Application of PagUBC10a gene in regulation and control of growth and development of poplar
By overexpressing the PagUBC10a gene, the development of poplar wood and leaves was regulated, solving the problem of improving the growth and development traits of poplar in existing technologies, and realizing the targeted improvement of poplar wood quality and growth traits.
Patent Information
- Application Number
- CN202511493385.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-20
- Publication Date
- 2025-11-14
- Estimated Expiration
- 2045-10-20
AI Technical Summary
The lack of effective gene targets in existing technologies to precisely regulate the width of poplar wood, phloem fiber structure and leaf morphology limits the targeted improvement of growth and development traits in poplar molecular breeding.
By overexpressing the PagUBC10a gene, the development of poplar wood and leaves was regulated. The specific operation included cloning the PagUBC10a gene, ligating it into a vector, transforming it into Agrobacterium and infecting poplar leaves, and then inducing leaf differentiation culture.
It has achieved targeted improvement of poplar wood quality and growth traits, with clear targeting and operability, and precise control of xylem development and leaf development.
Smart Images

Figure CN120944960A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of agricultural bio-genetic engineering technology, specifically involving PagUBC10a Application of genes in regulating the growth and development of poplar trees. Background Technology
[0002] Timber, as an important renewable resource, plays an irreplaceable role in the maintenance of global ecosystems and socio-economic development. It is not only a core raw material for industries such as construction, furniture manufacturing, and papermaking, but also plays a crucial role in ecological functions such as carbon cycling and biodiversity conservation. There is an urgent need to cultivate fast-growing, high-quality plantations through molecular breeding techniques to improve timber yield and quality.
[0003] Lignification is a core process of secondary growth in woody plants, involving a series of complex biological events such as cambium cell division, xylem and phloem differentiation, and secondary cell wall deposition. Among these, secondary cell wall formation and lignification are key factors determining wood quality, precisely regulated by various transcription factors, enzymes, and post-translational modification mechanisms. Poplar, as a model organism for woody plants, is an ideal material for studying the molecular mechanisms of wood formation and for genetic improvement due to its small genome, short growth cycle, and high genetic transformation efficiency. Currently, research on the regulation of xylem and leaf development in poplar is limited. No effective targets have been found that can precisely regulate xylem width, phloem fiber structure, and leaf morphology through specific genes, restricting the targeted improvement of growth and developmental traits in poplar molecular breeding. Summary of the Invention
[0004] This invention aims to provide PagUBC10a The application of genes in regulating poplar growth and development provides a new option for regulating poplar growth and development, clarifying... PagUBC10a The gene can specifically regulate the development of poplar wood and leaves, providing a theoretical basis for the regulatory role in the growth and development of woody plants, and providing a potential target for molecular breeding improvement of poplar traits.
[0005] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows: PagUBC10a The application of genes in regulating the growth and development of poplar trees, the PagUBC10a The nucleotide sequence of the gene is shown in SEQ ID NO:1.
[0006] Preferred, through regulation PagUBC10a Gene expression levels regulate poplar wood development and / or leaf development.
[0007] Preferably, by overexpressing the PagUBC10a Genes cause the width of the stem xylem to decrease, the secondary walls of the phloem fibers to become thinner, and the cavities to expand, thus inhibiting the development of the poplar xylem.
[0008] Preferably, by overexpressing the PagUBC10a Genes reduce leaf area, exacerbate leaf wrinkling, and inhibit leaf development.
[0009] The present invention also provides a method for utilizing the above-mentioned PagUBC10a The method for genetically breeding transgenic poplar trees includes the following steps: S1, Cloned Poplar PagUBC10a Gene; S2, the above PagUBC10a Genes are linked to a vector to obtain an overexpression vector; S3. The overexpression vector obtained in S2 is transformed into Agrobacterium to obtain Agrobacterium bacterial suspension; the Agrobacterium bacterial suspension is then used to inoculate poplar leaves to obtain... PagUBC10a Gene overexpression in poplar leaves was used to induce leaf differentiation and obtain... PagUBC10a Poplar trees with overexpressed genes.
[0010] Preferably, the cloned poplar tree in S1 PagUBC10a The specific gene manipulation is as follows: Total RNA was extracted from poplar trees, reverse transcribed into cDNA, and used as a template to generate primers. PagUBC10a -F and PagUBC10a -R is used for PCR amplification to obtain... PagUBC10a Gene.
[0011] Preferably, the primer PagUBC10a The nucleotide sequence of -F is shown in SEQ ID NO.2, and the primer... PagUBC10a The nucleotide sequence of -R is shown in SEQ ID NO.3.
[0012] The present invention also provides an overexpression vector for regulating the growth and development of poplar trees, the overexpression vector comprising the method described in claim 1. PagUBC10a Gene.
[0013] The present invention also provides a strain for regulating the growth and development of poplar trees, the strain comprising the overexpression vector described above.
[0014] Compared with the prior art, the present invention has the following advantages and technical effects: 1. This invention provides PagUBC10a The application of genes in regulating the growth and development of poplar trees is clearly stated in this invention. PagUBC10a Genes can specifically regulate xylem development and leaf development, providing a theoretical basis for the regulatory role in the growth and development of woody plants, and providing potential targets for molecular breeding improvement of poplar traits.
[0015] 2. The PagUBC10aGene regulation has clear targeting and operability. By constructing overexpression vectors, its expression level can be precisely controlled to achieve targeted improvement of poplar wood quality and growth traits.
