-recovered product was ligated into 1 μL of the TA / Blunt-Zero Cloning Kit (Vazyme, Nanjing, China) vector for 5 min. The reaction solution was gently aspirated and shaken a few times before being used in a PCR instrument with temperature control at 37 ℃ for 5 min.

[0038] The above ligation product was transformed into E. coli DH5α competent cells (Shanghai Weidi). The specific operation steps are as follows:

[0039] Melt E. coli DH5α competent cells in an ice bath (conversion efficiency is highest when they are in an ice-water mixture).

[0040] After the competent cells thaw, add 5 μL of the ligation product to 50 μL of competent cells, gently stir the centrifuge tube to mix, and incubate on ice for 25 min.

[0041] Heat shock in a 42 ℃ water bath for 45 s, then immediately place in an ice bath for 2 min;

[0042] Add 700 μL of LB liquid medium preheated to 37 ℃, place in a shaking incubator, and culture Escherichia coli at 37 ℃ and 200 rpm for 1-1.5 h.

[0043] Centrifuge the bacterial culture at 5000 rpm for 1 min, discard the supernatant, retain about 100 μL of concentrated bacterial culture, spread it on LB agar containing 100 mg / L Amp, and incubate upside down at 37 ℃ for 12-14 h (upside down).

[0044] After the bacteria have grown on the culture medium, select 10-20 positive clones from the LB solid plate and place them in centrifuge tubes containing 30 μL LLB liquid medium. Incubate at 37 ℃ and 200 rpm for 1 h with shaking. Then, using the cultured bacterial solution as a template and the universal primers M13F and M13R that are compatible with the vector as detection primers, prepare the PCR reaction solution according to the following reaction system to verify the size of the inserted target gene.

[0045] 10 μL reaction system: including 1 μL bacterial template, 3 μL ddH2O, 0.5 μL each of forward and reverse M13 primers, and 5 μL LEs-Taq Master Mix.

[0046] The PCR reaction conditions were: 95 ℃ for 10 min; 94 ℃ for 30 s, 56 ℃ for 45 s, 72 ℃ for 90 s, for 30 cycles; 72 ℃ for 10 min.

[0047] After PCR, the bacterial culture was detected by 1% agarose gel electrophoresis. The bacterial culture with the same length as the target band was retained. 200-500 μL of the bacterial culture was sent to a biotechnology company for sequencing. After obtaining the sequencing results, the sequencing results were compared with the original sequence using DNAMAN software. 300 µL of the remaining bacterial culture with the correct sequence was mixed with an equal volume of 60% glycerol and stored at -80 ℃ for later use. At the same time, about 200 µL of the bacterial culture was added to 10 ml of liquid LB medium and shaken overnight to increase the number of E. coli per unit volume. Then, the plasmid was extracted using a plasmid extraction kit for later use.

[0048] For specific procedures of plasmid extraction, please refer to the instruction manual of the plasmid extraction kit (TIANGEN, China).

[0049] Example 2: Construction of a plant overexpression vector for the rose RcHsp20-5 gene

[0050] Using homologous recombination, the ORF region of the rose RcHsp20-5 gene (with the stop codon removed) was constructed between the BamHI and SalI restriction sites of the plant expression vector GV1300, resulting in the recombinant plant expression vector GV1300-RcHsp20-5-GFP. Vector construction was performed using the ClonExpress II One Step Cloning Kit (Novozymes, China) according to the manufacturer's instructions. The specific primers for the homologous arm sequences (underlined parts indicate BamHI and SalI restriction sites) are as follows:

[0051] RcHsp20-5-BamH Ⅰ-F:5'-ttgatacatatgcccgtcgacATGTCGCTTATCCCAAATTTCC-3'

[0052] RcHsp20-5-Sal Ⅰ-R:5'-gcccttgctcaccatggatccCGCAGAAATTTCAATGGCTTTG-3'

[0053] The recombinant vector was transduced into E. coli and sequenced. After Kana screening in plate samples, the results were verified by PCR. Figure 2 The primers were universal primers for the vector. The bacterial culture with the correct band was sent to the biotechnology company for sequencing, and the sequencing results were consistent with the target sequence.

