Application of sunflower HaSnRK2 gene in regulating and controlling salt tolerance and drought tolerance of plants

Abstract

The invention provides an application of a sunflower HaSnRK2 gene in regulating and controlling salt tolerance and drought tolerance of plants, and belongs to the technical field of plant genetic engineering. The invention provides an overexpression vector of a sunflower HaSnRK2 gene. The overexpression vector is applied to regulation and control of salt tolerance and drought tolerance of plants after genetic transformation is carried out on the plants by using a flower dipping method. Through overexpression of the sunflower HaSnRK2 gene, the salt stress tolerance and the drought stress tolerance of plants are remarkably enhanced, and damage caused by reactive oxygen free radicals induced by salt stress and drought stress can be effectively relieved.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, and in particular relates to the application of the sunflower HaSnRK2 gene in regulating the salt and drought tolerance of plants. Background Technology

[0002] Salt-tolerant germplasm and genetic resources are crucial for ensuring stable and high yields of crops in saline-alkali lands, and are of strategic significance for the sustainable development of agriculture in these areas in my country. Sunflower (Helianthus annuus L.) exhibits significant growth inhibition under saline-alkali stress, with a marked decrease in seedling survival rate and mature plant rate. High salt concentrations not only delay root development and stem elongation but also cause physiological abnormalities such as chlorophyll degradation and reduced leaf area, ultimately leading to the death of the entire plant and resulting in severe yield losses and quality degradation.

[0003] Therefore, discovering key salt-tolerant gene resources is of strategic significance for ensuring the safe production of my country's sunflower industry and achieving stable and high yields. However, the current creation of salt-tolerant sunflower germplasm and the discovery of salt-tolerant gene resources are still insufficient, and the breeding of varieties suitable for saline-alkali land urgently needs to overcome the current situation of insufficient salt-tolerant germplasm and gene resources. In the plant stress response regulatory network, the SnRK family includes three key subfamilies: SnRK1, as a core regulator of sugar signal transduction, participates in metabolic regulation; SnRK2, as a plant-specific stress response kinase, participates in osmotic stress response through both ABA-dependent and non-ABA-dependent pathways; and SnRK3 participates in stress defense through interaction with CBLs.

[0004] The SnRK2 (SNF1-related protein kinases 2) family of protein kinases plays a central regulatory role in plant ABA (abscisic acid) signaling and salt stress response. Studies have shown that all SnRK2 members in Arabidopsis (AtSnRK2.1-2.10) and rice (OsSAPK1-10) are significantly activated by ABA treatment and salt stress, confirming the universal function of this family in plant stress responses. In Arabidopsis, AtSnRK2.4 and AtSnRK2.10 kinases mediate the plant's adaptive response to salt stress by regulating the expression network of genes related to reactive oxygen species (ROS) metabolism. Notably, research on the regulatory mechanisms of SnRK2 in non-ABA-dependent signaling pathways is relatively weak, but it plays an irreplaceable role in plant responses to multiple environmental stresses. As an upstream regulatory hub in the signaling cascade, even small changes in SnRK2 kinase expression can trigger significant physiological responses. Current research mainly focuses on ABA-dependent pathways, while further research is needed on the molecular mechanisms, transcriptional regulatory networks, and downstream effectors of non-ABA-dependent SnRK2 in stress responses. In-depth analysis of the signal transduction mechanisms of SnRK2, especially its non-ABA-dependent members, under salt-alkali stress will provide new theoretical basis and technical pathways for crop stress resistance breeding. Summary of the Invention

[0005] In view of this, the purpose of this invention is to provide an application of the sunflower HaSnRK2 gene in regulating the salt and drought tolerance of plants.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] This invention provides the application of the sunflower HaSnRK2 gene in regulating plant salt tolerance, and overexpression of the sunflower HaSnRK2 gene improves the salt tolerance of plants.

[0008] This invention also provides the application of the sunflower HaSnRK2 gene in regulating plant drought resistance, and overexpression of the sunflower HaSnRK2 gene improves the drought resistance of plants.

[0009] This invention also provides the application of the sunflower HaSnRK2 gene in regulating the scavenging of reactive oxygen species in plants, and that overexpression of the sunflower HaSnRK2 gene can reduce the damage caused by reactive oxygen species.

[0010] Preferably, the damage caused by the reactive oxygen species is induced by salt stress and drought stress.