[0016] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description
[0017] Figure 1 for PagUBC10a Results of bioinformatics analysis of genes; Figure 2 for PagUBC10a Relative expression levels of 84K in different tissues of *Populus alba* var. *silver*; Figure 3 for PagUBC10a The results of in situ PCR analysis; Figure 4 for PagUBC10a Subcellular localization results, among which, Figure 4 In the figure, A represents the subcellular localization of different PagUBC10a-GFP fusion proteins, with a scale bar of 10 μm. Figure 4 In the figure, B represents PagUBC10a-GFP located in the endoplasmic reticulum, with a scale bar of 10 μm. Figure 5 for PagUBC10a Overexpression vector map and results of transgenic poplar lines, among which, Figure 5 In this context, A represents the T-DNA region of pK2GW7-eYGFP. Figure 5 In this context, B represents the Agrobacterium-mediated leaf disc genetic transformation process. Figure 5 In the figure, C represents the screening result of GFP fluorescent signal positive plants; Figure 6 for PagUBC10a The results of plant identification for overexpression included, Figure 6 In this context, A represents the DNA level detection result. Figure 6 B in the figure represents the RNA electrophoresis detection result; Figure 6 In this context, C represents the leaf tissue of the transgenic line. PagUBC10a Results of real-time quantitative PCR analysis of gene expression. Figure 6 In this context, D represents the stem segment tissue of the transgenic line. PagUBC10a Results of real-time quantitative PCR analysis of gene expression; Figure 7 for PagUBC10a The results of the phenotypic and growth index determination of OE transgenic plants and WT plants after two months of soil culture were analyzed. Figure 7 In the figure, A represents a morphological comparison between the transgenic and WT strains. Figure 7 B in the figure represents a comparison of stem segments from transgenic and WT lines; Figure 7C in the figure represents a comparison of leaf size between the transgenic and WT lines. Figure 7 D in the figure represents a comparison of the degree of leaf wrinkling between the transgenic and WT lines. Figure 7 In this context, E represents the diameter at breast height (DBH). Figure 7 In the figure, F represents the circumference of the third to ninth leaflets. Figure 7 In this context, G represents the area statistics of the third to ninth leaf spread. Figure 8 for PagUBC10a The results of TBO staining of cross-sections of stems from -OE transgenic and WT plants were as follows: Figure 8 In this context, A represents tissue section analysis and TBO staining. Figure 8 In this context, B represents the width of the xylem in IN15. Figure 8 In this context, C represents the width of the xylem in IN10. Figure 9 for PagUBC10a The results of TBO staining of cross-sections of stems from -OE transgenic and WT plants were as follows: Figure 9 In the diagram, A represents Mäule staining of stem segments from transgenic and WT lines. Figure 9 B in the text represents transgenic and WT bast fiber Mäule staining. Figure 9 In this context, C represents the results of scanning electron microscopy analysis and statistical analysis of the cavity area of phloem fibers. Figure 9 In this context, D represents transmission electron microscopy analysis. Detailed Implementation
[0018] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.
[0019] Unless otherwise defined, the technical or scientific terms used in this invention shall have the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.
[0020] Source of experimental materials: 1×TAE: TAE 50× buffer (Hyperex, #DZ8039), weigh 20 mL of this stock solution, and then make up to volume with the corresponding volume of deionized water.
[0021] LB medium: Weigh 10g of tryptone (OXOID #LP0042), 5g of yeast extract (OXOID #LP0021), and 5g of sodium chloride (Yuanye Biotechnology), and bring the volume to 1L with deionized water. Adjust the pH to 7.0.
[0022] Poplar transgenic working solution: Weigh 2.4g of WPM449 (Phyto Technology #L449), 0.5g of morpholine ethanesulfonic acid (MES), and 20g of sucrose. Dissolve in deionized water and bring the volume to 1L. Adjust the pH to 5.90±0.02. After high-temperature and high-pressure sterilization, add 100μM acetylsyl syringone (AS) and dispense for later use.
[0023] Poplar transgenic co-culture medium: The formula is the same as that of poplar transgenic working solution. After adjusting the pH, add 7.8g of agar, then perform subsequent sterilization operations, and after cooling, add 100μM acetylsyl syringone (AS) and dispense into containers. After the medium solidifies, it is ready for use.
[0024] Differentiation screening medium: Weigh 2.41g of WPM449, 0.5g of MES, and 20g of sucrose, dissolve them in deionized water, then add 0.1mg of NAA and 0.5mg of 6-BA, bring the volume to 1L with deionized water, adjust the pH to 5.90±0.02, autoclave, add 1mL of termethin (200mg / mL), and dispense for later use.
[0025] Rooting selection medium: Weigh 2.2g of MS519 (Phyto Technology #M519) and dissolve it in deionized water. Then add 0.05mg of NAA and 0.02mg of IBA hormones, and bring the volume to 1L with deionized water. Adjust the pH to 5.90±0.02, then autoclave and dispense for later use.
[0026] Unless otherwise specified, the materials, reagents, enzymes, competent cells, plasmids, and instruments used in this invention are all conventional experimental materials in the field and can be purchased through commercial channels.
[0027] Example 1 According to the 84K genome database of *Populus sylvestris* PagUBC10a Primers were designed based on the full-length gene sequence. The cDNA of soil-grown *Populus aureus* 84K was used as a template. The cDNA was obtained by reverse transcription of RNA extracted from soil-grown *Populus aureus* 84K seedlings.
