Method for improving abiotic stress resistance of rice and rice
Modifying the upstream open reading frame of the rice GGP gene using CRISPR/Cas9 technology improves the translation efficiency of the rice GGP gene, solves the problem of insufficient resistance to abiotic stress in rice, and achieves significant increases in salt stress tolerance and vitamin C content.
Patent Information
- Application Number
- CN202511094852.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-06
- Publication Date
- 2025-11-14
AI Technical Summary
In the existing technology, the methods for improving the resistance of rice to abiotic stress are not yet effective for monocotyledonous plants such as rice, corn and wheat. The feedback regulation mode of vitamin C synthesis has not been reported, which affects their stress tolerance.
By modifying the upstream open reading frame sequence of the rice GGP gene using CRISPR/Cas9 technology, single-target and four-target editing vectors were constructed and genetically transformed to improve the translation efficiency of the rice GGP gene, thereby increasing vitamin C synthesis.
It significantly improved rice's tolerance to salt stress, enhanced vitamin C synthesis, improved osmotic regulation and the balance of reactive oxygen species in cells, and increased resistance to abiotic stresses.
Smart Images

Figure CN120944939A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioengineering technology, specifically relating to a method for improving the resistance of rice to abiotic stresses and rice. Background Technology
[0002] Vitamin C (Vc), also known as ascorbic acid (ASA), is a water-soluble vitamin. Under normal physiological conditions, it is mainly stored in chloroplasts as reduced ascorbic acid and plays an antioxidant role in plants. Vitamin C is a cofactor of enzymes, participating in cell division and growth. Furthermore, it is an important antioxidant for enhancing plant stress resistance. Therefore, increasing the endogenous vitamin C content in plants is a reliable way to improve the resistance of rice to abiotic stresses.
[0003] Plants produce large amounts of toxic substances when exposed to abiotic stresses, such as singlet oxygen (O2) and superoxide (O3). 2- Substances such as hydrogen peroxide (H2O2) and hydroxyl radicals (·OH) readily cause oxidative damage to DNA, proteins, and lipids, thereby impairing cellular function. The antioxidant mechanism maintaining the dynamic balance of reactive oxygen species (ROS) in plants consists of enzymatic and non-enzymatic components, which can alleviate the excessive production of ROS and oxidative stress responses, preventing cell damage. Vitamin C provides electrons to a wide range of enzymatic and non-enzymatic reactions, playing a crucial role in antioxidant defense. For example, in the ascorbic acid-glutathione cycle, reduced ascorbic acid reacts with H2O2 under the action of ascorbic acid peroxidase, producing monodehydroascorbic acid (MDHA). This MDHA can then be reduced back to AsA under the action of monodehydroascorbic acid reductase (MDHAR), not only scavenging the toxicity of H2O2 but also participating in the regulation of AsA levels along with other AsA synthetic pathways. In addition, vitamin C can also act directly as a ROS scavenger, neutralizing free radicals by providing electrons, thereby effectively removing toxic free radicals and other reactive oxygen species generated during cell metabolism and enhancing resistance to abiotic stresses.
[0004] Ascorbic acid can participate in the scavenging of reactive oxygen species (ROS) in plants through exogenous application or by increasing endogenous levels, thereby enhancing the plant's ability to cope with various abiotic stresses. Therefore, increasing the vitamin C content of plants can improve their drought resistance. For example, overexpression of two members of the GME gene family significantly increased the accumulation of ascorbic acid in tomatoes, resulting in stronger stress tolerance under methyl viologen, cold, drought, and salt stress. The combined application of ascorbic acid and the endophytic nitrogen-fixing bacterium Avi2 can improve the photosynthetic efficiency and antioxidant capacity of rice under drought stress, promoting its growth. Ali et al. expressed kiwifruit AcGGP in the widely planted indica rice variety IR64, which not only increased ascorbic acid levels and improved multi-stress tolerance but also did not affect its agronomic characteristics. Conversely, inhibiting the expression of OsVTC1-3 led to the rapid production of more O3 by the roots of rice plants under salt stress. 2- The accumulation of large amounts of H2O2 significantly impaired rice's tolerance to salt stress. Adding exogenous vitamin C restored the plant's salt tolerance, indicating that endogenous vitamin C is an important substance for rice's response to abiotic stress. Therefore, increasing the vitamin C content of plants not only enhances their ability to resist drought stress, but also ensures that fruits rich in vitamin C better meet human health needs.