[0054] Implementation Plan 3: Genetic transformation of the rose RcHsp20-5 gene into Arabidopsis thaliana

[0055] The recombinant plasmid GV1300-RcHsp20-5-GFP was transformed into Agrobacterium tumefaciens GV3101 competent cells using the freeze-transformation method, following the instructions in the manufacturer's manual.

[0056] Agrobacterium-mediated transformation of Arabidopsis thaliana with the recombinant plasmid GV1300-RcHsp20-5-GFP plant overexpression vector was performed using the flower-dip method. The specific method is as follows:

[0057] Arabidopsis thaliana sowing: In a clean bench, wild-type Arabidopsis thaliana seeds were disinfected with 75% alcohol for 2 min, repeated once, then rinsed with sterile water by shaking 3-5 times, followed by soaking in 0.8% sodium hypochlorite solution for 10 min, and then rinsed with sterile water by shaking 3-5 times to remove bacterial cells. The disinfected seeds were then sown on 1 / 2 MS solid medium and vernalized at 4 ℃ for 3 days. After that, they were placed in a tissue culture room for 7-10 days. When the Arabidopsis thaliana had 4 cotyledons, it was removed from the medium and transplanted into soil. After the first bolting of the Arabidopsis thaliana, the main inflorescence was cut off to induce more secondary inflorescences to bolt, thereby obtaining more inflorescences and increasing infection efficiency. The cultivation substrate is a mixture of peat moss, vermiculite, and perlite in a ratio of 5:3:2, and is sterilized at high temperature. The cultivation room conditions are: temperature 20-22 ℃, 16 h light / 8 h darkness, light intensity of 10000 lux, and relative humidity of 70%.

[0058] Preparation of infection solution: Agrobacterium with recombinant plasmid was added to 50 mL of liquid YEP containing 50 mg / L Kana and 30 mg / L Rif, and cultured at 28 °C with shaking at 200 rpm until OD. 600 When the OD value reaches 0.8-1.0, centrifuge to collect the bacterial cells, resuspend the bacterial cells in the suspension, adjust to OD=0.8-1.0, and let stand in the dark for 1 h to obtain the final infection solution;

[0059] Remove the pods from flowering Arabidopsis thaliana plants and immerse the inflorescences in the infection solution for 2 minutes. After infection, place the Arabidopsis plants in the dark for 24 hours, then incubate them in a normal incubator. Repeat the infection once a week later. Once the Arabidopsis seeds are mature, collect them and dry them in a 37 ℃ oven.

[0060] Implementation Plan 4: Screening and Identification of Transgenic Arabidopsis thaliana Positive Seedlings

[0061] After vernalization, T0 generation seeds were evenly scattered on the soil surface, kept moist, and then covered with a transparent plastic film. Once the seeds germinated, the film was removed. One week after germination, 300 mg / L hygromycin was sprayed every other day for preliminary screening of positive Arabidopsis seedlings. When Arabidopsis bolted, 0.1 g of leaves were collected, and DNA was extracted using the CTAB method. PCR was performed using the specific primers designed in section 3.2.3 with the extracted Arabidopsis leaf DNA as a template to identify transgenic Arabidopsis lines. The target band was detected by agarose gel electrophoresis. The PCR amplification products containing the target gene were sequenced. If the sequence was correct, the identified positive seedlings were designated as T1 generation transgenic Arabidopsis lines. Seeds from the transgenic seedlings were collected and cultured until the T3 generation for subsequent phenotypic observation and expression analysis.