[0028] Using designed primer pairs PagUBC10a The gene was amplified by PCR, and the amplification product was recovered and ligated into a T vector. The ligation product was then transformed into E. coli DH5α, and the cloning results were verified by bacterial sequencing.
[0029] Upload using the online primer design tool Primer3 Plus. PagUBC10a The complete CDS sequence of the gene is used to design primers for gene amplification and quantitative detection. Gene amplification primers cover... PagUBC10aThe 5'-3' full-length CDS region of the gene was annealed at a temperature of Tm=56℃; the quantitative primers were annealed at a temperature of Tm=60℃, with CG content between 40% and 60%.
[0030] PagUBC10a The gene has the nucleotide sequence shown in SEQ ID NO.1.
[0031] SEQ ID NO.1:>Pop_G12G050882.T1 ATGGCATCGAAACGGATCTTGAAGGAATTGAAAGATTTACAGAAGGATCCTCCTACTTCATGCAGTGCCGGTCCCGTTGCTGAAGACATGTTCCATTGGCAAGCAACAATTATGGGTCCTCGGATAGTCCTTATGCTGGCGGTTTTCCTAGTTACTATTCATTTTCCTCCAGATTATCCATTTAAGCCTCCCAAGGTAGCATTCCGAACAAAGGTATTCCA CCCAAATATAAATAGCAATGGCAGCATTTGCCTGGACATTTTGAAGGAGCAATGGAGCCCGGCTCTAACCATATCCAAGGTATTGCTCTCCATCTGCTCTTTGTTGACAGACCCTAACCCCGACGATCCATTGGTCCCCGAGATTGCTCATATGTACAAGACCGACAGGAACAAGTATGAGACAACTGCAAGAAGCTGGACCCAGAAGTATGCTATGGGCTAA.
[0032] PagUBC10a Full-length gene cloning primers include PagUBC10a -F and PagUBC10a -R, PagUBC10a The nucleotide sequence of -F is shown in SEQ ID NO.2. PagUBC10a The nucleotide sequence of -R is shown in SEQ ID NO.3.
[0033] SEQ ID NO. 2: ATGGCATCGAAACGGATCTT.
[0034] SEQ ID NO. 3: TTAGCCCATAGCATACTTCTGG.
[0035] PagUBC10aThe primers for quantitative PCR of genes include forward primer F and reverse primer R. The nucleotide sequence of forward primer F is shown in SEQ ID NO.4, and the nucleotide sequence of reverse primer R is shown in SEQ ID NO.5.
[0036] SEQ ID NO. 4: TCCAAGGTATTGCTCTCCATCTG.
[0037] SEQ ID NO. 5: TCTCATACTTGTTCCTGTCGGTC.
[0038] Using cDNA from *Populus alba* 84K as a template, PCR amplification was performed using 2×PhantaMax Master Mix high-fidelity polymerase (Vazyme, #P515). The PCR reaction program was as follows: initial denaturation at 95℃ for 3 min; 35 cycles: 95℃ for 30 s, annealing at 55℃ for 15 s; extension at 72℃ for 1 min; followed by final extension at 72℃ for 5 min. After amplification, the PCR products were used for subsequent experimental analysis.
[0039] The amplification system is shown in Table 1 below.
[0040] Table 1 PCR amplification system ;
[0041] After PCR product amplification, agarose gel electrophoresis is required for detection and product recovery. The specific steps for agarose gel electrophoresis are as follows: Weigh 0.25g of agarose, add 25mL of 1×TAE buffer, heat to dissolve, cool, add nucleic acid dye (GelRed), and pour into a mold to solidify. Next, mix the PCR product with the loading buffer and add it to the gel wells, then load 5μL of DNA 2000bp marker. After electrophoresis, observe and record the position and size of the DNA bands under a UV transilluminator. The 447bp cDNA fragment is then excised from the gel and stored at -20℃ for later use.
[0042] Ligation of the target gene fragment to the T vector: The purified PCR product was mixed with the T vector and ligated at room temperature for 5 min. It was then used directly for the transformation of competent cells. The T vector ligation system is shown in Table 2 below.
[0043] Table 2 T-carrier connection system ;
[0044] Remove DH5α competent cells from the -80℃ freezer and place them on ice to thaw. After most of the cells have thawed, add 5 μL of the target DNA (such as plasmid or ligation product), gently tap the EP tube to mix, and then place it on ice for 15 min.
[0045] Place the EP tubes in a 42°C water bath for 45 seconds to heat shock, then quickly return them to ice and let them stand for 3 minutes to ensure stable transformation efficiency and avoid shaking. Add 200 μL of antibiotic-free sterile LB medium to the EP tubes and incubate with shaking at 37°C and 220 rpm for 60 minutes to promote cell recovery. After recovery, centrifuge at 5000 rpm for 3 minutes to collect the cells, discard some of the supernatant, and resuspend the cells in approximately 50 μL of supernatant. Spread the resuspended cells evenly on LB medium plates containing the appropriate antibiotic. Finally, invert the plates and incubate overnight at 37°C.
[0046] Plasmid extraction and sequencing: Place overnight culture dishes in a clean bench, pick a single colony, add approximately 1 mL of liquid LB medium containing the corresponding antibiotic, mix well, and incubate at 37°C and 220 rpm in a shaker. Perform PCR testing on the expanded bacterial culture to confirm the introduction of the target DNA. Expand the DNA-positive bacterial culture for plasmid extraction using a plasmid miniprep kit (Huiling, NG218S) following the manufacturer's instructions, and send the extracted plasmids for verification using first-generation sequencing. Add 50% glycerol to the bacterial culture with correct sequencing alignment, flash freeze in liquid nitrogen, and store at -80°C.