[0005] Plant vitamin C synthesis involves multiple reactions and is a complex physiological process influenced by various factors. Numerous studies have been conducted on the regulation of plant vitamin C synthesis, including the regulation of key gene expression, transcription factor regulation, upstream open reading frame (ORF) regulation, and light regulation. Gene expression is regulated by multiple factors, with mRNA translation regulation being a crucial step, particularly translation initiation. As the core of translation regulation, it directly limits the rate of protein synthesis. Eukaryotic mRNA consists of a 5' untranslated region (5'UTR), an open reading frame (ORF) encoding the protein, and a 3' untranslated region (3'UTR). The upstream open reading frames (uORFs) are located in the 5'UTR and often inhibit the translation initiation of the downstream major ORF (pORF) by isolating or competing with ribosomes. Laiing et al. discovered this regulatory pattern in vitamin C synthesis in Arabidopsis thaliana. At high vitamin C concentrations, the expression of the key vitamin C synthesis gene GGP uORF inhibited GGP translation, while at low concentrations, GGP could be translated normally. This indicates that Arabidopsis thaliana regulates GGP gene translation through feedback regulation, thereby controlling vitamin C content. Utilizing this mechanism, Zhang et al. edited the uORF of the gene encoding the key enzyme LsGGP2 in lettuce vitamin C biosynthesis, increasing vitamin C content by 50% and enhancing oxidative stress tolerance. Deslous et al. used CRISPR technology to mutate the uORF of the GGP gene in tomato, producing the uORF-GGP1 mutant rich in ascorbic acid. Li et al. targeted and induced mutagenesis of the uORF of the SlGGP2 gene in tomato using CRISPR / Cas9, disrupting its function and increasing the ascorbic acid concentration on the leaf surface by approximately 1.4 times. However, whether this feedback regulation pattern exists in vitamin C synthesis in monocotyledonous plants such as rice, corn, and wheat has not yet been reported. Summary of the Invention
[0006] The purpose of this invention is to provide a method for improving the resistance of rice to abiotic stresses. This method involves mutating the GGPuORF of rice using CRISPR / Cas9 technology to create rice varieties that show significant improvements in resistance to abiotic stresses such as salt and alkali.
[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0008] A method to improve the resistance of rice to abiotic stresses by modifying the upstream open reading frame sequence SEQ ID NO.1 of the GGP gene in rice to make rice tolerant to salt stress.
[0009] Furthermore, specific targeted editing sites SEQ ID NO.3-SEQ ID NO.7 are selected upstream, downstream, or within SEQ ID NO.1 for modification.
[0010] Furthermore, the modifications include the addition and / or deletion of bases.
[0011] Furthermore, the modification steps are as follows: constructing single-target editing vectors and four-target editing vectors using the CRISPR / Cas9 multi-gene editing vector method, and then genetically transforming the single-target editing vectors and four-target editing vectors to obtain T0 generation rice plants.
[0012] Furthermore, the single-target editing vector is obtained by mutation of a specific target editing site with sequence SEQ ID NO.3, and the four-target editing vector is obtained by mutation of specific target editing sites with sequences SEQ ID NO.4-SEQ ID NO.7.
[0013] Furthermore, the single-target editing vector and the four-target editing vector were respectively transferred into host cells to construct engineered bacteria, and the engineered bacteria were transformed into recipients. After genetic transformation, the T0 generation rice plants were obtained.
[0014] Furthermore, the host cell is Agrobacterium.
[0015] A type of rice was prepared using the method described above for improving the resistance of rice to abiotic stresses.
