Application of OsDjA5 protein or coding gene thereof in regulating and controlling resistance of plants to southern rice black-streaked dwarf virus
By reducing the expression level of the rice OsDjA5 gene and editing rice genes using the CRISPR/Cas9 system, resistance to Southern Rice Black-Streaked Dwarf Virus (SRBSDV) was enhanced. This solved the problem of insufficient disease resistance gene discovery in existing technologies, achieved effective control of SRBSDV, and improved the disease resistance and yield of rice.
Patent Information
- Application Number
- CN202511167822.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-20
- Publication Date
- 2025-11-14
AI Technical Summary
Existing technologies have yielded very little information on the resistance genes of Southern Rice Black-Streaked Dwarf Virus (SRBSDV), which seriously threatens rice production, resulting in significant yield losses. Furthermore, the virus inhibits plant growth after infection, making effective control difficult.
By reducing the expression level of the OsDjA5 gene in rice and creating genetic mutants using the CRISPR/Cas9 system to weaken the function of the OsDjA5 protein, the resistance of rice to SRBSDV can be enhanced. This includes gene editing using CRISPR/Cas9 vectors to reduce the expression of the OsDjA5 gene.
It significantly improved rice resistance to SRBSDV, reduced virus expression and morbidity, alleviated disease symptoms, and improved rice health and yield.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and more specifically, to the application of the OsDjA5 protein or its encoding gene in regulating plant resistance to Southern Rice Black-Streaked Dwarf Virus. Background Technology
[0002] Rice cultivation faces a diverse range of viral threats, encompassing pathogens such as RDV (rice dwarf virus), RSV (rice stripe virus), RBSDV (rice black-streaked dwarf virus), SRBSDV (southern rice black-streaked dwarf virus), RGSV (rice straw-like dwarf virus), RGDV (rice tumor dwarf virus), RRSV (rice serrated leaf dwarf virus), and RSMV (rice stripe mosaic virus). The distribution of these viral diseases exhibits regional differences; for example, southern rice-growing areas are heavily affected by dwarf virus, while northern areas generally face the challenge of rice stripe virus. The transmission chain of rice viral diseases mainly relies on insect vectors such as leafhoppers and planthoppers, which are frequently active in the field, acting as bridges for virus transmission from one rice plant to another, promoting rapid disease spread. Given that viral diseases tend to systemically infect rice plants, once infected, they have a profound impact on plant growth and development, significantly reducing rice yield and quality, posing a significant agricultural challenge.
[0003] SRBSDV is a viral disease that poses a serious threat to rice production, belonging to the genus Fijivirus in the family Reoviridae. This virus is widespread and has become one of the major diseases in southern rice-growing areas. SRBSDV virus particles exhibit a typical spherical structure, with a diameter ranging from approximately 75 to 80 nanometers. Its unique double-layered capsid surface is evenly distributed with 12 columnar protrusions, encapsulating a complex genome containing 10 double-stranded RNA strands. The virus has a wide host range, covering various gramineous crops such as rice, corn, and wheat, as well as weeds, but rice is its primary target. Since SRBSDV was officially recognized as a new species in 2008, domestic and international research efforts have intensified, gradually elucidating its pathogenic characteristics, transmission routes, and pathogenic mechanisms. The main vector of SRBSDV is the migratory pest—the white-backed planthopper (SRBSDV). Sogatella furciferaThese insects acquire the SRBSDV virus by feeding on the phloem sap of rice plants carrying the virus, and carry it for life, becoming key vectors for virus spread. After an incubation period within the planthopper, the virus is injected into healthy rice plants through its saliva, thus spreading the virus. Furthermore, the migratory habits of the white-backed planthopper and meteorological conditions such as descending air currents and rainfall all promote the widespread spread of the virus. SRBSDV causes significant damage to rice, manifesting as significantly stunted growth, abnormally dark green leaves, abnormally increased tillering, and poor root development. Rice infected during the seedling stage to the early tillering stage suffers severe growth inhibition, with plant height often less than half that of healthy plants, and fails to head, directly leading to crop failure. Even if infected during the late tillering to booting stage, the rice may still manage to head, but the grain filling rate is low, producing mostly empty grains, resulting in yield losses of 30% to 50%, and in severe cases, still facing the risk of total crop failure. After invading rice, SRBSDV primarily locates in the phloem, inducing abnormal cell proliferation and forming tumor-like structures, providing a favorable environment for viral replication and spread. Simultaneously, the virus interferes with the normal physiological functions of rice sieve tube cells, disrupting their metabolic processes, ultimately leading to inhibited rice growth and a sharp reduction in yield. Therefore, strengthening the monitoring, control, and scientific research of SRBSDV is of great significance for ensuring the safety of rice production. However, currently, very little information has been found about antiviral genes targeting SRBSDV.