[0047] Tissue Quantitative Analysis: Different tissues were sampled from two-month-old *Populus silageensis* 84K soil-grown seedlings approximately 45 cm tall. RNA was extracted from each tissue using liquid nitrogen grinding, and then reverse transcribed and analyzed by real-time quantitative PCR.
[0048] Plant RNA extraction and detection: Rapid sampling was performed using blades or similar instruments, and the samples were quickly ground in a mortar with liquid nitrogen to ensure they remained at a low temperature. The ground tissue powder was then transferred to RNA-free centrifuge tubes, and RNA extraction was performed following the instructions of the RNA extraction kit (Befite, #RN33050).
[0049] After extraction, 5 μL of RNA sample was mixed with loading buffer and subjected to electrophoresis to ensure quality. The RNA concentration was then determined using a micro spectrophotometer. Immediately after detection, the RNA sample was transferred to a -80°C freezer for storage.
[0050] RNA reverse transcription: RNA reverse transcription was performed using the Evo M-MLV Reverse Transcription Kit (#AG11728) from Acore.
[0051] gDNA removal: Prepare the genomic DNA removal reaction solution on ice according to the reaction system shown in Table 3 below, and continue the reaction at 42°C for 2 min.
[0052] Table 3 gDNA Removal Reaction Solution ;
[0053] Reverse transcription reaction: Prepare the reverse transcription reaction solution on ice according to Table 4 below, and perform the reverse transcription reaction in a PCR instrument. 37℃, 15 min; 85℃, 5 s. Subsequently, dilute the cDNA 10-fold and store at -20℃ for later use.
[0054] Table 4 Reverse transcription reaction solution ;
[0055] Real-time quantitative PCR Real-time quantitative PCR was performed using the SYBR Green Pro Taq HS premixed qPCR kit (#AG11701) from Akerui. The reaction mixture was prepared on ice according to the manufacturer's instructions and then placed in the quantitative PCR instrument for the reaction.
[0056] The quantitative PCR reaction program was as follows: initial denaturation at 95℃ for 30 s; 40 cycles (95℃, 5 s; 60℃, 30 s); and finally, melting curve acquisition (95℃, 15 s; 60℃, 60 s; 95℃, 15 s). The real-time quantitative PCR reaction system is shown in Table 5.
[0057] Table 5 Real-time quantitative PCR reaction system ;
[0058] In situ PCR analysis Sample fixation and embedding: Add 1.8 mL of fixative (63% ethanol, 5% acetic acid, 2% formaldehyde, prepared fresh for use) to a 2 mL centrifuge tube and place it on ice. Cut stem segments from healthy 84K tissue culture seedlings and carefully slice them into 4-5 mm long pieces using a blade. Gently invert the stem segments into the fixative, then use a rotary vacuum tube to perform vacuum permeation treatment on the samples for 3 minutes each time, repeating 2-3 times. After the vacuum operation, incubate the stem samples in the dark at 4°C for at least 12 hours.
[0059] After fixation, remove the sample and wash it three times every 10 minutes with 1.8 mL of low-temperature washing buffer I (63% ethanol, 5% glacial acetic acid, prepared fresh). After the last wash, remove the washing buffer as much as possible. Then, wash the sample three times every 3 minutes with 1.8 mL of low-temperature 1×PBS. After washing, transfer the sample to a 5% agarose gel for embedding and store at 4°C for at least 3 hours.
[0060] Sample DNase treatment and reverse transcription: The embedded, refrigerated samples were removed, trimmed, and then sectioned using a vibratory microtome. Stem sections were stored in RNase-free PCR tubes containing a mixture of 2.5 μL RNase Inhibitor and 85 μL sterile water. On ice, 10 μL of 10×DNase I Buffer and 2.5 μL of DNase I were added to a 0.2 mL PCR tube containing the sample, bringing the final volume to 100 μL. The PCR tube was placed in a PCR instrument and incubated at 37°C for 45 min. Next, 3.3 μL of 0.5 M EDTA (pH 8.0) was added, and the tube was treated at 70°C for 15 min to inactivate DNase I. After inactivation, the PCR tube was cooled on ice for 2 min. The DNase solution was carefully removed and discarded. Every 1 min, the sample was washed twice with 150-200 μL of ice-cold RNase-free water. Finally, the water was gently removed using a pipette tip.
[0061] Add 4.5 μL of RNase-free water and 5 μL of 10 μM reverse primer for gene quantification to a PCR tube containing the sample on ice. Then place the PCR tube in a PCR instrument, set the temperature to 70 °C, and incubate for 3 min. After incubation, place the PCR tube on ice to cool for 2 min. Add 10.5 μL of reaction solution, prepared as shown in Table 6 below. For the negative control, omit SMART MMLV Reverse Transcriptase and replace it with the same volume of RNase-free water. Continue incubating the PCR tube in the PCR instrument, set the temperature to 42 °C, and react for 90 min, followed by treatment at 70 °C for 10 min. Store on ice.
[0062] Table 6 In situ PCR reverse transcription system ;
[0063] In situ PCR: Carefully remove the reaction solution from the previous step. Wash the sample twice with 150 μL of sterile water at low temperature every 1 min. After washing, remove as much water as possible. Add the reaction reagents shown in Table 7 below to each PCR tube containing the slide on ice to perform the in situ PCR reaction.