[0011] Preferably, the method for overexpressing the sunflower HaSnRK2 gene includes the following steps:

[0012] An overexpression vector for the sunflower HaSnRK2 gene was constructed, and the plants were genetically transformed using the flower-dipping method. Transgenic lines that overexpress the sunflower HaSnRK2 gene were screened, thus achieving overexpression of the sunflower HaSnRK2 gene in plants.

[0013] Preferably, the overexpression vector of the sunflower HaSnRK2 gene is pCAMBIA1300-HaSnRK2-GFP, which uses pCAMBIA1300-GFP as the original vector and clones the sunflower HaSnRK2 gene between the BglII and XbaI restriction sites of pCAMBIA1300-GFP.

[0014] Preferably, the plant includes Arabidopsis thaliana.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] This invention provides an overexpression vector for the sunflower HaSnRK2 gene. After genetic transformation of plants using the flower-dipping method, this overexpression vector is applied to the regulation of salt and drought tolerance. This invention significantly enhances the salt and drought stress tolerance of sunflower plants through overexpression of the HaSnRK2 gene, effectively mitigating the damage caused by reactive oxygen species induced by salt and drought stress. Attached Figure Description

[0017] Figure 1 The results show the amino acid sequence homology comparisons of HaSnRK2, AtSnRK2.4, and AtSnRK2.10.

[0018] Figure 2 The expression pattern of HaSnRK2 under salt stress treatment (where A is the expression analysis of HaSnRK2 gene in various vegetative organs of sunflower, R-root, SS-young stem, SL-young leaf, ML-mature leaf, BL-bract, MS-mature stem, and B is the analysis of the change in expression level of HaSnRK2 at different time points after NaCl (200mM) treatment).

[0019] Figure 3 This is a map of the pCAMBIA1300-GFP vector plasmid;

[0020] Figure 4 This is the germination rate phenotype of Arabidopsis thaliana seedlings overexpressing HaSnRK2 under different concentrations of NaCl and mannitol treatment;

[0021] Figure 5This study analyzed the germination rate of Arabidopsis thaliana seedlings overexpressing HaSnRK2 after treatment with different concentrations of NaCl and mannitol (where (a) is CK, (b) is 100 mM NaCl, (c) is 125 mM NaCl, (d) is 150 mM NaCl, (e) is 100 mM Mannitol, (f) is 150 mM Mannitol, (g) is 200 mM Mannitol, and (h) is 300 mM Mannitol).

[0022] Figure 6 The effects of different concentrations of NaCl and mannitol on the greening rate of wild-type (WT) and HaSnRK2-overexpressing (OE) seedlings were investigated.

[0023] Figure 7 The phenotypes of Arabidopsis thaliana overexpressing HaSnRK2 under 200mM NaCl and drought stress are shown in the figures (where (a) is the normal growth state of wild type (WT) and transgenic lines (OE-10-3, OE-10-19) before treatment and the phenotype after 14 days of treatment with 200mM NaCl, and (b) is the phenotype after 14 days of drought stress and 7 days of rehydration. Data label: scale bar = 1cm).

[0024] Figure 8 The enzyme activity analysis of Arabidopsis thaliana before and after treatment with HaSnRK2 overexpression and 200 mM NaCl stress (where (a) is POD activity, (b) is SOD activity, (c) is MDA activity, (d) is CAT activity, and (e) is APX activity).

[0025] Figure 9 This is an analysis of enzyme activity in Arabidopsis thaliana before and after drought treatment and after rehydration for overexpressing the HaSnRK2 gene ((a) is POD activity, (b) is SOD activity, (c) is MDA activity, (d) is CAT activity, and (e) is APX activity). Detailed Implementation

[0026] This invention provides the application of the sunflower HaSnRK2 gene in regulating plant salt tolerance, and overexpression of the sunflower HaSnRK2 gene improves the salt tolerance of plants.

[0027] This invention also provides the application of the sunflower HaSnRK2 gene in regulating plant drought resistance, and that overexpression of the sunflower HaSnRK2 gene improves the drought resistance of plants.

[0028] This invention also provides the application of the sunflower HaSnRK2 gene in regulating the scavenging of reactive oxygen species in plants, and that overexpression of the sunflower HaSnRK2 gene can reduce the damage caused by reactive oxygen species.