[0004] Molecular chaperone proteins are a class of proteins that play important roles in cells. They are primarily responsible for assisting in the correct folding, assembly, and transport of proteins, making them a crucial research subject in protein chemistry and molecular biology. Through their unique functions, molecular chaperone proteins ensure the correct conformation and stability of proteins within cells, which is essential for maintaining normal cellular physiological functions. Molecular chaperone proteins play a vital role in plant virus infection. They not only participate in normal protein metabolism processes within plant cells but also directly or indirectly affect viral replication, assembly, and infection efficiency. Some molecular chaperone proteins can interact with virus-encoded proteins, thereby influencing the viral replication process. For example, the chaperone protein Hsp70 (Heat Shock Protein 70) is significantly upregulated during plant virus infection and may interact with the viral replication complex, promoting viral replication. Studies have shown that rice small heat shock protein (sHSP) OsHSP20 not only protects cells under high temperature and salt stress but also interacts with the RNA-dependent RNA polymerase (RdRP) of rice stripe virus (RSV). This suggests that OsHSP20 may participate in RSV replication and infection through its molecular chaperone activity. Furthermore, overexpression of OsHSP20 significantly enhanced the tolerance of E. coli and yeast cells to high temperature and salt stress, further confirming its important role in protein protection and stability.
[0005] First discovered in *Escherichia coli*, DnaJ proteins are heat shock proteins with a molecular weight of approximately 41 kDa. As one of the most diverse members of the molecular chaperone family, these proteins play crucial roles in maintaining proper protein folding, regulating various physiological processes, and participating in plant growth, development, and responses to environmental stress. Currently, scientists have conducted in-depth research on DnaJ family proteins in various organisms, including humans, fruit flies, mushrooms, tomatoes, and *Arabidopsis thaliana*. The most prominent feature of this family is the presence of a highly conserved amino acid sequence, the "J domain." This unique structure allows it to synergize with the HSP70 heat shock protein, assisting protein folding by enhancing ATPase activity while preventing the aggregation of misfolded proteins. Furthermore, these proteins participate in important cellular activities such as regulating the assembly of protein oligomers. Notably, these proteins not only affect viral protein maturation but also the viral life cycle and coordinate the relationship between host proteins and the virus. For example, the J domain protein (JDP), as a partner of HSP70, enhances viral RNA replication together with HSP70 and participates in the loading and unassembly of viral capsid proteins. Infection with different plant RNA viruses induces the expression of a heat shock protein chaperone (CPIP) from the DnaJ family. For example, PVA infection can induce the expression of tobacco CPIP, and the interaction between PVA CPIP and tobacco CPIP promotes viral replication and movement. Furthermore, HSP70 and its co-chaperone protein CPIP are essential for the replication and translation of potato virus Y.