[0016] The beneficial effects of this invention are:
[0017] This invention identifies conserved open reading frames upstream of the key gene GGP for L-galactose synthesis in rice, which affect its translation efficiency, and determines its function using a dual-luciferase reporter vector. By knocking out GGPuORF in rice using CRISPR / Cas9 technology, a rice variety exhibiting significantly enhanced resistance to abiotic stresses such as salt and alkali was created. This invention not only elucidates the function of GGPuORF but also provides a new gene resource for creating abiotic stress-resistant germplasm resources using GGPuORF allelic variations. Mutations in rice GGPuORF enhance the translation efficiency of the GGP gene, increase ascorbic acid synthesis in rice, and improve tolerance to salt stress by improving osmotic regulation and the balance of reactive oxygen species in cells. Attached Figure Description
[0018] Figure 1 The diagram illustrates the effect of artificially prepared GGPuORF allele variants on downstream primary open reading frame translation. A is a schematic diagram of a dual-luciferase reporter vector, B is a schematic diagram of the preparation of uORF allele variants, and C is a diagram showing the effect of uORF allele variants on pORF in a dual-luciferase reporter system.
[0019] Figure 2The GGP uORF diagram was designed using the CRISPR / Cas9 method. A is the GGP uORFs and CRISPR / Cas9 target diagram, B is a schematic diagram of a single-target editing vector, C is a schematic diagram of a four-target editing vector, D is a diagram of the mutation frequency induced by CRISPR / Cas9 in T0 generation rice plants, and E is a Sanger sequencing peak diagram of homozygous single-plant target sites of GGP uORF editing in T1 generation rice plants.
[0020] Figure 3 The diagram shows the effects of seven AL1-AL7 mutation types on vitamin C content and downstream primary open reading frame translation in rice. A shows the effects of the seven AL1-AL7 mutation types on vitamin C content in rice, B shows the effects of the seven AL1-AL7 mutation types on GGP gene expression level in rice, C shows a schematic diagram of the seven AL1-AL7 mutation types, and D shows the LUC / REN ratio of the seven AL1-AL7 mutation types.
[0021] Figure 4 The effects of seven mutation types of AL1-AL7 on rice are shown in Figure A, where salt tolerance of different mutation types of AL1-AL7 was identified by hydroponics; Figure B shows the ROS content of the seven mutation types of AL1-AL7 identified by DAB under salt stress; and Figures C and J show the ASA, Pro, H2O2, MDA, APX, POD, CAT, and SOD content of the seven mutation types of AL1-AL7 under salt stress. Detailed Implementation
[0022] The present invention will be further described below with reference to the embodiments and accompanying drawings.
[0023] Example 1
[0024] I. Identification and Analysis of GGPuORF in Rice
[0025] Using tblastn and the amino acid sequence encoded by the Arabidopsis GGP uORF, a BLAST search was performed on the rice genome. A rice GGP uORF gene with a similar conserved sequence to the Arabidopsis GGP uORF was identified. The same method was used to obtain GGPuORF sequences from other monocots and dicots. MEGA 7.0 was used to perform sequence alignment and evolutionary analysis on the obtained GGPuORF sequences. While there is significant evolutionary divergence between monocots and dicots, they may share a common origin, as both share the noncanonical codon (ACG) start codon. Amino acid sequence alignment analysis showed sequence conservation of GGPuORF across species, implying potential functional conservation.
[0026] Artificial mutations were performed on the GGPuORF gene in rice, and the 5' UTR sequences of the wild-type (WT) and different mutants were ligated into the dual-luciferase vector pGreenII0800. The results showed that the LUC (firefly luciferase) / REN (renaeus luciferase) fluorescence ratio in the protoplasts of the uorf1 and uorf2 mutants was significantly higher than that of the wild-type, indicating that the mutation of GGPuORF can significantly improve the translation efficiency of downstream pORFs. This means that artificially mutating the uORF of GGP, a key gene in the L-galactose pathway of vitamin C in rice, can improve the vitamin C content of rice. The uorf1 and uorf2 mutants are shown below. Figure 1 As shown in B.