[0029] In this invention, the damage caused by reactive oxygen species is induced by salt and drought stress. The method for overexpressing the sunflower HaSnRK2 gene includes the following steps: constructing an overexpression vector for the sunflower HaSnRK2 gene; genetically transforming plants using the flower-dipping method; screening for transgenic lines overexpressing the sunflower HaSnRK2 gene; thereby achieving overexpression of the sunflower HaSnRK2 gene in plants; the overexpression vector for the sunflower HaSnRK2 gene is pCAMBIA1300-HaSnRK2-GFP, which uses pCAMBIA1300-GFP as the original vector and clones the sunflower HaSnRK2 gene between the Bgl II and Xba I restriction sites of pCAMBIA1300-GFP; the plant includes Arabidopsis thaliana.

[0030] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0031] Example 1

[0032] 1. Sequence characteristics and expression pattern analysis of HaSnRK2

[0033] Multiple sequence alignment revealed that HaSnRK2 (gene number: LOC110885370, protein sequence number: XP_021988745.1) shared over 80% sequence similarity with Arabidopsis thaliana AtSnRK2.4 and AtSnRK2.10. Figure 1 ).

[0034] 2. qRT-PCR analysis of the spatiotemporal expression pattern of HaSnRK2 under salt stress conditions

[0035] Tissue-specific expression analysis: Using sunflower SK02R as material, total RNA was extracted from plant tissues of various parts, including roots, young stems, young leaves, mature leaves, bracts, and mature stems, and reverse transcribed into cDNA. qPCR primers were designed based on the gene coding sequence of HaSnRK2, and PCR was performed using a real-time PCR MIX kit in a real-time PCR instrument to amplify the target fragment and detect the expression level of the target gene in different tissues.

[0036] Temporal expression patterns induced by salt stress: Sunflower seedlings SK02R were treated with H2O and 200mM NaCl for two weeks. Samples were taken at 0h, 1h, 3h, 6h, 12h, 24h and 48h after treatment to extract total RNA, which was then detected by qRT-PCR according to the above method.

[0037] Experimental results: such as Figure 2As shown. Tissue-specific analysis results showed that the gene was expressed in all tested tissues, but exhibited a clear tissue bias, with the highest expression level in mature stems (MS), followed by young stems and roots. This indicates that under salt stress conditions, the expression of this gene in all tissues is induced. Figure 2 (A) Regarding temporal dynamics of expression, HaSnRK2 expression exhibited a progressive induction pattern: expression reached 2.03 times that of the control 1 hour after stress, then continued to rise to 2.6 times that of the control at 3 hours; it slightly decreased to 2.46 times at 6 hours, reaching a peak of 3.10 times at 12 hours. Thereafter, expression gradually decreased, remaining at 1.57 times that of the control until 48 hours. Figure 2 (B in the middle).

[0038] 3. Construction of HaSnRK2 overexpression vector

[0039] Obtaining the full length of the HaSnRK2 gene: The target gene fragment was amplified using high-fidelity polymerase (Vazyme P505). Primers F: ATGGAGAAGTATGAGCTTGTGA (as shown in SEQ ID NO:1) and R: GGTGAAGTTGGTCCCATCTAA (as shown in SEQ ID NO:2) were designed using the HaSnRK2 CDS sequence as a template. The PCR reaction system was as follows: 25 μL 2×PhantaMasterMix, 1 μL 10mM dNTPs, 2 μL each of forward and reverse primers, 1 μL P505 enzyme, 1 μL DNA template, and ddH2O added to a final volume of 50 μL. Agarose gel electrophoresis was used to check whether the PCR product matched the target gene band size. The target band was purified using the DP214 kit (TIANGEN) (purchased from Shaanxi Zhongke Yutong Biotechnology Co., Ltd.), following the manufacturer's instructions.