[0006] The rice genome contains a large number of proteins with a J domain. These proteins range in amino acid length from 112 (12 kD) to 1,507 (164 kD). Unlike other heat shock protein gene families, J proteins exhibit significant molecular weight variation. Currently, 104 potential J proteins have been identified, including 12 type A, 9 type B, and 83 type C. OsDjA5 belongs to the type A family, and studies have shown that OsDjA4 and OsDjA5 can successfully compensate for the defective phenotype of the yeast Ydj1 protein mutation, demonstrating that it is a functional J domain protein. However, its impact on SRBSDV has not been reported. Summary of the Invention
[0007] One of the objectives of this invention is to provide a novel method for regulating plant resistance to Southern Rice Black-Streaked Dwarf Virus and to develop... OsDjA5 New functions of genes.
[0008] This invention has found that OsDjA5In response to infection by Southern rice black-streaked dwarf virus (SRBSDV, Zhou Guohui et al., "A new species of Southern rice black-streaked dwarf virus in the genus Fijivirus of the family Reoviridae: Southern rice black-streaked dwarf virus", Science Bulletin 53.20(2008):9), it was suggested that it might play a role in regulating the virus-rice interaction. Therefore, its genetic mutant was created using CRISPR / Cas9 and inoculated with SRBSDV. Ultimately, it was found that it participates in regulating the interaction between SRBSDV and rice. OsDjA5 After the gene expression level is reduced, the resistance of rice to Southern Rice Black-Streaked Dwarf Virus is enhanced, which is manifested by the reduction of SRBSDV expression level, the decrease in incidence rate and the milder symptoms after SRBSDV infection.
[0009] Furthermore, this invention provides the application of the OsDjA5 protein or its encoding gene, or biological materials containing its encoding gene, in regulating plant resistance to Southern Rice Black-Streaked Dwarf Virus, in breeding transgenic plants with strong resistance to Southern Rice Black-Streaked Dwarf Virus, in improving germplasm resources of plants resistant to Southern Rice Black-Streaked Dwarf Virus, or in improving the health status of plants infected with Southern Rice Black-Streaked Dwarf Virus.
[0010] The method of regulating plant resistance to Southern Rice Black-Streaked Dwarf Virus in this invention is as follows: by reducing OsDjA5 The expression level of genes is used to improve the plant's resistance to Southern Rice Black-Streaked Dwarf Virus.
[0011] The method for breeding transgenic plants with strong resistance to Southern Rice Black-Streaked Dwarf Virus of this invention includes: detecting in plants... OsDjA5 Gene expression levels, selection OsDjA5 Plants with low gene expression levels were selected as breeding results.
[0012] The method for improving plant germplasm resources resistant to Southern Rice Black-Streaked Dwarf Virus of the present invention includes: reducing the concentration of the virus in plants... OsDjA5 The expression level of genes can be used to improve germplasm resources.
[0013] Specifically, the concentration of certain substances in plants can be reduced through methods such as genetic modification, hybridization, backcrossing, and self-pollination. OsDjA5 Gene expression levels.
[0014] The method of the present invention for improving the health of plants infected with Southern Rice Black-Streaked Dwarf Virus includes: reducing the concentration of the virus in the plant. OsDjA5 This increases the expression level of genes, thereby improving the health of plants infected with Southern Rice Black-Streaked Dwarf Virus.
[0015] In the application of the present invention, the amino acid sequence of the OsDjA5 protein is as shown in SEQ ID NO.2; or, as shown in the amino acid sequence having 95% or more, preferably 98% or more, more preferably 99% or more identity with the amino acid sequence shown in SEQ ID NO.2 and capable of encoding a protein having the same function.
[0016] A sequence with 95% or more, preferably 98% or more, more preferably 99% or more identity with the amino acid sequence shown in SEQ ID NO.2 can be obtained by substitution, deletion or insertion of one or more nucleotides.
[0017] In the application of the present invention, the nucleotide sequence encoding the OsDjA5 protein is as shown in SEQ ID NO.1 or as shown in a sequence that is completely complementary to the nucleotide sequence shown in SEQ ID NO.1.
[0018] In the application of this invention, the biological material is an expression cassette, a vector, or a host cell.