[0064] The in situ PCR reaction program was as follows: initial denaturation at 98℃ for 3 min; denaturation at 98℃ for 20 s in each of the 34 cycles; annealing at 60℃ for 30 s; extension at 72℃ for 30 s; and final extension at 72℃ for 5 min.
[0065] Table 7 In situ PCR system ;
[0066] Anti-DIG-AP hybridization and observation: Carefully remove the in situ PCR reaction solution. Wash the tissue sections twice with 150 μL of 1×PBS every 5 min. After removing excess 1×PBS, add 100 μL of 1×Block solution and incubate on ice for 30 min. After incubation, carefully remove the 1×Block solution, add 50 μL of diluted Anti-DIG-AP antibody, and store at room temperature for 1 h.
[0067] After anti-DIG-AP hybridization, the antibody was removed, and the slides were then washed twice every 15 minutes with Washing Buffer II (0.1M Tris-HCl, 0.15M NaCl, pH=9.5). The samples were transferred to glass slides, and 50 μL of BMpurple was added for colorimetric reaction. The slides were observed using a bright-field microscope equipped with a camera.
[0068] Subcellular localization: Construction of subcellular localization vectors The subcellular localization vectors were pMDC43 and pMDC83, constructed using the Gateway method. First, Gateway attb adapters were added to the 5' end of both the forward and reverse primers (the stop codon TTA was removed from the reverse primer of pMDC83) of the full-length cloned gene. The nucleotide adapter sequence of forward primer F is shown in SEQ ID NO.6, and the nucleotide adapter sequence of forward primer R is shown in SEQ ID NO.7.
[0069] SEQ ID NO.6: GGGGACAAGTTTGTACAAAAAAGCAGGCTCG; SEQ ID NO.7: GGGGACCACTTTGTACAAGAAAGCTGGGTC.
[0070] Gene amplification and product recovery were performed according to the above experimental protocol. The recovered product and Gateway intermediate vector pDONR207 were ligated using BP ligase (GenecopoeiaEZRecombinase™ BP Mix, #ER003). The reaction system is shown in Table 8. Ligation was carried out overnight at 25°C.
[0071] Table 8 BP Reaction Linkage System ;
[0072] The BP ligation product was transformed into *E. coli* DH5α competent cells and sequenced. The recombinant plasmid with the correct sequenced pDONR207 intermediate vector was extracted and stored at -20°C for subsequent LR ligation reactions. The LR ligation system used was LR ligase (Genecopoeia EZRecombinase™ LR Mix, #ER001), and the reaction mixture is shown in Table 9. Ligation was performed overnight at 25°C.
[0073] Table 9 LR Reaction Linkage System ;
[0074] The LR ligation product was transformed into E. coli DH5α competent cells and sequenced. Plasmids with correctly sequenced pMDC43 and pMDC83 were extracted and stored at -20°C for later transformation into GV3101-psoup Agrobacterium competent cells.
[0075] Agrobacterium transformation: Add the extracted correct plasmid into Agrobacterium competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd., refer to the instruction manual for specific operation).
[0076] Transient expression in tobacco: *Nicotiana benthamiana* plants with a growth cycle of 4-6 weeks and not yet flowering were selected as experimental materials. Water was withheld for 3 days prior to transient expression, and dark incubation was performed 1 day before and on the day of transient expression to open the stomata on the underside of the leaves. The bacterial culture was pre-produced and collected at 4000 rpm for 10 min. The cells were resuspended in tobacco infection working solution to OD600 = 1.0 and placed in the dark for 1 h. The working solution system is shown in Table 10.
[0077] Table 10 Instantaneous Expression Working Fluid System ;
[0078] The bacterial suspension was injected into the underside of tobacco leaves using a 1 mL syringe, avoiding the veins. After injection, the tobacco leaves were cultured in the dark for one day, followed by two days of culture under light. After the culture was completed, leaf sections showing transient bacterial infection were cut off and prepared for observation and photography using a laser confocal microscope.
[0079] The test results are as follows: PagUBC10a Gene cloning and sequence alignment analysis, results are as follows Figure 1 As shown.
[0080] Depend on Figure 1 It can be seen that, PagUBC10a The full-length CDS is 447 bp, and the clone sequence is completely identical to Pop_G12G050882 in the Silver Poplar 84K Genome Database.
[0081] PagUBC10a Tissue-specific expression pattern analysis, results as follows Figure 2 As shown.
[0082] Depend on Figure 2 It can be seen that, PagUBC10a The differences in different tissues of *Populus silvergrass* 84K are not significant, particularly in the terminal bud, cambium, and fifth internode of the stem segment. PagUBC10a The transcription level was relatively high. Additionally, it was found that... PagUBC10a The transcriptional level in leaves gradually decreases from leaf primordia to older leaves, indicating that... PagUBC10a It plays a key role in the early development of leaves.
[0083] PagUBC10a In situ PCR analysis results are as follows Figure 3 As shown.
[0084] Depend on Figure 3 It can be seen that in the early stages of the formation of secondary xylem, PagUBC10a It is mainly expressed in the cambium and phloem near the cambium, with a small amount of signal distribution also in the protoxenum region and the periphery of the phloem. This result is consistent with... PagUBC10a The trend of the tissue quantitative analysis results is consistent with that of Populus tomentosa, and is also similar to the expression pattern in Populus tomentosa, proving that... PagUBC10a It is related to the development of poplar stem segments.
[0085] The subcellular localization analysis results of PagUBC10a are as follows: Figure 4 As shown.