[0062] Example 5: Observation of flower organ phenotypes of T3 generation transgenic Arabidopsis thaliana

[0063] To investigate the effect of the rose RcHsp20-5 gene on Arabidopsis flower development, changes in the number of flower organs were observed in transgenic Arabidopsis. It was found that compared to wild-type Arabidopsis, some flower petal symmetry changed, and the flower organs exhibited the following phenotypes: increased number of petals, unchanged or decreased number of stamens; unchanged number of petals, decreased number of stamens (…). Figure 5 ).

[0064] SEQ ID NO.1

[0065] >RcHsp20-5

[0066] ATGTCGCTTATCCCAAATTTCCGACGAAACAGTGTCTTCGACCTCGATCTCTGGGACCCATTCAGGGATTTCCAATTCCCTTCTTCATCTCTCTCCACATTCCCTGAATTTCCTGGCGAGAATTCGGCTTTCATCAACACCCGGATCGACTGGAAGGAGACCCCAGAAGCCCATGTGTTCAAGGCCGACCTTCCGGGGCTGAAGAAAGAAGAGGTCAAGGTTGAGATTGAAG ATGACAGGGTGCTGCAGATCAGCGGAGAGGAAGATAGAGAAGGAGGACAAGAACGACAAGTGGCACCGGGTCGAGAGAAGCAGCGGCAAGTTCTCCAGGAGGTTCAGGCTTCCTGAGAATGCGAAGGTTGATGAGGTTAAGGCTGCTATGGAGAACGGGGTTTCTCCGTGTGACTGTTCCGAAGGCAGAGGTGAAGAGGCCTGATGTCAAAGCCATTGAAATTTCTGCGTAA

[0067] SEQ ID NO.2

[0068] MSLIPNFRRNSVFDLDLWDPFRDFQFPSSSLSTFPEFPGENSAFINTRIDWKETPEAHVFKADLPGLKKEEVKVEIEDDRVLQISGERKIEKEDKNDKWHRVERSSGKFSRRFRLPENAKVDEVKAAMENGVLRVTVPKAEVKRPDVKAIEISA*.

Claims

1. A gene RcHsp20-5 that regulates the number of flower organs in roses, characterized in that, The nucleotide sequence of the RcHsp20-5 gene is shown in SEQ ID NO.1 in the list.

2. The gene RcHsp20-5 for regulating the number of rose flower organs as described in claim 1, characterized in that, The ORF region of this gene is 465 bp.

3. The expression protein of the gene RcHsp20-5 that regulates the number of rose flower organs as described in claim 1, the amino acid sequence of which is shown in SEQ ID NO.2 in the list.

4. A recombinant cloning vector, a recombinant plant expression vector, and a recombinant bioengineered bacterium containing the gene RcHsp20-5, which regulates the number of rose flower organs as described in claim 1.

5. The biomaterial related to the gene RcHsp20-5 that regulates the number of rose flower organs according to claim 4, characterized in that: The cloning vector was a 5 min TA / Blunt-Zero Cloning Kit (Vazyme, Nanjing, China) vector.

6. The biomaterial related to the gene RcHsp20-5, which regulates the number of rose flower organs, according to claim 4, is characterized in that: The plant expression vector is GV1300.

7. The biomaterial related to the gene RcHsp20-5 that regulates the number of rose flower organs according to claim 4, characterized in that: The bioengineered bacteria is Agrobacterium tumefaciens GV3101.

8. The application of the gene according to claim 1 in regulating the number of floral organs, characterized in that: The recipient plant is Arabidopsis thaliana.

9. The application according to claim 8, characterized in that, An overexpression vector for the gene RcHsp20-5, which regulates the number of flower organs in roses, was constructed and transformed into recipient plants through stable genetic transformation to obtain transgenic plants. These transgenic plants were then applied to regulate the number of flower organs in plants, providing theoretical guidance and gene reserves for future molecular breeding experiments on flower shapes, with the aim of cultivating plants with richer flower shapes and higher ornamental value.