[0040] Ligation and transformation: First, the vector plasmid pCAMBIA1300-GFP (see Zhang Y, Liu X, Yiji Shi Lina Lang Shunxian Tao Qi Zhang Mengfan Qin Kai Wang Yu Xu Lin Zheng Hanming Cao Han Wang Yunlin Zhu Jia Song Keqi Li Aixia Xu Zhen Huang. The B-box transcription factor BnBBX22.A07 enhances salt stress tolerance by indirectly activating BnWRKY33.C03[J]. Plant, Cell & Environment, 2024. Plasmid map as shown) Figure 3 (As shown) The HaSnRK2 gene was double-digested with restriction endonucleases Bgl II and Xba I. The digestion products were then detected by electrophoresis, and the linearized vector was purified using the DNA kit described above. Finally, the purified HaSnRK2 gene sequence and the linearized vector were ligated using homologous recombinase, and the ligation product was transformed into competent E. coli cells. After overnight culture at 37°C, colony PCR was performed for verification. The positive clone plasmid pCAMBIA1300-HaSnRK2-GFP, which was consistent with the size of the target gene band, was selected for sequencing. After the alignment results were correct, Agrobacterium was transformed.

[0041] 4. Obtaining Arabidopsis thaliana with HaSnRK2 overexpression

[0042] Transformation of Arabidopsis thaliana using the flower-dipping method:

[0043] (1) Germinated on 1 / 2 MS solid medium, and transplanted to nutrient soil after the second true leaf unfolds. Culture conditions were strictly controlled in an artificial climate chamber with 16h light / 8h darkness, day / night temperature of 24 / 22℃, and relative humidity of 50-60%. After the plants entered the reproductive growth stage, the following key pretreatments were performed: First, the tissues that had flowered and formed pods were cut off, and then the bolting stem tissues were removed regularly. One week after treatment, healthy plants were selected, and the semi-open flower buds were retained for subsequent transformation experiments. At the same time, the pollinated siliques were removed.

[0044] (2) When Arabidopsis thaliana bolts, cut off the flowering and pod-forming tissues, remove the apical dominance, and let it grow for about a week. After all the planted Arabidopsis thaliana bolts, select open flower buds for infection.

[0045] (3) Agrobacterium culture and infection solution preparation: The GV3101 Agrobacterium strain was streaked on LB agar plates containing 50 μg / mL Rif (rifampicin) and 50 μg / mL Kanamycin, and incubated at 28°C for 2-3 days. Single colonies were picked and inoculated into LB broth containing antibiotics, and cultured with shaking at 220 rpm for 18-24 hours. Subsequently, the colonies were transferred to 100 mL of LB broth at a ratio of 1:200 and cultured until OD600 ≈ 2.0. The cells were collected by centrifugation at 5000 rpm for 8 minutes, resuspended in transformation osmotic buffer (containing 5% sucrose and 0.02% Silwet L-77), and the OD600 was adjusted to the range of 0.8-1.0. Finally, 0.5% Tween-20 surfactant was added to enhance the infection effect.

[0046] (4) Inflorescence Infection and Culture: Completely immerse the semi-open flower buds of the pretreated plants in the prepared Agrobacterium suspension, gently agitating for 45 seconds. Repeat this process 2-3 times to ensure adequate contact. After infection, absorb excess bacterial solution with sterile filter paper and incubate the plants horizontally in the dark for 24 hours, then transfer them to normal growth conditions. To improve transformation efficiency, repeat the infection process 3-7 days after the first transformation. After full bloom, properly fix the plants to facilitate subsequent seed collection.

[0047] Screening for positive strains:

[0048] After surface sterilization, the harvested T1 generation seeds were evenly sown on 1 / 2 MS selection medium containing 25 mg / L hygromycin. After 7-10 days of culture, positive transformants were selected based on resistance markers (characterized by dark green leaves, well-developed root systems, and vigorous growth). Candidate positive plants were transplanted to nutrient soil for further culture, and three generations (T3) were continuously screened using a single-plant harvesting method to obtain genetically stable homozygous lines. Genomic DNA was extracted, and PCR amplification was performed using primers specific to the target gene. The target band was detected by 1% agarose gel electrophoresis, with the original recombinant plasmid as a positive control and wild-type plants as a negative control, ultimately confirming the transgenic positive plants. Homozygous transgenic lines (OE-10-3, OE-10-19) were collected for subsequent phenotypic identification.