[0019] In the application of this invention, the plant is a monocotyledonous plant or a dicotyledonous plant, preferably a grass, more preferably rice, corn, or wheat, and even more preferably rice.
[0020] This invention also provides a method for altering plant resistance to Southern Rice Black-Streaked Dwarf Virus, which involves regulating... OsDjA5 Gene expression levels can be used to alter plant resistance to Southern Rice Black-Streaked Dwarf Virus.
[0021] In the method of this invention, when it is necessary to improve the plant's resistance to Southern Rice Black-Streaked Dwarf Virus, knockout or silencing is performed. OsDjA5 Gene.
[0022] Specifically, a vector (such as a CRISPR / Cas9 vector) used to knock out the gene encoding the OsDjA5 protein can be transferred into the target plant to obtain a transgenic plant with the gene encoding the OsDjA5 protein knocked out.
[0023] Gene editing techniques such as RNA interference (RNAi) and genome replacement can also be used to knock out or silence genes. OsDjA5 Gene.
[0024] As a specific implementation method, the recombinant gene editing vector can be transferred into plant cells using any of the following methods: direct DNA transformation, microinjection, gene gun, electrocoagulation, and Agrobacterium-mediated transformation, and transgenic plants can be obtained by inducing callus.
[0025] The beneficial effects of this invention are at least as follows: This invention discovered that OsDjA5The study reveals a new function of the gene and provides a novel method to enhance plant resistance to Southern Rice Black-Streaked Dwarf Virus, offering new insights for creating new disease-resistant plant varieties. Attached Figure Description
[0026] Figure 1 For the transfer OsDjA5 Identification of CRISPR / Cas9 rice.
[0027] Figure 2 For the transfer OsDjA5 Results of qRT-PCR detection of relevant genes in CRISPR / Cas9 rice and wild-type rice (Zhonghua 11) after SRBSDV infection.
[0028] Figure 3 This image shows the symptoms of different rice strains infected with SRBSDV. The scale bar in the image is 15 cm. Detailed Implementation
[0029] The preferred embodiments of the present invention will now be described in detail with reference to specific examples. It should be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and essence.
[0030] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available or prepared according to conventional methods in the art.
[0031] Example 1 OsDjA5 The acquisition of CRISPR / Cas9 rice I. Construction of the Expression Carrier 1) Based on the PAM site with the terminal sequence NGG, according to the website http: / / skl.scau.edu.cn / home / , two specific target sequences targeting the N-terminus of the OsDjA5 coding region were selected as follows: AAGAAGAGCGACAACACGCG (SEQ ID No. 3); CATCAAGAACCACCCCGACA (SEQ ID No. 4). 2) Design primers based on the DNA sequence of the target site and add BsaI restriction sites to both ends of the primers. The primer sequence is UF:CTCCGTTTTACCTGTGGAATCG (SEQ ID No. 5). OsDjA5-gRT1: 5'-CGCGTGTTGTCGCTCTTCTTgttttagagctagaaat-3' (SEQ ID No. 6); OsDjA5-U3T1:AAGAAGAGCGACAACACGCGTgccacggatcatctgc (SEQ ID No. 7); OsDjA5-gRT2: CATCAAGAACCACCCCGACAgttttagagctagaaat (SEQ ID No. 8); OsDjA5-U6aT2: TGTCGGGGTGGTTCTTGATGCggcagccaagccagca (SEQ ID No. 9); gRNA-R: CGGAGGAAAATTCCATCCAC (SEQ ID No. 10); B1': TTCAGAggtctcTctcgCACTGGAATCGGCAGCAAAGG (SEQ ID No. 11); B2: AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC (SEQ ID No. 12); 3) Using the intermediate vector (the backbone vector pYLsgRNA-OsU3 / OsU6a containing the U3 and U6a promoter sequences, see Ma et al., 2013, A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. MolecularPlant. 2015) as a template, three rounds of PCR amplification were performed using five primer pairs: UF / OsDjA5-U3T1, UF / OsDjA5-U6aT2, OsDjA5-gRT1 / gRNA-R, OsDjA5-gRT2 / gRNA-R, and B1' / B2, respectively, to obtain an expression cassette with adapters (containing two sgRNAs that specifically target the OsDjA5 exon; these sgRNAs can guide Cas9 to cleave the target gene OsDjA5, thereby causing mutations in the gene and resulting in loss of function). 4) After amplification, the final product is gel-cleaved, purified, and recovered, and then added to the final vector pYLCRISPR / Cas9. ubi-H (generated using an optimized Cas9 gene, see Ma et al., 2013, A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and DicotPlants. Molecular Plant. 2015) along with restriction endonucleases and T4 ligases, were used for simultaneous digestion and ligation according to a specific system; 5) Transform Escherichia coli strain DH5α, spread on kanamycin-resistant medium to obtain transformants, extract plasmids from transformants and send them for sequencing, positive transformants are the final recombinant vector, named pYLCRISPR / Cas9-DjA5:sgRNA.