[0027] II. Rice GGPuORF Editing and Mutation Analysis of Edited Strains
[0028] SEQ ID NO.1 (GGPuORF):
[0029] ACGGCTAGCGTTGAAGCGTCGGGCGCGGCCACGCAGCTGCGCCGCCCACGCCCAGTGGGGGAGCCATCGCTTCTCCGGCGACGGCGTCCAGCCCAGCCCCGCACGGCGGCCGCGGGGCGCTTCCCTCGGCCGGCGGCAGCCCCTCTGACCTCCTCTTCCTCGCCGGCGGCGGTCGCCTCTGA
[0030] SEQ ID NO.2 (>GGP 5'UTR):
[0031] CTCGCCTACCACCACCACCACCGTCGCCGCCGCCGCCGACTGAGAAGAGGAAGAGGAAGAGGGGAGATTCCGCCGCCGACGAGAGGTGGGGGGGAGTGGGTTGTGATCGTGAGGAGGGCTCTCATCCCTAGACGGGCGAGTTGAAAGGCGGCAAAGACGGCTAGCGTTGAAGCGGTCGGGCGCGGCCACGCAGCTGCGCCGCCCACGCCCAGTGGGGGAGCCATCGCTTCTCCGGCGACGGCGTCCAGCCCAGCCCCGCACGGCGGCCGCGGGGCGCTTCCCTCGGCCGGCGGCAGCCCCTCTGACCTCCTCTTCCTCGCCGGCGGCGGTCGCCTCTGAGACCGCTCGCCCCCCCCATCCACCTTCTCTAACATCCAATCAACAAAAATCTTTCGCTGACCTGACCCTGACCCCGAGAGAGAGGAAGGAATTGAGATTTAATC
[0032] Based on the sequence SEQ ID NO.1 of rice GGPuORF, five specific target editing sites were selected: Vc9, VcT1, VcT2, VcT3, and VcT4. The nucleotide sequences of these five specific target editing sites are shown in Table 1. Using CRISPR / Cas9 multi-gene editing technology, allelic mutations were performed on the five specific target editing sites to prepare an S9 single-target editing vector containing Vc9 and an S15 quadruple-target editing vector containing VcT1, VcT2, VcT3, and VcT4. The constructed S9 single-target and S15 quadruple-target editing vectors were transformed into Agrobacterium tumefaciens EHA105, using Hongdao 59 as the transformation recipient for genetic transformation. The transformed and regenerated edited plants were planted at the transgenic experimental base of the College of Life Sciences, Henan Normal University, and the GGPuORF editing status of the obtained regenerated seedlings was identified. The results showed that there were 39 positive T0 generation plants of S9, of which 29 were edited, with an editing rate of approximately 74.36%; there were 11 edited T0 generation plants of S15, with an editing rate of approximately 100%. Among the 11 edited seedlings of S15, the mutation frequency at the specific targeted editing site VcT1 was the highest (100%), the mutation frequency at the specific targeted editing site VcT2 was 36.36%, the mutation frequency at the specific targeted editing site VcT3 was the lowest (18.18%), and the mutation frequency at the specific targeted editing site VcT4 was 72.73%. Among these, there were 5 homozygous mutations (45.45%), including 2 mutation types; and 6 biallelic mutations (54.55%), including 3 types. The uORF of the S9 edited seedlings mainly consisted of single-base mutations, while the uORF of the S15 edited seedlings showed greater variation. There were a total of 7 mutation types, with S9 exhibiting three mutation types: AL1-AL3. The AL1-AL3 mutation types are as follows... Figure 2 As shown in E and 3C, S15 has four mutation types, namely AL4-AL7, and the mutation types of AL4-AL7 are shown in 2E and 3C.
[0033] Table 15 Nucleotide Sequences of Specific Target Editing Sites
[0034] sequence Specific targeting editing sites (nucleotide sequence) 5′-3′ SEQ ID NO.3 Vc9 GCTGCGCCGCCCACGCCCAGTGG SEQ ID NO.4 VcT1 ACGGCTAGCGTTGAAGCGGTCGG SEQ ID NO.5 VcT2 CGCGGGGCGCTTCCCTCGGCCGG SEQ ID NO.6 VcT3 TCTGACCTCCTCTTCCTCGCCGG SEQ ID NO.7 VcT4 TGGATGTTAGAGAAGGTGGATGG
[0035] Experimental Example 1
[0036] mRNA was extracted from leaves of Hongdao 59 and AL1-AL7 using the Trizol method. cDNA was synthesized using reverse transcriptase and random primers, with the mRNA serving as a template. Hieff... The Universal Blue qPCR SYBR Green Master Mix kit (Yisheng Biotechnology Co., Ltd., HB220119) was used to detect GGP gene expression levels by qRT-PCR. Each sample underwent three technical and three biological replicates. Results are as follows: Figure 3 As shown in B, from Figure 3 As can be seen from B, the GGP gene expression level is the highest in AL4.