[0049] 5. Overexpression of Arabidopsis seedlings under different concentrations of stress treatment

[0050] Materials Preparation: Seeds of positive Arabidopsis thaliana lines (OE-10-3, OE-10-19) confirmed by molecular identification were selected as experimental materials. Seed sterilization followed a standard procedure: treatment with 75% ethanol for 1 min, treatment with 1% sodium hypochlorite solution for 7-8 min, and rinsing with sterile water 3-4 times. After sterilization, the seeds were vernalized at 4℃ for 2-3 days to break dormancy. 1 / 2 MS medium containing 0.15% water agar was used as the germination substrate. All operations were performed in a clean bench. Stress Treatment Design: Concentration gradients of NaCl (0, 100, 125, 150 mM) and mannitol (0, 100, 150, 200, 300 mM) were set to simulate salt stress and drought stress, respectively. Each petri dish was divided into 2-3 equal-area regions, with at least 30 seeds sown in each region. Each treatment was replicated 3 times. The cultivation conditions were controlled at 22℃ with a photoperiod of 16h light / 8h dark. Germination rate determination: Germination was recorded daily starting from the day after sowing, with the radicle breaking through the seed coat as the germination standard. The experiment was terminated when no new germination occurred for two consecutive days, and the final germination rate was calculated. During the experiment, care was taken to keep the petri dishes level and avoid interference from condensation. Seedling greenness rate was calculated at the end of the experiment, with the cotyledons unfolding and turning green as the survival standard.

[0051] Root phenotypic analysis: Healthy seedlings aged 7 days were selected and transplanted into 1 / 2 MS solid medium containing 125 mM NaCl or 200 mM mannitol. A vertical culture system was used, and the seedlings were cultured under identical environmental conditions for 14 days. Five to eight seedlings of uniform growth were selected from each treatment, and the taproot length was measured using professional image analysis software. The experiment was set up with three independent replicates to ensure data reliability. Quality control: All operations were strictly performed according to aseptic techniques. Contamination was checked regularly during the culture period, and abnormal samples were promptly disposed of. Data collection was performed using a double-blind method, independently by two researchers. Statistical analysis was conducted using one-way ANOVA, with a significance level set at P < 0.05. The experiment was replicated at least three times to ensure the scientific validity of the results.

[0052] Precautions: Maintain consistent environmental conditions during the experiment, avoiding fluctuations in temperature, light, etc. Petri dishes should be placed horizontally to prevent condensation interference. Data recording must be performed regularly and at fixed times to ensure the accuracy of the results. Any abnormal data must be replicated to eliminate the influence of random factors.

[0053] Experimental results: such as Figures 4-6As shown in the figure, the results of adding different concentrations of NaCl stress showed that the germination rate was not different on day 7 under 125 mM NaCl treatment. However, combined with the analysis of germination process and seedling greenness, the overexpression lines had better germination numbers and speed than the wild type, and the seedling greenness was significantly higher than that of the wild type. There was no obvious inhibitory or promoting effect under 100 mM stress treatment. Under 150 mM high salt conditions, the seedling greenness of all lines was less than 20%. Therefore, 125 mM was selected as the optimal salt stress concentration. Results of adding different concentrations of mannitol to stress showed that the overexpression lines under 200 mM mannitol treatment had a higher germination rate and number than the wild type, and the germination time was one day earlier than the wild type. The final seedling green rate reached 68.3%, which was 1.98 times that of the wild type (34.5%). Low concentrations of 100 mM and 150 mM stress treatments promoted seedling growth. Statistically, all seedlings survived on day 7 and there was no difference from the WT. Under the 300 mM high-osmotic condition, the seedling green rate of all lines was less than 16.6%. Therefore, 200 mM was selected as the appropriate drought stress concentration.

[0054] 6. Overexpression treatment of Arabidopsis thaliana during adult stage stress

[0055] Materials Preparation and Culture Conditions: Plump Arabidopsis seeds (including overexpression lines (OE-10-3, OE-10-19) and wild-type controls) were selected and sown on 1 / 2 MS solid medium. Vernalization was performed at 4℃ for 7 days to break dormancy. Uniformly growing seedlings were transplanted into 80mm diameter round pots, with 8-15 seedlings per pot, and three biological replicates were established. Culture conditions were set as follows: constant temperature 22℃, photoperiod of 16h light (15000 Lux) / 8h dark, and relative humidity 60±5%. The seedlings were covered with plastic wrap for 3-5 days after transplanting to maintain moisture. The wrap was removed when the seedlings reached the 4-leaf stage to ensure uniform growth.