[0032] II. Transfer OsDjA5 The acquisition of CRISPR / Cas9 rice 1) Induction and culture of callus tissue Zhonghua 11 rice (hereinafter also known as wild-type rice) seeds were dehulled, soaked in 70% ethanol for 10 min, and then soaked in 0.1% mercuric chloride for 30 min for surface sterilization. The seeds were then rinsed with plenty of sterile water to remove the solution from the seed surface, and the moisture was absorbed with sterile filter paper. The seeds were placed on mature embryo callus induction medium plates, the edges of the plates were sealed with Parafilm, and cultured in a 26°C incubator in the dark. After approximately 15 days, the callus tissue was carefully removed and transferred to mature embryo subculture medium, and cultured under the same conditions. Subculture was performed every two weeks. For transformation, pale yellow granular callus tissue that had been subcultured for about 5 days was selected.
[0033] 2) Culture of Agrobacterium pYLCRISPR / Cas9-DjA5:sgRNA was electroporated into Agrobacterium EHA105 to obtain recombinant bacteria EHA105 / pYLCRISPR / Cas9-DjA5:sgRNA.
[0034] EHA105 / pYLCRISPR / Cas9-DjA5:sgRNA was streaked onto LB agar plates containing antibiotics (50 mg / L Kanamycin, 50 mg / L Rifampicin) and incubated at 28°C for 2 days. Single colonies were picked and inoculated into liquid LB medium, and cultured at 28°C with shaking until the OD600 reached approximately 0.5. Acetyleugenol was added to a final concentration of 100 mM to obtain an Agrobacterium suspension for transforming rice callus.
[0035] 3) Co-culture of rice callus and Agrobacterium Subcultured callus tissue was placed in a sterile Erlenmeyer flask, and Agrobacterium suspension was poured in to submerge the callus tissue. The flask was incubated at room temperature for 20 minutes, gently agitating occasionally to ensure adequate contact between the callus tissue and the bacterial suspension. The callus tissue was then carefully removed using sterile forceps, placed on sterile filter paper to absorb excess bacterial suspension, and transferred to a co-culture medium plate lined with sterile filter paper. The plate was incubated in the dark at 28°C for 3 days to obtain co-cultured callus tissue.
[0036] 4) Screening and differentiation of resistant callus The co-cultured callus tissue was washed with an appropriate amount of sterile water to remove residual Agrobacterium on the surface. It was then placed on selection medium and cultured at 26°C in the dark for two weeks. After two weeks, it was transferred to a new selection medium for another two weeks of selection. Callus tissue in good condition after two rounds of selection was selected and transferred to differentiation medium plates. It was first cultured in the dark for 3 days, and then transferred to a light incubator (15 hr / day) for further light culture. Differentiated seedlings were visible after one month. When the differentiated seedlings grew to about 2 cm, they were transferred to rooting medium in Erlenmeyer flasks and cultured for about two weeks. Seedlings with good growth and well-developed root systems were selected, and the culture medium was washed off the roots with tap water before transplanting them into the soil. Seeds were harvested to obtain T1 generation pYLCRISPR / Cas9-DjA5:sgRNA transgenic rice seeds. These seeds were then sown to obtain T1 generation pYLCRISPR / Cas9-DjA5:sgRNA transgenic rice (transgenic rice). OsDjA5 CRISPR / Cas9 rice).