[0086] Depend on Figure 4 It was found that GFP-PagUBC10a emits strong GFP fluorescence in the nucleus and cytoplasm. By confirming the signaling of tobacco with a stable nuclear localization marker in the RFP channel, it was determined that PagUBC10a, as an E2 enzyme, exhibits nuclear translocation.
[0087] By building PagUBC10a -GFP vector and observed subcellular localization of PagUBC10a-GFP, found the same localization results ( Figure 4 (A in the text). This suggests that PagUBC10a may be recruited to the nucleus by certain proteins to perform its function.
[0088] Furthermore, the fluorescent signal of PagUBC10a-GFP was found to be present in the reticular organelles of the cytoplasm, suggesting that it is located in the endoplasmic reticulum. By co-injecting PagUBC10a-GFP with the endoplasmic reticulum localization marker HDEL-mCherry-corresponding Agrobacterium, it was found that the PagUBC10a protein was also located in the endoplasmic reticulum. Figure 4The presence of B in the text suggests that PagUBC10a may be involved in cellular synthesis-related biological activities.
[0089] Example 2 PagUBC10a Gene function analysis: Using the Agrobacterium-mediated leaf disc method, PagUBC10a The T-DNA transfer region was overexpressed and transformed into the genome of *Populus simonii* 84K. Positive overexpression transgenic lines were obtained through fluorescent labeling, plant resistance screening, and nucleic acid level identification. PagUBC10a -OE.
[0090] For further evaluation PagUBC10a The growth and development of -OE plants will PagUBC10a -OE plants and wild-type *Populus silveraefolia* 84K were co-cultivated in soil for two months, during which the growth status and related physiological indicators of the plants were observed and recorded. Simultaneously, the growth and development of the xylem were analyzed using microscopic sectioning techniques. Based on the combined results of multiple phenotypic identifications, the following analysis was conducted: PagUBC10a -OE plant changes in morphology and physiological characteristics.
[0091] Vector construction: pK2GW7-eYGFP was used as the overexpression vector, and the pK2GW7-eYGFP- vector was constructed using the Gateway method. PagUBC10a The vector, Gateway attb adapter, includes the forward sequence F (SEQ ID NO. 6) and the reverse sequence R (SEQ ID NO. 7). The Gateway assay includes BP and LR reactions, following the same experimental protocol as described above. The correctly sequenced pK2GW7-eYGFP- PagUBC10a After extracting plasmids from the vector, transform GV3101 Agrobacterium (purchased from Shanghai Weidi Biotechnology Co., Ltd., refer to the instruction manual for specific operation). After the Agrobacterium test is positive, freeze the bacterial culture at -80℃ for later use.
[0092] Agrobacterium-mediated transformation of Populus aurea var. 84K (1) Preparation of bacterial culture: Pick a single colony of Agrobacterium and inoculate it into LB liquid medium containing the corresponding antibiotic. Incubate overnight at 28°C with shaking until the OD600 value is 0.6-0.8. Centrifuge at 4000 rpm for 10 min, discard the supernatant, and resuspend the bacterial cells with poplar infection working solution to make the OD600 = 0.4-0.6. The resuspended bacterial culture can be used for Agrobacterium-mediated leaf disc genetic transformation.
[0093] (2) Infection and co-culture: Take leaves of sterile seedlings of the Silver Poplar 84K with good growth status, inoculate them on CM co-culture medium, and gently scratch the main vein and lateral veins with a sterile scalpel blade to remove the leaf tip.
[0094] Place the leaf in the poplar infection working solution and incubate for 15-20 minutes, gently shaking during the process. After infection, remove the leaf, blot off excess bacterial solution with sterile filter paper, and transfer it to CM co-culture medium. Incubate in the dark at 25°C for 2 days.
[0095] (3) Screening culture: The co-cultured leaves were transferred to a differentiation medium containing kanamycin (50 mg / L) and termethin (200 mg / mL). The medium was changed every 2 weeks to screen for resistant shoots.
[0096] (4) Rooting culture: When the fluorescently resistant shoots grow to 3-5 cm, cut them off and inoculate them on a rooting medium containing kanamycin. This process should avoid damaging the adventitious shoots and plant tissues. Then, place the adventitious shoots and the rooting induction medium in the tissue culture room for further culture. If the T-DNA is successfully inserted into the plant genome, the adventitious shoots can grow and root on the resistant medium, and the DNA and RNA levels can be detected.
[0097] DNA extraction and detection: DNA was extracted according to the CTAB method; RNA extraction was performed according to the Biofit RNA extraction kit.
[0098] RNA reverse transcription: The procedure was performed according to the protocol of the Evo M-MLV reverse transcription premixed kit from Aikerui.
[0099] Measurement of growth indicators of transgenic and WT plants: Overexpression lines with high expression levels and wild-type 84K were selected and propagated in large quantities through tissue culture. Ten tissue culture seedlings with consistent growth were selected and transplanted into a seedling substrate for soil culture. The growth conditions for soil-cultured plants were: a 16-hour light cycle followed by an 8-hour dark cycle, and a constant temperature of 24℃.
[0100] After two months of soil culture, systematic growth indicators were measured.
[0101] (1) Conduct an overall growth assessment of all 10 plants and observe their growth status; (2) The two plants with the best and two plants with the worst growth were removed, and a detailed analysis was conducted on the remaining six plants. The key physiological indicators measured included: plant height, diameter at root, number of internodes, internode length, leaf area, and leaf circumference. All measurement data were compiled and statistically analyzed to evaluate the differences and trends in the growth performance of different strains under soil cultivation conditions.