[0056] Salt stress treatment protocol: Salt stress treatment was initiated when the plants reached 3 weeks of age. A 200mM NaCl solution was used for stress treatment. Specifically, regular watering was stopped, and 50mL of NaCl solution was applied every 3-5 days (adjusting according to pot volume to maintain consistency across treatment groups). The amount of water applied was controlled to ensure complete soil absorption without seepage from the bottom of the pot. Other culture conditions were kept constant during the treatment period, continuing for 2-3 weeks. After treatment, leaf samples from the same leaf position (2-3 replicates) were selected, flash-frozen in liquid nitrogen, and stored at -80℃ for later use.

[0057] Drought stress treatment plan: Apply drought stress treatment to 3-week-old plants. Completely stop watering for 2-3 weeks, until the plants show obvious wilting symptoms. Rewater before the plants show severe drought symptoms but are not yet fatal: the initial rewatering volume is 30% of the normal watering volume, gradually increasing to the normal watering volume over 5-7 days. Observe and record plant phenotypic changes daily during the treatment period, and statistically analyze the recovery rate and survival rate of each line after rewatering.

[0058] Quality control and precautions: Ensure consistent culture conditions for all treatment groups to avoid interference from environmental factors; strictly control the amount and frequency of NaCl solution irrigation during salt treatment; closely monitor plant condition during drought treatment to prevent irreversible damage; rehydration should be gradual to avoid sudden large-scale watering; properly label samples during collection to ensure accuracy of subsequent analysis; maintain consistent conditions between replicate groups for all operations.

[0059] Experimental results: such as Figure 7 As shown in the figure, before treatment with 200 mM NaCl, there were no significant differences in plant morphology between the wild-type (WT) and the two overexpression lines (OE-10-19 and OE-10-3). After salt stress treatment, the growth of WT plants was significantly inhibited, showing wilting of the whole plant and yellowing of leaves; in contrast, the overexpression lines only showed slight changes in leaf color and their growth was not affected. The results indicate that HaSnRK2 overexpression significantly enhances the salt stress tolerance of Arabidopsis thaliana.

[0060] 7. Assay of enzyme activities related to stress treatment in adult Arabidopsis thaliana plants.

[0061] Sample collection protocol: Leaf samples were systematically collected from wild-type and stress-treated plants during the experiment, including samples before treatment (0h), after treatment (salt stress group), and after rehydration in the drought stress group. Healthy leaves at the same leaf position were selected for sampling. Three biological replicates were set up for each treatment group, and each biological replicate contained three technical replicates. All samples were flash-frozen in liquid nitrogen immediately after collection and stored in an ultra-low temperature freezer at -80℃ for later use.

[0062] Measurement Indicators and Methods: The physiological indicators measured included SOD, POD, CAT, APX activities, and MDA content. All indicators were measured using the enzyme activity assay kit (microplate method) from Addison Biotechnology Co., Ltd., and the specific operation was strictly in accordance with the kit instructions.

[0063] Detection and analysis conditions: After enzyme extraction, the enzyme solution was loaded into 96-well microplates, and absorbance was measured using a Spark 2010 multi-functional microplate analyzer. Three technical replicates were set up for each sample to ensure data reliability. Data analysis was performed as above.

[0064] Experimental results: such as Figures 8-9 As shown.

[0065] Depend on Figure 8 The results showed that POD activity analysis revealed that the POD activity of OE-10-3 was significantly higher than that of WT (1.27 times) before stress. After salt stress, the POD activities of the two overexpressing lines reached 1.48 and 1.39 times that of WT, respectively. The SOD activity assay showed that there was no difference among the lines before stress, but after stress, the SOD activities of OE-10-19 and OE-10-3 increased by 1.59 and 1.16 times compared with WT, respectively. CAT activity analysis showed that before salt stress, the CAT activity in WT was significantly higher than that in OE-10-3, being 1.61 times higher. After stress, the CAT activity in OE-10-19 was significantly higher than that in WT, being 1.43 times higher. APX activity analysis showed that before stress treatment, there were significant differences in APX activity between WT and OE-10-19 and OE-10-3, with OE-10-19 and OE-10-3 being 1.24 times and 1.18 times higher than WT, respectively. After stress, the APX activities of OE-10-19 and OE-10-3 were significantly higher than those of WT, being 1.63 times and 1.26 times higher, respectively. Malondialdehyde (MDA) content determination results showed that even under non-stress conditions, the MDA level in WT was significantly higher than that in OE-10-19 (1.27 times higher). Following salt stress, this difference widened further, with the MDA content in WT reaching 1.78 and 1.89 times that of OE-10-19 and OE-10-3, respectively. The results indicate that HaSnRK2 overexpression can effectively alleviate salt stress-induced membrane lipid peroxidation damage.