[0037] 5) Turn OsDjA5 Identification of CRISPR / Cas9 rice OsDjA5 Leaf powder from CRISPR / Cas9 transgenic rice lines was used to extract genomic DNA, following a specific method using a high-efficiency plant genomic DNA extraction kit (Tiangen Biotech Co., Ltd., catalog number: DP350). Subsequently, using 0.5 g of genomic DNA as a template, PCR was performed with primers DjA5-CF: 5'-ACAAACCGCTTCCAACCC-3' (SEQ ID No. 13) and DjA5-CR: 5'-CATTCCCGGAGCACACGC-3' (SEQ ID No. 14). The PCR products were directly sequenced, followed by sequence alignment. The results are shown below. Figure 1 As shown, DNA sequencing results comparison revealed two positive strains, named respectively. OsDjA5 KO#4 and OsDjA5 KO#17, among which, OsDjA5 KO#4 is in OsDjA5 An "A" was inserted between bases 128 and 129 in the coding region, causing premature termination of the OsDjA5 amino acid sequence; OsDjA5 An "A" is inserted between the 25th and 26th bases in the KO#17 coding region, and another "A" is inserted between the 128th and 129th bases, causing premature termination of the amino acid sequence.
[0038] Example 2 OsDjA5 Effects of CRISPR / Cas9 on SRBSDV Resistance in Rice 1) SRBSDV infection was identified by measuring the expression level of SRBSDV S8 (S8 encodes the virus's core capsid protein) using quantitative real-time PCR (qRT-PCR). White-backed planthoppers carrying SRBSDV (see Zhang et al., 2016. Suppression of jasmonic acid-mediated defense by viral-inducible microRNA319 facilitates virus infection in rice. Molecular Plant. 9:1302-1314) (the pathogen is Southern rice black-streaked dwarf virus, SRBSDV) were inoculated with the T1 generation transgenic plants obtained in Example 1. OsDjA5 CRISPR / Cas9 rice and wild-type rice Zhonghua 11 were inoculated with 30 plants of each type. The plants were cultured at 30 degrees Celsius during the day and 22 degrees Celsius at night, with a humidity of 60%. Each plant was inoculated with 3 white-backed planthoppers. After feeding on the plants for three days, the planthoppers were removed. The fed rice plants were then cultured in a sunny greenhouse (natural light and temperature. The experiment was repeated 3 times, and the average value was taken).
[0039] Four weeks after receiving the drug, T1 was extracted for transfusion. OsDjA5 CRISPR / Cas9 rice and wild-type rice (Zhonghua 11) leaf powder after infection were added to Trizol (Invitrogen) and RNA was extracted according to the instructions. Then, the genomic DNA in the RNA was digested using RQ1 DNase (Promega, catalog number: M610A) according to Table 1 below.
[0040] Table 1 Digestive System Then, 2 μg of digested RNA was used for reverse transcription qRT-PCR. For specific methods, please refer to invitrogen M-MLV Reverse Transcriptase (catalog number: 28025-021). OsEF1α(NCBI:XM_015774317.3) was used as an internal control, with primers EF1α-F: 5'-GCACGCTCTTCTTGCTTTCACTCT-3' (SEQ ID No. 15) and EF1α-R: 5'-AAAGGTCACCACCATACCAGGCTT-3' (SEQ ID No. 16). The expression level of S8 (NCBI:JQ692579.1) was detected using primers SRBSDV-S8-F: 5'-GAGCTTCAGTGAATTGGAAAC-3' (SEQ ID No. 17) and SRBSDV-S8-R: 5'-AGAGCCACACAATTATTTAAAATATGT-3' (SEQ ID No. 18). The results are as follows: Figure 2 As shown, it can be seen that OsDjA5 CRISPR / Cas9 ( OsDjA5 The accumulation of S8 in KO transgenic rice was lower than that in wild-type rice (asterisks in the figure indicate significant differences). Therefore, OsDjA5 CRISPR / Cas9 can improve rice's resistance to SRBSDV.