[0037] Experimental Example 2
[0038] Identification of reducing ascorbic acid (PRO) content in rice leaves: Germinated seeds were sown in soil and cultured until they reached the three-leaf stage. The soil was then irrigated with a 100 mM NaCl solution for three weeks. Samples were then collected and various physiological indicators were measured. The samples were homogenized in an aqueous sulfosalicylic acid solution, centrifuged to obtain the supernatant, and then mixed with an acidic ninhydrin solution to form a red product with characteristic absorption at 520 nm. PRO content was determined based on a standard curve of pure proline at a known concentration. H2O2 content was determined based on the formation of a complex between H2O2 and titanium sulfate. The samples were homogenized in acetone and centrifuged to obtain the supernatant. Titanium sulfate was added to form a yellow titanium peroxide complex with characteristic absorption at 415 nm. MDA content was determined based on the reactivity of thiobarbituric acid (TBA). The samples were homogenized in trichloroacetic acid and centrifuged to obtain the supernatant. TBA was added to form a brownish-red trimethyldione with a maximum absorption wavelength of 532 nm. Finally, the MDA content was calculated using the absorbance differences between 532 nm, 450 nm, and 600 nm, and the results are as follows: Figure 3 As shown. From Figure 3 It can be seen that the vitamin C content in rice plants of the seven mutant types from AL1 to AL7 is significantly higher than that in wild-type rice plants, with the AL4 mutant type having the highest vitamin C content.
[0039] from Figure 4 It can be seen that under salt stress, the contents of ASA and proline in rice plants with the seven mutant types of AL1-AL7 increased significantly, and the activities of peroxidase (POD), ascorbate peroxidase (APX), catalase (CAT), and superoxide dismutase (SOD) also increased significantly, while the contents of H2O2 and malondialdehyde (MDA) decreased significantly. The mutation of GGP uORF enhanced the translation efficiency of the GGP gene and increased the synthesis of ascorbate in rice plants, enabling rice plants to tolerate salt stress through osmotic pressure regulation and the balance of reactive oxygen species in cells.
Claims
1. A method for improving the resistance of rice to abiotic stresses, characterized in that, Rice was made tolerant to salt stress by modifying the upstream open reading frame sequence SEQ ID NO.1 of the GGP gene.
2. The method for improving the resistance of rice to abiotic stresses according to claim 1, characterized in that, Specific targeted editing sites SEQ ID NO.3-SEQ ID NO.7 are selected upstream, downstream, or within SEQ ID NO.1 for modification.
3. The method for improving the resistance of rice to abiotic stresses according to claim 1 or 2, characterized in that, The modifications include the addition and / or deletion of bases.
4. The method for improving the resistance of rice to abiotic stresses according to claim 1, characterized in that, The modification steps are as follows: constructing single-target editing vectors and four-target editing vectors using the CRISPR / Cas9 multi-gene editing vector method, and then genetically transforming the single-target editing vectors and four-target editing vectors to obtain T0 generation rice plants.
5. The method for improving the resistance of rice to abiotic stresses according to claim 4, characterized in that, The single-target editing vector is obtained by mutation of a specific target editing site with sequence SEQ ID NO.3, and the four-target editing vector is obtained by mutation of specific target editing sites with sequences SEQ ID NO.4-SEQ ID NO.
7.
6. The method for improving the resistance of rice to abiotic stresses according to claim 4, characterized in that, The single-target editing vector and the four-target editing vector were respectively transferred into host cells to construct engineered bacteria. The engineered bacteria were then transformed into recipients, and the T0 generation rice plants were obtained after genetic transformation.
7. The method for improving the resistance of rice to abiotic stresses according to claim 6, characterized in that, The host cell is Agrobacterium.
8. A type of rice, characterized in that, It was prepared using the method for improving the resistance of rice to abiotic stresses as described in claim 1.