[0102] Observation of stem tissue sections from transgenic and WT plants: Shaking sectioning: Plants that have completed growth index measurements were sampled, with three biological replicates selected for each line. Internodes were excised and placed in 2 mL EP centrifuge tubes, with sterile water added for preservation. The resulting stem segments were trimmed, embedded in 5% agarose, and transversely sectioned using a Leica VT1200S shaking microtome, with each section 50 μm thick. Early collected shaking sections were initially observed under an eyepiece to ensure the integrity of the stem cross-section. Multiple shaking sections were then collected for subsequent staining and observation.
[0103] Staining observation of tissue sections: 0.1% toluidine blue (TBO) staining: Carefully remove the collected tissue sections with tweezers or a dropper, shake them, place them on a glass slide and blot dry. Add 0.1% toluidine blue (TBO) and stain for about 20 seconds. Rinse the stained sections with sterile water to remove excess staining solution. Add sterile water and slowly and carefully cover with a coverslip with tweezers to avoid generating air bubbles.
[0104] Mäule staining method: First, remove the slide and place it on a glass slide, then blot dry. Add 0.5% potassium permanganate solution and stain for 10 minutes, followed by washing three times with sterile water. Then, add 10% hydrochloric acid solution and stain for 5 minutes. After staining, wash three times with sterile water and blot dry. Finally, fix with 1.5M sodium carbonate solution for 1 minute, then slowly and carefully cover with a coverslip and observe under a microscope.
[0105] After preparation, the slides were observed using a Leica DM6B upright fluorescence microscope.
[0106] Images were taken using a Leica DM6B upright fluorescence microscope, and scale bars were marked using the accompanying LAS X. ImageJ software was used to measure and statistically analyze data such as xylem width in the transverse tissue sections of the stem segments to determine if there were significant changes in the transgenic plants.
[0107] Scanning electron microscopy and transmission electron microscopy observations: Scanning electron microscopy observation: The morphology of plant tissue was observed directly under a Hitachi TM4000 desktop scanning electron microscope using a shaking section of the 10th internode of the stem segment.
[0108] Transmission electron microscopy observation: Select fresh samples and cut them into 1×3×1mm pieces. 3 The samples were placed in 1.5 mL or 2 mL EP tubes and quickly fixed thoroughly with fixative (2.5% glutaraldehyde). The stem segments were then gently inverted in the fixative, followed by vacuum permeation of the samples using a rotary vane vacuum apparatus for 15 minutes each time, repeated twice, allowing the specimens to settle. The fixed samples were then stored in a 4°C refrigerator.
[0109] Before processing the osmotic-embedded samples, the fixed samples were removed from the 4°C freezer and rinsed three times with 0.1M phosphate buffer (pH 7.0) for 15 min each time. The samples were then fixed with 1% osmium tetroxide solution for 1-2 hours. The osmium tetroxide waste solution was carefully removed, and the samples were rinsed again three times with 0.1M phosphate buffer (pH 7.0) for 15 min each time. After rinsing, the plant tissue samples were dehydrated using a gradient of 30%, 50%, 70%, and 80% ethanol solutions, each for 15 min. This was followed by dehydration using gradients of 90% and 95% acetone solutions, each for 15 min. Finally, the samples were treated twice with pure acetone for 20 min each. During the dehydration process, the samples were shaken to ensure thorough dehydration.
[0110] After dehydration, the samples were treated with a mixture of Spurr embedding medium and acetone (V / V=1:1) for 1 hour; then, the samples were removed and treated with a mixture of Spurr embedding medium and acetone (V / V=3:1) for 3 hours; finally, the samples were removed and treated overnight in pure Spurr embedding medium. After embedding, the infiltrated samples were sectioned in a Leica EM UC7 ultramicrotome to obtain sections of 70-90 nm. These sections were then stained with lead citrate solution and 50% ethanol saturated solution of uranium acetate for 5-10 minutes each, and observed on a Hitachi H7650 transmission electron microscope.
[0111] The test results are as follows: PagUBC10a Screening, identification, and expression analysis of overexpressing plants; results are as follows: Figure 5 As shown.
[0112] Depend on Figure 5 As can be seen from A in the text, pK2GW7-eYGFP- PagUBC10a A schematic diagram of the vector construction, in which the T-DNA region contains 35S-driven PagUBC10a and green fluorescent protein.
[0113] Depend on Figure 5 As can be seen from B in the figure, transformation can be induced by using the leaf disc method. PagUBC10a Overexpression of leaves obtained PagUBC10a Overexpressing plants.
[0114] Depend on Figure 5 As shown in C, green fluorescence can be observed when plant tissue is irradiated with a handheld ultraviolet light exciter, indicating that T-DNA has been successfully transformed into the plant genome.
[0115] PCR identification of the DNA level of the transgenic lines was performed, and the results are as follows: Figure 6 A. Further transcriptional analysis was performed on the obtained fluorescent 84K tissue culture seedlings, and the quantitative results are as follows: Figure 6B in the middle.
[0116] Depend on Figure 6 From B, we know that the transgenic plants #1, #4, #5, #7, #11, and #12... PagUBC10a The transcriptional level was significantly higher than that of wild-type 84K plants, reaching 30 to 50 times the expression level.
[0117] Depend on Figure 6 As shown in C, the RNA expression level in the stem segments of the above-mentioned transgenic positive plants was also significantly increased, reaching 7 to 8 times that of the wild-type 84K plants. The two lines with the highest expression levels were selected. PagUBC10a -OE#1 and PagUBC10a -OE#7 will be used as the subject of subsequent experiments.