[0066] Depend on Figure 9Before drought stress treatment, there were no differences in plant morphology and growth between the wild-type and the two overexpression lines. After 14 days of drought stress treatment, WT plants showed severe growth inhibition and dehydration symptoms, with some stems completely losing water. In contrast, the overexpression lines only showed slight purple discoloration and edge drying in the lowest rosette leaves, and their overall growth was not affected. Seven days after rehydration, the overexpression lines fully recovered their growth vigor, while the WT plants could not, indicating that HaSnRK2 overexpression significantly enhanced the drought tolerance and rehydration recovery ability of Arabidopsis thaliana. Further analysis of antioxidant enzyme activities revealed that POD activity in the overexpression lines was significantly higher than that in the wild type (OE-10-19: 2.29-fold; OE-10-3: 1.66-fold). After rehydration, the POD activity of the wild type continued to increase and significantly exceeded that of OE-10-19 (1.74-fold), while the overexpression lines showed a decreasing trend. SOD activity analysis showed that the activity of OE-10-19 was significantly higher than that of WT before treatment (1.28-fold of WT). After treatment, the SOD activities of the two overexpression lines reached 1.67-fold and 1.17-fold of the wild type, respectively. After rehydration, the SOD activity of the overexpression lines rapidly decreased to a level similar to that of WT. CAT activity analysis showed that the CAT activity of the overexpression lines increased by 1.52-1.70-fold compared to WT after treatment; meanwhile, APX activity increased by 1.50-1.67-fold. Seven days after rehydration, the CAT activity of OE-10-3 remained significantly higher than that of WT (1.22 times), while APX activity showed a differential response between the two lines: OE-10-19 maintained high activity (1.41 times that of WT), while OE-10-3 rapidly decreased (0.63 times that of WT). MDA content determination results showed that the MDA levels of WT after treatment were 4.20 times and 2.74 times that of OE-10-19 and OE-10-3, respectively. After rehydration, the MDA content of WT remained significantly higher than that of OE-10-19 (1.91 times), with no significant difference from OE-10-3. These results indicate that HaSnRK2 overexpression can effectively alleviate the damage caused by reactive oxygen species induced by salt and drought stress.

[0067] As shown in the above embodiments, this invention provides an overexpression vector for the sunflower HaSnRK2 gene. After genetic transformation of plants using the flower-dipping method, this overexpression vector is applied to the regulation of salt tolerance, drought tolerance, and rehydration. This invention significantly enhances the salt stress tolerance and drought tolerance of sunflower plants by overexpressing the sunflower HaSnRK2 gene, effectively mitigating the damage caused by reactive oxygen species induced by salt and drought stress.

[0068] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of the sunflower HaSnRK2 gene in regulating plant salt tolerance, characterized in that, Overexpression of the sunflower HaSnRK2 gene improves the plant's salt tolerance.

2. The application of the sunflower HaSnRK2 gene in regulating plant drought tolerance, characterized by: Overexpression of the HaSnRK2 gene in sunflower improves the plant's drought resistance.

3. The application of the sunflower HaSnRK2 gene in regulating the scavenging of reactive oxygen species in plants, characterized by: Overexpression of the sunflower HaSnRK2 gene reduces damage caused by reactive oxygen species.

4. The application according to claim 3, characterized in that, The damage caused by the reactive oxygen species was induced by salt stress and drought stress.

5. The application according to any one of claims 1 to 4, characterized in that, The method for overexpressing the sunflower HaSnRK2 gene includes the following steps: An overexpression vector for the sunflower HaSnRK2 gene was constructed, and the plants were genetically transformed using the flower-dipping method. Transgenic lines that overexpress the sunflower HaSnRK2 gene were screened, thus achieving overexpression of the sunflower HaSnRK2 gene in plants.

6. The application according to claim 5, characterized in that, The overexpression vector for the sunflower HaSnRK2 gene is pCAMBIA1300-HaSnRK2-GFP. The sunflower HaSnRK2 gene is cloned between the Bgl II and Xba I restriction sites of pCAMBIA1300-GFP using pCAMBIA1300-GFP as the original vector.

7. The application according to claim 6, characterized in that, The plants mentioned include Arabidopsis thaliana.

Images