[0041] 2) Determining SRBSDV infection through phenotyping Four weeks after inoculation, 30 T1 transgenic strains were observed. OsDjA5 CRISPR / Cas9 ( OsDjA5 Symptoms of KO rice and 30 wild-type rice plants (plants infected with SRBSDV showed stunted growth, dark green leaves, curled leaf tips, white nodular protrusions on the stem (which later turned black), and poor heading and grain filling). The number of symptomatic plants was counted, and the incidence rate was calculated as (number of phenotypic plants / total number of plants) × 100%.
[0042] The statistical results are shown in Table 2 below.
[0043] Table 2. Statistical results of disease incidence in transgenic rice after SRBSDV infection. It can be seen that the transfer OsDjA5 CRISPR / Cas9 rice showed a relatively low incidence of disease. In addition, photographs were taken of susceptible rice strains from different lines; representative results are shown below. Figure 3 As shown, it is healthy wild-type rice, and wild-type rice and transformed rice 4 weeks after infection. OsDjA5 A diagram showing the symptoms of disease in CRISPR / Cas9 rice. It can be seen that... OsDjA5 CRISPR / Cas9 rice exhibits milder and more gradual disease symptoms, resulting in less stunting. OsDjA5 KO representative OsDjA5CRISPR / Cas9-based genetically modified rice. Compared to wild-type rice, OsDjA5 CRISPR / Cas9 genetically modified rice is more resistant to disease.
[0044] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.
Claims
1. Application of OsDjA5 protein or its encoding gene, or biological materials containing its encoding gene, in regulating plant resistance to Southern Rice Black-Streaked Dwarf Virus.
2. Application of OsDjA5 protein or its encoding gene, or biological materials containing its encoding gene, in the breeding of transgenic plants with strong resistance to Southern Rice Black-Streaked Dwarf Virus.
3. Application of OsDjA5 protein or its encoding gene, or biological materials containing its encoding gene, in the improvement of germplasm resources for plant resistance to Southern Rice Black-Streaked Dwarf Virus.
4. Application of OsDjA5 protein or its encoding gene, or biological materials containing its encoding gene, in improving the health status of plants infected with Southern Rice Black-Streaked Dwarf Virus.
5. The application according to any one of claims 1-4, characterized in that, The amino acid sequence of the OsDjA5 protein is shown in SEQ ID NO.
2.
6. The application according to any one of claims 1-4, characterized in that, The nucleotide sequence encoding the OsDjA5 protein is shown in SEQ ID NO.1 or is a sequence that is completely complementary to the nucleotide sequence shown in SEQ ID NO.
1.
7. The application according to any one of claims 1-4, characterized in that, The biomaterial is an expression cassette, vector, or host cell.
8. The application as described in any one of claims 1-4, characterized in that, The plant in question is rice.
9. A method for altering plant resistance to Southern Rice Black-Streaked Dwarf Virus, characterized in that, Through regulation OsDjA5 Gene expression levels can be used to alter plant resistance to Southern Rice Black-Streaked Dwarf Virus.
10. The method according to claim 9, characterized in that, When it is necessary to improve plant resistance to Southern Rice Black-Streaked Dwarf Virus, knockout or silencing is recommended. OsDjA5 Gene.
Citation Information
Cited By
Rice white-backed planthopper and southern rice black-streaked dwarf resistance genes bps and bpl and application thereof
CN122445715A