[0118] The results of the growth phenotype analysis of the overexpressed transgenic plants are as follows: Figure 7 .
[0119] Depend on Figure 7 A and Figure 7 As shown in B, there were no significant differences in plant height, number of internodes, and internode length between wild-type and overexpressing transgenic plants.
[0120] Depend on Figure 7 C in Figure 7 F and Figure 7 From G, we can know that PagUBC10a -OE#1 and PagUBC10a -OE#7 leaves showed a significant reduction in area, with noticeable wrinkling and curling on the leaf surface, which was more pronounced in younger leaves. Figure 7 (D in the middle).
[0121] Depend on Figure 7 As can be seen from E, PagUBC10a -OE#1 and PagUBC10a The diameter at ground of -OE#7 is significantly smaller than that of the wild-type 84K, indicating that PagUBC10a High expression of the gene may inhibit the normal development of the stem segment of Populus spp. 84K, resulting in a smaller diameter at ground level.
[0122] The above results further illustrate that, PagUBC10a Gene overexpression inhibits the growth and development of *Populus silverae* 84K, especially during the development of leaves and stem segments.
[0123] PagUBC10a -OE transgenic plant section analysis, results as follows Figures 8-9 .
[0124] Depend on Figure 8 It can be seen that, PagUBC10aThe xylem of the -OE plant is significantly narrower than that of the wild-type Populus spp. 84K, and this phenomenon is evident in the xylem regions of the 5th, 10th, and 15th internodes. This trend is already apparent in the early stages of secondary growth (internode 5), and is even more pronounced in the mature internodes (internode 15). PagUBC10a -OE overexpression plants exhibited later secondary growth and development characteristics compared to wild-type Populus aurea 84K.
[0125] Depend on Figure 9 It can be seen that, PagUBC10a The lignin staining in the xylem region of the -OE overexpressing lines was similar to that of the wild-type 84K, but the staining range was significantly smaller than that of the control group. PagUBC10a -OE staining of the phloem fiber structure in the peripheral region of the phloem was significantly lighter than that in the control group. Further observation of the sections under a high-power microscope revealed that the volume of the collapsed cavities in this region was significantly larger than that in the control group, and the gelatinous layer inside the phloem fibers was also significantly lighter in staining than in the control group, indicating that... PagUBC10a This may have affected the inward regulation of secondary biological deposition processes.
[0126] The structure was observed using scanning electron microscopy and transmission electron microscopy. PagUBC10a The phloem fiber structure cavities of the -OE strain were significantly larger than those of the wild-type control group, a finding that further supports the conclusions of the Mäule staining observations.
[0127] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.
Claims
1. PagUBC10a The application of genes in regulating the growth and development of poplar trees is characterized by, The PagUBC10a The nucleotide sequence of the gene is shown in SEQ ID NO:
1.
2. The application according to claim 1, characterized in that, Through regulation PagUBC10a Gene expression levels regulate poplar wood development and / or leaf development.
3. The application according to claim 2, characterized in that, By overexpressing the above PagUBC10a Genes cause the width of the xylem in poplar stems to decrease, the secondary walls of phloem fibers to become thinner and the cavities to expand, thus inhibiting the development of the xylem in poplars.
4. The application according to claim 2, characterized in that, By overexpressing the above PagUBC10a Genes reduce leaf area, exacerbate leaf wrinkling, and inhibit leaf development.
5. A method utilizing the method described in claim 1 PagUBC10a The method for genetically breeding transgenic poplar trees is characterized by, Includes the following steps: S1, Cloned Poplar PagUBC10a Gene; S2, the above PagUBC10a Genes are linked to a vector to obtain an overexpression vector; S3. The overexpression vector obtained in S2 is transformed into Agrobacterium to obtain Agrobacterium bacterial suspension; the Agrobacterium bacterial suspension is then used to inoculate poplar leaves to obtain... PagUBC10a Gene overexpression in poplar leaves was used to induce leaf differentiation and obtain... PagUBC10a Poplar trees with overexpressed genes.
6. The method according to claim 5, characterized in that, The cloned poplar tree in S1 PagUBC10a The specific gene manipulation is as follows: Total RNA was extracted from poplar trees, reverse transcribed into cDNA, and used as a template to generate primers. PagUBC10a -F and PagUBC10a -R is used for PCR amplification to obtain... PagUBC10a Gene.
7. The method according to claim 6, characterized in that... The primers PagUBC10a The nucleotide sequence of -F is shown in SEQ ID NO.2, and the primer... PagUBC10a The nucleotide sequence of -R is shown in SEQ ID NO.
3.
8. An overexpression vector for regulating the growth and development of poplar trees, characterized in that, The overexpression vector comprises the one described in claim 1. PagUBC10a Gene.
9. A strain that regulates the growth and development of poplar trees, characterized in that, The strain includes the overexpression vector as described in claim 8.
Citation Information
Patent Citations
DNA (deoxyribonucleic acid) fingerprint spectrum construction method of various poplar strains
CN115838787A
Molecular design for improving lignin content through overexpression of PdHUB2 and application
CN118006644A
Gene PagGRF12a for regulating and controlling development of leaves and stems of poplar and application of gene PagGRF12a
CN118726383A
Gene GhUCE for regulating and controlling growth period and drought resistance of crops and application of gene GhUCE
CN120099043A
Application of knockout NL895 E6-LIKE gene in increasing wood yield and method of knockout NL895 E6-LIKE gene
CN120366369A